Axin2 mutants and uses thereof
By detecting AXIN2 mutant proteins and nucleic acids, a biological model was constructed and wild-type AXIN2 expression was restored using gene editing technology. This solved the problem of insufficient fetal malformation diagnosis in existing technologies and enabled early diagnosis and treatment of embryonic developmental malformations.
Patent Information
- Application Number
- CN202211589650.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-12
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2042-12-12
AI Technical Summary
Current prenatal genetic diagnostic techniques are unable to effectively detect the genetic diagnosis of more than 60% of fetal malformations, resulting in the inability to determine the cause and affecting prenatal assessment and perinatal treatment.
We provide AXIN2 mutant protein and nucleic acid and their detection methods. We use techniques such as immunohistochemistry and Western blotting to detect AXIN2 protein and nucleic acid, construct biological models for drug screening, and use gene editing technology to restore wild-type AXIN2 expression and activity to prepare drugs for the prevention and treatment of embryonic developmental malformations.
It enables early diagnosis and effective treatment of embryonic developmental abnormalities. By detecting AXIN2 mutant protein and nucleic acid, it restores wild-type AXIN2 expression and activity, thus preventing and treating embryonic developmental abnormalities.
Smart Images

Figure BDA0003993463970000141 
Figure BDA0003993463970000142 
Figure BDA0003993463970000143
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the AXIN2 mutant and its applications. Background Technology
[0002] Birth defects are a global public health problem, affecting millions of newborns worldwide. Structural birth defects account for approximately 60-70% of all birth defects. These are fetal structural changes that occur in the uterus during pregnancy, and their clinical manifestations can range from single, minor structural defects to severe and fatal multi-system structural malformations. The incidence rate in live births is 3%, accounting for approximately 25% of perinatal mortality. Based on the systems involved, they can be classified as malformations of the central nervous system, face, chest, cardiovascular system, abdominal wall, digestive system, genitourinary system, and skeletal system. Other types include increased nuchal translucency (NT), cystic hygroma, fetal hydrops, and intrauterine growth restriction. When a fetus has two or more malformations simultaneously, it is called multiple malformations. The organ systems involved can occur randomly or according to certain patterns, presenting as various syndromes, sequence signs, syndromes, and malformation spectra.
[0003] Most fetal malformations occur early in the formation of major organ systems, and most can be detected through routine prenatal ultrasound. Further prenatal evaluation is required when a malformation is detected, and identifying the cause is a prerequisite for assessing pregnancy outcome, fetal prognosis, perinatal treatment, and genetic counseling. The causes of fetal malformations are complex, and currently known causes mainly include genetic factors, infections during pregnancy, medication use, exposure to teratogens or other toxic or harmful substances, and maternal factors (such as fetal alcohol syndrome and gestational diabetes mellitus). Genetic factors can be associated with various types of hereditary diseases, including chromosomal abnormalities, copy number variants (CNVs), and single-gene disorders. The remaining cases with unknown causes are defined as fetal malformations of unknown origin. Overall, among fetuses found to have abnormalities through prenatal ultrasound and other imaging examinations, approximately 30% have chromosomal karyotype abnormalities, and another 6% can be detected with pathogenic copy number variations through chromosomal microarray analysis (CMA). This means that currently, more than 60% of fetuses cannot obtain a clear genetic diagnosis through conventional prenatal genetic diagnostic techniques.
[0004] The discovery and detection of genes causing fetal malformations can enhance our understanding of embryonic development and provide guidance for prenatal diagnosis. Newly developed next-generation sequencing (NGS) technologies can precisely detect gene variants within the entire genome's 3 billion base pairs, offering technical convenience and feasibility for exploring and discovering pathogenic genes for genetic diseases. Among these, whole exome sequencing (WES), with its economic and efficient advantages, has been widely used in research on genetic and complex diseases. With the development of WES, more genes associated with fetal malformations will be discovered, leading to a deeper understanding of the genetic causes of these diseases. Summary of the Invention
[0005] The first aspect of the present invention is to provide a protein.
[0006] A second aspect of the present invention is to provide a nucleic acid encoding the first aspect of the present invention.
[0007] A third aspect of the present invention aims to provide substances for detecting proteins of the first aspect of the present invention and / or substances for detecting substances of the second aspect of the present invention for use in the preparation of products for diagnosing embryonic developmental abnormalities.
[0008] A fourth aspect of the present invention is to provide a method for constructing a biological model.
[0009] A fifth aspect of the present invention aims to provide the application of biological models in drug screening.
[0010] A sixth aspect of the present invention is to provide the use of substances that specifically alter the proteins of the first aspect of the present invention and / or the nucleic acids of the second aspect of the present invention in the preparation of medicaments for the prevention and / or treatment of embryonic developmental abnormalities.
[0011] The seventh aspect of the present invention is to provide a medicine.
[0012] An eighth aspect of the present invention is to provide a product.
[0013] The object of the ninth aspect of the present invention is to provide nucleic acid-related biomaterials related to the second aspect of the present invention.
[0014] The tenth aspect of this invention is to provide an application of AXIN2.
[0015] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0016] In a first aspect, the present invention provides a protein having at least one of the following mutations compared to the wild-type AXIN2 protein: p.G288A, p.R714W.
[0017] Preferably, the protein has any one of the following mutations compared to the wild-type AXIN2 protein: p.G288A or p.R714W.
[0018] Preferably, the protein has the following mutations compared to the wild-type AXIN2 protein: p.G288A and p.R714W.
[0019] Preferably, the amino acid sequence of the wild-type AXIN2 protein is shown in SEQ ID NO.2.
[0020] A second aspect of the invention provides a nucleic acid encoding a protein of the first aspect of the invention.
[0021] Preferably, the nucleic acid has at least one of the following mutations compared to the wild-type AXIN2 gene: c.863G>C or c.2140C>T.
[0022] Preferably, the nucleic acid has any one of the following mutations compared to the wild-type AXIN2 gene: c.863G>C or c.2140C>T.
[0023] Preferably, the nucleic acid has the following mutations compared to the wild-type AXIN2 gene: c.863G>C and c.2140C>T.
[0024] Preferably, the nucleotide sequence of the wild-type AXIN2 gene is shown in SEQ ID NO.1.
[0025] A third aspect of the present invention provides the use of at least one of (e1) to (e3) in the preparation of products for diagnosing embryonic developmental abnormalities;
[0026] (e1) A substance for detecting the protein of the first aspect of the present invention;
[0027] (e2) A substance for detecting nucleic acids according to the second aspect of the present invention;
[0028] (e3) Detection of substances in wild-type AXIN2.
[0029] Preferably, the substance for detecting the protein of the first aspect of the present invention is a substance for quantitatively detecting the protein of the first aspect of the present invention.
[0030] Preferably, the substance used to detect the protein of the first aspect of the present invention is selected from substances of one or more detection methods from the group consisting of: immunohistochemistry, Western blotting, and biochip methods.
[0031] Preferably, the immunohistochemical method is selected from: immunofluorescence assay, enzyme-linked immunosorbent assay (ELISA), and immunogold assay.
[0032] Preferably, the substance for detecting the protein of the first aspect of the present invention comprises a substance that is specific to the protein of the first aspect of the present invention.
[0033] Preferably, the substance specific to the protein of the first aspect of the present invention is any one of (a1) to (a3):
[0034] (a1) An antibody that specifically binds to the protein of the first aspect of the present invention;
[0035] (a2) A ligand protein or polypeptide that specifically binds to the protein of the first aspect of the present invention;
[0036] (a3) Non-protein compounds that specifically recognize the proteins of the first aspect of the present invention.
[0037] Preferably, the antibody includes at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody.
[0038] Preferably, the substance for detecting the nucleic acid of the second aspect of the present invention is a substance for quantitatively detecting the nucleic acid of the second aspect of the present invention.
[0039] Preferably, the substance used to detect the nucleic acid of the second aspect of the present invention is selected from one or more detection techniques or methods from the group consisting of: Northern blotting, PCR, and biochip methods.
[0040] Preferably, the substance for detecting the nucleic acid of the second aspect of the present invention includes probes, gene chips, PCR primers, etc. of the nucleic acid of the second aspect of the present invention.
[0041] Preferably, the substance for detecting the nucleic acid of the second aspect of the present invention comprises AXIN2-863G>C primer and / or AXIN2-2140C>T.
[0042] Preferably, the sequence of the AXIN2-863G>C primer is shown in SEQ ID NO.3 and SEQ ID NO.4.
[0043] Preferably, the sequence of the AXIN2-2140C>T primer is shown in SEQ ID NO.5 and SEQ ID NO.6.
[0044] Preferably, the substance for detecting wild-type AXIN2 includes a substance for quantitatively detecting wild-type AXIN2.
[0045] Preferably, the substance for detecting wild-type AXIN2 includes a substance that detects wild-type AXIN2 at the gene level and / or protein level.
[0046] Preferably, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarrays.
[0047] Preferably, the immunohistochemical method is selected from at least one of the following: immunofluorescence analysis, reverse enzyme-linked immunosorbent assay (ELISA), and immunogold assay.
[0048] Preferably, the substance for detecting wild-type AXIN2 is selected from at least one of the following groups: substances specific to wild-type AXIN2, such as antibodies (preferably monoclonal antibodies); probes specific to wild-type AXIN2, gene chips, PCR primers, etc.
[0049] Preferably, the product comprises at least one of reagents, reagent kits, test strips, chips, and systems.
[0050] Preferably, the test sample for the product is selected from at least one of blood, amniotic fluid, chorionic villus, umbilical cord blood, tissue, and cell samples.
[0051] The inventors discovered that patients with embryonic malformations exhibit the aforementioned gene mutations in their exons, specifically heterozygous and / or homozygous mutations; and / or decreased expression levels of wild-type AXIN2; and / or decreased activity of wild-type AXIN2 protein. Products prepared from substances for detecting the aforementioned nucleic acids and / or the aforementioned proteins and / or for detecting wild-type AXIN2 can be used for the diagnosis of embryonic malformations.
[0052] A fourth aspect of the present invention provides a method for constructing a biological model, comprising the following steps: causing the biological model to carry at least one of (b1) to (b4):
[0053] (b1) The protein of the first aspect of the present invention;
[0054] (b2) Nucleic acid of the second aspect of the present invention;
[0055] (b3) The expression level of wild-type AXIN2 is reduced;
[0056] (b4) The activity of wild-type AXIN2 protein is reduced.
[0057] Preferably, the wild-type AXIN2 described in (b3) comprises protein and nucleic acid.
[0058] Preferably, the expression level of wild-type AXIN2 is reduced by substances that degrade wild-type AXIN2 and / or substances that reduce the expression level of wild-type AXIN2.
[0059] Preferably, the activity of wild-type AXIN2 protein is reduced by substances that degrade wild-type AXIN2 protein and / or substances that inhibit the activity of wild-type AXIN2 protein.
[0060] Preferably, the biological model includes at least one of an animal model and a cell model; more preferably, the biological model includes an animal model.
[0061] Preferably, the animal model includes a zebrafish model.
[0062] Preferably, the biological model is an embryonic developmental malformation model.
[0063] A fifth aspect of the invention provides the application of a biological model in drug screening, said biological model carrying at least one of (b1) to (b4):
[0064] (b1) The protein of the first aspect of the present invention;
[0065] (b2) Nucleic acid of the second aspect of the present invention;
[0066] (b3) The expression level of wild-type AXIN2 is reduced;
[0067] (b4) The activity of wild-type AXIN2 protein is reduced.
[0068] Preferably, the wild-type AXIN2 described in (b3) comprises protein and nucleic acid.
[0069] Preferably, the expression level of wild-type AXIN2 is reduced by substances that degrade wild-type AXIN2 and / or substances that reduce the expression level of wild-type AXIN2.
[0070] Preferably, the activity of wild-type AXIN2 protein is reduced by substances that degrade wild-type AXIN2 protein and / or substances that inhibit the activity of wild-type AXIN2 protein.
[0071] Preferably, the biological model includes at least one of an animal model and a cell model; more preferably, the biological model includes a cell model.
[0072] Preferably, the animal model includes a zebrafish model.
[0073] Models carrying the aforementioned nucleic acids, proteins, reduced expression levels of wild-type AXIN2, and reduced activity of wild-type AXIN2 protein can serve as disease models related to c.863G>C and / or c.2140C>T. These disease models can then be used for scientific research, such as screening drugs to treat c.863G>C and / or c.2140C>T-related diseases.
[0074] Preferably, the biological model is an embryonic developmental malformation model.
[0075] Preferably, the drug is used to prevent and / or treat embryonic developmental abnormalities.
[0076] A sixth aspect of the present invention is to provide the use of at least one of (f1) to (f3) in the preparation of a medicament for the prevention and / or treatment of embryonic developmental abnormalities;
[0077] (f1) Substances that increase the expression level of wild-type AXIN2;
[0078] (f2) Substances that enhance the activity of wild-type AXIN2 protein;
[0079] (f3) Substances that specifically alter the protein of the first aspect of the present invention and / or the nucleic acid of the second aspect of the present invention.
[0080] As previously mentioned, patients with embryonic malformations carry the aforementioned gene mutations, which are heterozygous and / or homozygous mutations; and / or have reduced expression levels of wild-type AXIN2; and / or reduced activity of wild-type AXIN2 protein. Drugs that can restore the aforementioned nucleic acids or proteins to wild-type or non-pathogenic states, and / or increase the expression levels of wild-type AXIN2, and / or increase the activity of wild-type AXIN2 protein, have the potential to treat and / or prevent embryonic malformations.
[0081] Preferably, the specificity change is to restore the protein of the first aspect of the present invention and / or the nucleic acid of the second aspect of the present invention to the wild type.
[0082] Preferably, the substance that specifically alters the protein of the first aspect of the present invention and / or the nucleic acid of the second aspect of the present invention is a substance based on at least one gene editing method, including single-base gene editing, zinc finger nuclease (ZFN), transcription activation-like effector nuclease (TALEN), CRISPR / Cas9 (which can be combined with iPSC and AAV vector technology simultaneously).
[0083] A seventh aspect of the present invention is to provide a medicament comprising at least one of (f1) to (f3):
[0084] (f1) Substances that increase the expression level of wild-type AXIN2;
[0085] (f2) Substances that enhance the activity of wild-type AXIN2 protein;
[0086] (f3) Substances that specifically alter the protein of the first aspect of the present invention and / or the nucleic acid of the second aspect of the present invention.
[0087] Preferably, the specificity change is to restore the protein of the first aspect of the present invention and / or the nucleic acid of the second aspect of the present invention to the wild type.
[0088] Preferably, the substance that specifically alters the protein of the first aspect of the present invention and / or the nucleic acid of the second aspect of the present invention is a substance based on at least one gene editing method, including single-base gene editing, zinc finger nuclease (ZFN), transcription activation-like effector nuclease (TALEN), CRISPR / Cas9 (which can be combined with iPSC and AAV vector technology simultaneously).
[0089] Preferably, the drug is used to prevent and / or treat embryonic developmental abnormalities.
[0090] An eighth aspect of the present invention is to provide a product comprising at least one of (g1) to (g3):
[0091] (g1) Substances for detecting the protein of the first aspect of the present invention;
[0092] (g2) A substance for detecting nucleic acids according to the second aspect of the present invention;
[0093] (g3) Detection of substances in wild-type AXIN2.
[0094] Preferably, the product comprises (g1) or (g2).
[0095] Preferably, the product comprises at least two of (g1) to (g3).
[0096] Preferably, the product comprises at least one of a substance for detecting the protein of the first aspect of the present invention, a substance for detecting the nucleic acid of the second aspect of the present invention, and a substance for detecting wild-type AXIN2.
[0097] Preferably, the substance for detecting the protein of the first aspect of the present invention is a substance for quantitatively detecting the protein of the first aspect of the present invention.
[0098] Preferably, the substance used to detect the protein of the first aspect of the present invention is selected from substances of one or more detection methods from the group consisting of: immunohistochemistry, Western blotting, and biochip methods.
[0099] Preferably, the immunohistochemical method is selected from: immunofluorescence assay, enzyme-linked immunosorbent assay (ELISA), and immunogold assay.
[0100] Preferably, the substance for detecting the protein of the first aspect of the present invention comprises a substance that is specific to the protein of the first aspect of the present invention.
[0101] Preferably, the substance specific to the protein of the first aspect of the present invention is any one of (a1) to (a3):
[0102] (a1) An antibody that specifically binds to the protein of the first aspect of the present invention;
[0103] (a2) A ligand protein or polypeptide that specifically binds to the protein of the first aspect of the present invention;
[0104] (a3) Non-protein compounds that specifically recognize the proteins of the first aspect of the present invention.
[0105] Preferably, the antibody includes at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody.
[0106] Preferably, the substance for detecting the nucleic acid of the second aspect of the present invention is a substance for quantitatively detecting the nucleic acid of the second aspect of the present invention.
[0107] Preferably, the substance used to detect the nucleic acid of the second aspect of the present invention is selected from one or more detection techniques or methods from the group consisting of: Northern blotting, PCR, and biochip methods.
[0108] Preferably, the substance for detecting the nucleic acid of the second aspect of the present invention includes probes, gene chips, PCR primers, etc. of the nucleic acid of the second aspect of the present invention.
[0109] Preferably, the substance for detecting the nucleic acid of the second aspect of the present invention comprises AXIN2-863G>C primer and / or AXIN2-2140C>T.
[0110] Preferably, the sequence of the AXIN2-863G>C primer is shown in SEQ ID NO.3 and SEQ ID NO.4.
[0111] Preferably, the sequence of the AXIN2-2140C>T primer is shown in SEQ ID NO.5 and SEQ ID NO.6.
[0112] Preferably, the substance for detecting wild-type AXIN2 includes a substance for quantitatively detecting wild-type AXIN2.
[0113] Preferably, the substance for detecting wild-type AXIN2 includes a substance that detects wild-type AXIN2 at the gene level and / or protein level.
[0114] Preferably, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: immunohistochemistry, Western blotting, Northern blotting, PCR, and microarrays.
[0115] Preferably, the immunohistochemical method is selected from at least one of the following: immunofluorescence analysis, reverse enzyme-linked immunosorbent assay (ELISA), and immunogold assay.
[0116] Preferably, the substance for detecting wild-type AXIN2 is selected from at least one of the following groups: substances specific to wild-type AXIN2, such as antibodies (preferably monoclonal antibodies); probes specific to wild-type AXIN2, gene chips, PCR primers, etc.
[0117] Preferably, the product is used for the diagnosis of embryonic developmental abnormalities.
[0118] Preferably, the product comprises at least one of reagents, reagent kits, test strips, chips, and systems.
[0119] Preferably, the test sample for the product is selected from at least one of blood, amniotic fluid, chorionic villus, umbilical cord blood, tissue, and cell samples.
[0120] Preferably, the product also contains other substances for diagnosing embryonic developmental abnormalities.
[0121] Preferably, the aforementioned embryonic developmental malformations include at least one of the following: cleft lip and palate, tetralogy of Fallot, corneal leukoma, hypospadias, ventricular septal defect, diaphragmatic hernia, increased nuchal translucency (NT), and bipedalism.
[0122] A ninth aspect of the present invention provides a nucleic acid-related biomaterial related to the second aspect of the present invention, said biomaterial comprising at least one of (c1) to (c7):
[0123] (c1) An expression cassette containing the nucleic acid of the second aspect of the present invention;
[0124] (c2) A vector comprising the nucleic acid of the second aspect of the present invention;
[0125] (c3) A carrier containing the expression box described in (c1);
[0126] (c4) A transgenic cell line comprising the nucleic acid of the second aspect of the present invention;
[0127] (c5) A transgenic cell line containing the expression cassette described in (c1);
[0128] (c6) A transgenic cell line containing the vector described in (c2);
[0129] (c7) A transgenic cell line containing the vector described in (c3).
[0130] Preferably, the transgenic cell line does not contain propagation material.
[0131] The tenth aspect of the present invention is to provide an application of AXIN2.
[0132] Application of AXIN2 in any of (d1) to (d6):
[0133] (d1) Regulates the proliferative activity of embryonic stem cells;
[0134] (d2) Regulates late-stage death of embryonic stem cells;
[0135] (d3) Regulates the expression of the anti-apoptotic factor Bcl-2 in embryonic stem cells;
[0136] (d4) Regulates the expression of cleaved caspase-3, an apoptosis factor in embryonic stem cells;
[0137] (d5) A key factor regulating the Wnt / β-catenin signaling pathway in embryonic stem cells;
[0138] (d6) Regulates downstream molecules of the Wnt / β-catenin signaling pathway in embryonic stem cells;
[0139] The key factors of the Wnt / β-catenin signaling pathway include β-catenin and TCF4;
[0140] The downstream molecules of the Wnt / β-catenin signaling pathway include c-jun, c-myc, and cyclin D1.
[0141] Preferably, overexpression of AXIN2 can reduce embryonic stem cell proliferation activity, induce late embryonic stem cell death, reduce Bcl-2 expression, promote Cleaved Caspase-3 expression, reduce the expression of key factors in the Wnt / β-catenin signaling pathway of embryonic stem cells, and reduce the expression of downstream molecules of the Wnt / β-catenin signaling pathway of embryonic stem cells; while inhibiting AXIN2 expression can increase embryonic stem cell proliferation activity, reduce late embryonic stem cell death, promote Bcl-2 expression, reduce Cleaved Caspase-3 expression, promote the expression of key factors in the Wnt / β-catenin signaling pathway of embryonic stem cells, and promote the expression of downstream molecules of the Wnt / β-catenin signaling pathway of embryonic stem cells.
[0142] The beneficial effects of this invention are:
[0143] This invention discloses for the first time a protein containing at least one of the following mutations compared to the wild-type AXIN2 protein: p.G288A, p.R714W, and the nucleic acid encoding the protein. This protein and / or the nucleic acid encoding the protein are pathogenic factors of embryonic malformations. Embryonic malformations can be diagnosed by detecting this protein and / or the nucleic acid encoding the protein. The effects of preventing and / or treating embryonic malformations can be achieved by specifically altering this protein and / or the substance encoding the protein. Attached Figure Description
[0144] Figure 1 These are sanger validation diagrams of the AXIN2 gene mutation sites; Figure A is the sanger validation diagram (antisense strand) of the AXIN2 gene mutation site c.863G>C; Figure B is the sanger validation diagram (antisense strand) of the AXIN2 gene mutation site c.2140C>T.
[0145] Figure 2 This is a technical roadmap for in vitro experiments on the effects of the AXIN2 gene on cell development.
[0146] Figure 3 The following are the results of the effects of the AXIN2 gene on embryonic stem cells: A shows the mRNA expression levels of AXIN2 after interference and overexpression in embryonic stem cells (*P<0.05 compared to LV3-vector); B shows the cell proliferation activity of AXIN2 after interference and overexpression in embryonic stem cells (*P<0.05 compared to LV3-vector); C shows the statistical results of early and late apoptosis of cells after interference and overexpression of AXIN2 in embryonic stem cells (*P<0.05 compared to LV3-vector); D shows the expression levels of Cleaved caspase-3 after interference and overexpression of AXIN2 in embryonic stem cells (*P<0.05, *P<0.01 compared to LV3-vector).
[0147] Figure 4 These are electrophoresis results of zebrafish AXIN2 gene mutant embryos: A is the electrophoresis result of zebrafish AXIN2 gene homozygous mutant embryos; B is the electrophoresis result of zebrafish AXIN2 gene heterozygous mutant embryos.
[0148] Figure 5These are developmental examples of zebrafish homozygous mutant embryos at different stages: A is a developmental example of a zebrafish homozygous mutant embryo at 8 hpf; B is a developmental example of a zebrafish homozygous mutant embryo at 24 hpf; C is a developmental example of a zebrafish homozygous mutant embryo at 48 hpf; D is a developmental example of a zebrafish homozygous mutant embryo at 72 hpf; E is a developmental example of a zebrafish homozygous mutant embryo at 96 hpf. axin2+ / + represents the wild-type zebrafish control group, and axin2- / - represents the zebrafish homozygous mutant experimental group.
[0149] Figure 6 This is a statistical chart of phenotypic observations of zebrafish homozygous mutant embryos at various stages of microscopic morphology.
[0150] Figure 7 These are representative images of zebrafish heterozygous mutant and wild-type TU zebrafish embryos at different stages.
[0151] Figure 8 This is a comparison of heart rate data at different stages between zebrafish heterozygous mutant and wild-type TU zebrafish embryos: *** indicates p < 0.001; **** indicates p < 0.0001. Detailed Implementation
[0152] The present invention will be further described in detail below through specific embodiments.
[0153] Unless otherwise specified, the materials and reagents used in this embodiment are commercially available.
[0154] Terminology Explanation:
[0155] 1. gnomAD: https: / / gnomad.broadinstitute.org / , a population database that has currently collected data on 15,708 whole genomes and 125,748 exomes;
[0156] 2.1000 Genomes: https: / / www.internationalgenome.org / , the 1000 Genomes database, containing 2,504 sequencing samples;
[0157] 3. OMIM: https: / / www.omim.org / , an online database of human Mendelian genetics;
[0158] 4. BWA: http: / / bio-bwa.sourceforge.net / , software that aligns raw sequencing data to a reference genome;
[0159] 5. GATK: https: / / gatk.broadinstitute.org / hc / en-us, short for Genome Analysis Tool Kit, is a software for analyzing variant information from high-throughput sequencing data;
[0160] 6. VEP: Variant Effect Predictor, which annotates different types of mutations generated by second-generation testing, https: / / asia.ensembl.org / info / docs / tools / vep / index.html;
[0161] 7. SIFT, Polyphen2_HDIV, REVEL, MutationTaster, MetaSVM: Various hazard prediction software used to predict the hazards caused by mutations;
[0162] 8. ClinVar: https: / / www.ncbi.nlm.nih.gov / clinvar / , stores the relationship between human variant sites and phenotypes and provides supporting evidence;
[0163] 9. HGMD: http: / / www.hgmd.cf.ac.uk / ac / gene.php?, The Human Gene Mutation Database, collects mutations related to human genetic diseases;
[0164] 10. Orphanet: https: / / www.orpha.net / consor / cgi-bin / index.php, a database of rare human diseases;
[0165] 11. DDG2P: https: / / decipher.sanger.ac.uk / ddd / ddgenes, a database of genotypes and phenotypes related to developmental disorders;
[0166] 12. PCR: Polymerase chain reaction is a molecular biology technique used to amplify specific DNA fragments;
[0167] 13. CRISPR-Cas9: A genome editing technology developed from the acquired immune system unique to microorganisms such as bacteria and archaea;
[0168] 14. QPCR: Quantitative Real-time PCR, which uses PCR to quantitatively analyze specific DNA sequences in a sample.
[0169] 15.hpf: hours post-fertilization.
[0170] Example 1: Screening and Validation of Pathogenic Genes Leading to Fetal Malformations
[0171] 1. Sample collection
[0172] The inventors collected data from 56 families who visited the Guangzhou Women and Children's Medical Center between January 2016 and December 2018 due to recurrent fetal malformations (≥2 times) of unknown cause. These families had previously failed to identify the cause of the fetal malformations using conventional genetic testing methods such as chromosome karyotype analysis or CMA technology. Each recruited family retained a sample from at least one fetus with an abnormality. The average gestational age at amniocentesis in the enrolled families was 24 weeks (range 12–32 weeks), and the average maternal age was 29 years (range 22–39 years). Proband samples included chorionic villus sampling (n=7), amniotic fluid (n=19), umbilical cord blood (n=33), induced abortion tissue (n=1), and postnatal peripheral blood (n=2), with peripheral blood from both parents also collected for testing. All enrolled couples were not consanguineous and underwent detailed genetic counseling before and after exome sequencing. Simultaneously, peripheral blood samples were collected from 123 women who had previously given birth to children with congenital developmental defects and 100 women with no adverse reproductive history to conduct extended screening and verification of candidate pathogenic genes identified by WES. This invention was approved by the Ethics Committee of Guangzhou Women and Children's Medical Center, adhering to the standards set forth in the 1964 Declaration of Helsinki and its subsequent revisions. Informed consent was obtained from all participating individuals or their guardians. Clinical information, including age, sex, and clinical symptoms, was collected.
[0173] 2. Whole exome sequencing
[0174] The inventors used the SureSelect XT Human All Exon 50Mb V5 Kit (Agilent) capture chip to hybridize all DNA samples to obtain target region sequences, and performed paired-end 150bp sequencing on an Illumina HiSeq 2500 sequencer. The raw data obtained after sequencing was subjected to raw data quality control using fastp (V0.20) to remove reads containing adapters or low quality. The clean data after quality control was aligned to the human reference genome GRCH37 (hg19) using BWA (V0.7.17). Samtools (V1.9) and Picard software were used to sort the aligned data and label repetitive sequences. Finally, the HaplotypeCaller module of GATK (V3.8) was used to detect the variation information of the samples. The initial variation results were filtered to retain high-quality information, removing variations that met one of the following conditions: total mutation depth less than 10, genotype quality value less than 50, and alignment quality value less than 30. Variants were annotated using VEP (Variant Effect Predictor), along with information from disease databases, population frequency databases, hazard or conserved prediction software, and variant site databases. Population databases included 1000genomics, gnomAD, and local laboratory frequency databases. Hazard or conserved prediction software included SIFT, Polyphen2_HDIV, REVEL, MutationTaster, and MetaSVM. Variant site databases included ClinVar and HGMD, while disease databases included OMIM, Orphanet, MedGen, and DDG2P.
[0175] Through data analysis of all the above samples, priority was given to coding regions and splicing regions that may affect protein function, as well as variants with a population frequency of less than 0.05. The inventors applied WES technology to test 56 families with unexplained recurrent births of fetuses with abnormal phenotypes. Known pathogenic or potentially pathogenic variants associated with the abnormal fetal phenotype were detected in 14 families. The overall molecular diagnostic rate for Mendelian monogenic diseases was 25%, involving genes BBS7, L1CAM, NOTCH3, CEP290, ARX, AMPD2, EPHB4, COL1A1, TMEM231, ABCA12, DCHS1, ASPM, FG FR3, and EIF2B3. Among these, 7 cases were autosomal recessive, 2 were X-linked recessive, and 5 were autosomal dominant (2 inherited from a father or mother with the phenotype, and 3 were de novo). In six other families, variants of unknown clinical significance (VUS) related to fetal phenotype were detected, involving the genes ZIC3, PKD1, ABCA1, TSC2, ARHGAP29, and CCDC22. No clinically significant variants were detected in the remaining 36 families. Further analysis of data from these 36 families identified and screened six genes and their mutation sites related to oocyte maturation, cell cycle regulation, meiosis, and embryonic development in seven females, including AXNI2 (2 cases), POLG, PTPN13, NINL, SH3PXD2B, and KIAA1109.
[0176] 3. Validation of expanded screening of candidate pathogenic genes
[0177]
[0178] Table 1. Mutation sites of the AXIN2 gene
[0179]
[0180] Table 2. Major abnormal phenotypes in offspring of women carrying the AXIN2 gene mutation.
[0181]
[0182] Table 3 Information on samples carrying AXIN2 gene mutations
[0183]
[0184]
[0185] Example 2: Sanger sequencing verification
[0186] 1. DNA extraction: DNA was extracted from all samples using the QIAamp DNA Blood Mini Kit (method as per the instruction manual).
[0187] 2. Primer design and PCR reaction
[0188] a) Primer design: Based on the human genome reference sequence Hg19 / GRCH37, mutation site-specific primers were designed, as shown in Table 4.
[0189] Table 4. Specific primers for AXIN2-863G>C and AXIN2-2140C>T
[0190]
[0191] b) Reaction system: 3 μL MgCl2 (25 mM), 15 μL GC Buffer I, 3 μL dNTP (2.5 mM), 2 μL each of upstream and downstream primers (10 μmol / L), 0.1 μL Promega Taq DNA polymerase, 1 μL template DNA, and 7 μL ddH2O.
[0192] c) Reaction program: as follows: 94℃ for 3 min; 94℃ for 30 s, 59℃ for 30 s, 72℃ for 100 s, 30 cycles; 72℃ for 5 min; 10℃ for ∞.
[0193] 3. Sanger sequencing
[0194] The PCR amplification products from the 123 women who had previously given birth to children with congenital malformations and the 100 women with no adverse pregnancy history obtained in step 2 were directly subjected to DNA sequencing (ABI 3730 DNA Analyzer) to obtain sequencing results. Based on the sequencing results, the AXIN2 gene sequence of the above samples was compared, and the results are shown in Table 2: Six women who had previously given birth to children with congenital malformations had missense mutations c.863G>C and / or c.2140C>T in the AXIN2 gene (e.g., ...). Figure 1 As shown in the figure, the AXIN2 gene of 100 women with no adverse pregnancy history did not contain the missense mutations c.863G>C and / or c.2140C>T. Therefore, the missense mutations c.863G>C and / or c.2140C>T in the AXIN2 gene are pathogenic mutations leading to fetal malformations.
[0195] Example 3: Mechanism of AXIN2 gene in embryonic stem cell development
[0196] The inventors used human embryonic stem cells (H9 cells, purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences) to construct lentiviral vectors for AXIN2 gene interference and overexpression to silence and overexpress the AXIN2 gene in embryonic stem cells (experimental groups: normal control group, negative plasmid group (transfected with blank plasmid), AXIN2 gene interference group (AXIN2 gene interference sequence information: AXIN2-F 5'-ATCCAGTCGGTGATGGAGGA-3' (SEQ ID NO.7) and AXIN2-R 5'-GTTTCCGTGGACCTCACACT-3' (SEQ ID NO.8), target sequence: GCGATCTGTTAATCCTTATC (SEQ ID NO.9)), and AXIN2 gene overexpression group), and conducted experiments in three groups respectively. Cell proliferation and apoptosis were detected using the MTT assay and flow cytometry, respectively. Real-time quantitative PCR (qPCR) and Western blotting (WB) were used to detect changes in anti-apoptotic and apoptotic factors, as well as the expression of key factors and downstream molecules of the Wnt signaling pathway, in each group of cells. The regulatory mechanism of AXIN2 gene deficiency on embryonic stem cell development and differentiation was evaluated. Specific technical routes are as follows: Figure 2 qPCR results showed that, compared with the control blank vector group, the expression level of AXIN2 mRNA in embryonic stem cells was significantly decreased in the AXIN2 gene interference group (LV3-AXIN2RNAi), while the expression level of AXIN2 mRNA in embryonic stem cells was significantly increased in the AXIN2 gene overexpression group (LV5-AXIN2). Figure 3(A). Growth curves were plotted based on the MTT assay results. It was found that at 48 and 72 hours post-transfection, compared to the negative plasmid group (L3-vecto r), the AXIN2 gene interference group (LV3-AXIN2RNAi) showed increased cell proliferation activity, while the AXIN2 gene overexpression group (LV5-AXIN2) showed significantly decreased cell proliferation activity. Figure 3 (B) The regulatory role of the AXIN2 gene on apoptosis was investigated by flow cytometry. The results showed that, compared with other groups, the AXIN2 gene overexpression group (LV5-AXIN2) significantly induced late apoptosis in embryonic stem cells. Figure 3 (C). Western blot analysis (WB) was used to detect the expression of anti-apoptotic factors Bcl-2 and cleaved caspase-3 in embryonic stem cells after AXIN2 gene interference and overexpression. WB results showed that Bcl-2 expression was significantly enhanced in the AXIN2 gene interference group (LV3-AXIN2 RNAi), while Bcl-2 expression was significantly decreased in the AXIN2 gene overexpression group (LV5-AXIN2). Cleaved caspase-3 expression was significantly inhibited in the AXIN2 gene interference group (LV3-AXIN2 RNAi), while it was significantly upregulated in the AXIN2 gene overexpression group (LV5-AXIN2). Figure 3 (D). Using qPCR and Western blotting to detect key components of the Wnt / β-catenin signaling pathway, the mRNA and protein expression of β-catenin and TCF4 were found to be significantly increased in the AXIN2 gene interference group (LV3-AXIN2 RNAi) and significantly decreased in the AXIN2 gene overexpression group (LV5-AXIN2). Simultaneously, in the AXIN2 gene interference group (LV3-AXIN2 RNAi), the mRNA and protein levels of downstream molecules of the WNT / β-catenin signaling pathway, c-jun, c-myc, and cyclin D1, were significantly increased, while in the AXIN2 gene overexpression group (LV5-AXIN2), the mRNA and protein levels of c-jun, c-myc, and cyclin D1 were significantly decreased.
[0197] Example 4: Effects of maternal AXIN2 gene defects on offspring embryonic development
[0198] This embodiment uses zebrafish of the TU strain. Whole embryo in situ hybridization results showed significant expression of the AXIN2 gene in embryos at the 2-cell, 64-cell, 512-cell, and 75% epoch (8hpf) stages, confirming maternal expression of the AXIN2 gene in zebrafish. The inventors successfully constructed a zebrafish model with a double mutation of the AXIN2 gene using CRISPR Cas9 technology. Zebrafish homozygous mutants of axin2 (- / -) were self-crossed to produce offspring with the axin2- / - homozygous mutant genotype. Female zebrafish with the axin2 homozygous mutant genotype (- / -) were crossed with wild-type males (+ / +) to produce offspring with the axin2+ / - heterozygous mutant genotype. Embryos from these two groups were collected as the experimental group, while a control group of wild-type (+ / +) embryos was collected. Different indicators were observed at different developmental stages of zebrafish. The microscopic morphology of zebrafish embryos was observed under a stereomicroscope at five developmental stages: 8, 24, 48, 72, and 96 hpf. The observation sites were the head, heart, trunk, and tail. This study verified the developmental status of zebrafish embryos lacking maternal axin2 gene expression products, specifically the axin2- / - homozygous mutant and the axin2+ / - heterozygous mutant. Specifically, genomic DNA was extracted from the caudal fin tissue of six F1 generation adult zebrafish and subjected to PCR. The PCR products were recombined with a vector, and then single clones were selected for sequencing to confirm their allele genotypes. Three F1 generation zebrafish carrying the axin2 biallelic mutation were screened out. One group of embryos collected from the self-crossing of the zebrafish axin2 F3 generation homozygous mutant was used as the experimental group, and a group of TU wild-type embryos was collected as the control group. Sixteen 96hpf larvae from the experimental group were randomly selected for genotyping, confirming their genotype as axin2- / - homozygous mutation. (See below) Figure 4Based on different indicators observed at different developmental stages of zebrafish, the microscopic morphology of zebrafish axin2- / - homozygous mutant embryos was observed under a stereomicroscope at five developmental stages: 8 hpf, 24 hpf, 48 hpf, 72 hpf, and 96 hpf. 1) At 8 hpf, there was no significant difference between the homozygous mutant embryos and the wild type. Upon reaching 24 hpf (after the tunica vaginalis was removed), compared with the control group embryos, the homozygous mutant group showed developmental delay. In this experiment, a total of 192 embryos were counted in the experimental group. At the 24 hpf stage, 91 embryos showed developmental delay, and 101 embryos were normal, with a developmental delay rate of 47.4%. Morphological observation showed that at this time, the eyes of the control group zebrafish embryos were relatively well developed, while the eye development of the homozygous mutant group embryos was significantly delayed, and no lens and retinal structures as obvious as those in the wild type embryos were observed; the trunk development of the control group was normal, while the trunk development of the homozygous mutant group was slower and had not yet straightened. 2) At 48 hpf, 30 homozygous mutant embryos (30 / 192) showed mild pericardial edema, 62 (62 / 192) showed developmental delay, and the remaining 100 embryos (100 / 192) were normal. Wild-type embryos in the control group developed normally. 3) At 72 hpf, 65 homozygous mutant larvae in the experimental group showed pericardial edema (65 / 192), 30 (30 / 192) showed significant developmental delay, and the remaining 97 were normal (97 / 192). 4) At 96 hpf, 39 homozygous mutant larvae in the experimental group showed pericardial edema (39 / 192), 27 larvae that had previously shown pericardial edema died (27 / 192), 30 showed developmental delay (15.6%, 30 / 192), and the remaining 96 were normal (50.0%, 96 / 192). Preliminary microscopic observations of zebrafish axin2 homozygous mutant embryos lacking maternal axin2 gene expression products revealed that the absence of the maternal axin2 gene affects early embryonic development in zebrafish, specifically manifesting as developmental delay, pericardial edema, decreased heart rate, and subsequent death of some larvae that initially exhibited pericardial edema. Figure 5 , 6Morphological observation of the development of zebrafish heterozygous mutant embryos lacking maternal axin2 gene expression products was conducted by crossing homozygous female zebrafish (- / -) with wild-type male zebrafish (+ / +). The results showed that at 24 hpf, 99 heterozygous mutant embryos were counted in the experimental group, with 97 surviving (98% survival rate); 185 wild-type embryos were counted in the control group, with 182 surviving (98% survival rate). 1) At 24 hpf, 42 embryos (42 / 97) in the experimental group showed developmental delay, with development occurring around 20 hpf, while the control group's development occurred around 22 hpf, a difference of approximately 2 hpf. 2) At 48 hpf, there was no significant difference between the experimental and control groups. 3) At 72 hpf, there was no significant difference between the experimental and control groups. 4) At 96 hpf, there was no significant difference between the experimental and control groups. In other words, zebrafish heterozygous mutants lacking maternal axin2 gene expression products exhibit transient developmental abnormalities in early embryonic development. These abnormalities may include developmental delay (24 hpf) and cardiac arrhythmia (before 72 hpf). Specifically, at 24 hpf, heterozygous embryos lacking maternal axin2 gene expression products show developmental delay, which recovers at 48 hpf. At 48 hpf and 72 hpf, heterozygous embryos lacking maternal axin2 gene expression products exhibit cardiac arrhythmia, but after 96 hpf, the cardiac rate of heterozygous embryos is no longer significantly different from that of wild-type embryos. Figure 7 , 8Based on the above observations, it is speculated that, assuming normal expression of the axin2 zygotic gene, the absence of the maternal gene expression product in heterozygous mutants will not cause abnormal phenotypes such as developmental malformations seen in homozygous axin2 mutant embryos. However, in the early stages of embryonic development (before 24 hpf), the absence of the maternal axin2 expression product will affect zebrafish embryonic development, resulting in certain developmental delay phenotypes and abnormal heart rate. After reaching 48 hpf, the microscopic morphology and heart rate of the heterozygous embryos may gradually return to normal due to the normal expression of the axin2 heterozygous gene. This further illustrates the association between AXIN2 protein and embryonic malformations. Mutations or deletions of AXIN2 protein can cause embryonic malformations. Embryonic malformations can be diagnosed by detecting the expression levels of AXIN2 protein and / or the nucleic acid encoding AXIN2 protein, and / or the AXIN2 protein with the aforementioned point mutations (p.G288A and / or p.R714W) and / or the AXIN2 gene (c.863G>C and / or c.2140C>T). Correspondingly, increasing the expression levels of AXIN2 protein and / or the nucleic acid encoding AXIN2 protein, and / or restoring the AXIN2 protein with the aforementioned point mutations (p.G288A and / or p.R714W) and / or the AXIN2 gene (c.863G>C and / or c.2140C>T) to the wild type can achieve the effect of preventing and / or treating embryonic malformations.
[0199] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. The application of at least one of (e1) to (e2) in the preparation of products for diagnosing embryonic developmental abnormalities: (e1) Substances for detecting proteins; (e2) Detection of the substance encoding the nucleic acid of the protein; Compared with the wild-type AXIN2 protein, the protein exhibits the following mutations: p.G288A, p.R714W; The amino acid sequence of the wild-type AXIN2 protein is shown in SEQ ID NO:
2.
2. A method for constructing a biological model, comprising the following steps: causing the biological model to carry at least one of (b1) to (b2): (b1) Protein; (b2) The nucleic acid encoding the protein; Compared with the wild-type AXIN2 protein, the protein exhibits the following mutations: p.G288A, p.R714W; The amino acid sequence of the wild-type AXIN2 protein is shown in SEQ ID NO:2; The biological model is an embryonic developmental malformation model; The biological model is a zebrafish model.
3. Application of biological models in drug screening, wherein the biological model carries at least one of (b1) to (b2): (b1) Protein; (b2) The nucleic acid encoding the protein; Compared with the wild-type AXIN2 protein, the protein exhibits the following mutations: p.G288A, p.R714W; The amino acid sequence of the wild-type AXIN2 protein is shown in SEQ ID NO:2; The drug is used to prevent and / or treat embryonic developmental abnormalities; The biological model is a zebrafish model.
Citation Information
Patent Citations
Primer-probe combination for detecting expression level of human axin2 genes
CN105755142A