Primers for detecting and identifying Vibrio harveyi and their applications

Abstract

The present invention belongs to the technical field of detection of pathogenic microorganisms, and particularly relates to primers for detecting and identifying Vibrio harveyi and their applications. According to the conserved regions of the virulence genes of Vibrio vulnificus, the present invention designs a primer pair for detecting and identifying Vibrio vulnificus and a kit. The results show that when the primer pair of the present invention or the kit containing the primer pair is used to identify Vibrio vulnificus, it has strong specificity and high sensitivity, and has certain application value in the detection of Vibrio vulnificus in complex water bodies.

Description

Technical Field

[0001] The present invention belongs to the technical field of detection of pathogenic microorganisms, and particularly relates to primers for detecting and identifying Vibrio harveyi and their applications. Background Art

[0002] Vibrio is a "permanent resident" in the aquatic environment, which can symbiose with eukaryotes or cause diseases, leading to Vibrio infections and fatal foodborne diseases such as cholera, vibriosis, gastroenteritis, and septicemia, seriously affecting the development of the aquaculture industry and the safety of aquatic products. In recent years, Vibrio harveyi has become one of the most harmful bacterial pathogens in marine aquaculture, characterized by strong drug resistance, high toxicity, and the ability to infect multiple hosts. Moreover, there are currently no effective safety prevention and control measures, which not only pose a great threat to the safety of aquatic products but also cause huge economic losses to the marine aquaculture industry every year.

[0003] Once vibriosis breaks out, it is very difficult to control. Therefore, in the aquaculture industry, we adopt prevention-oriented prevention and control measures and need to conduct long-term real-time monitoring of the aquaculture water body. However, the current detection methods are not highly specific and are prone to false positives. Therefore, there is an urgent need to improve the specificity and sensitivity of Vibrio harveyi detection technology, which is crucial for monitoring the distribution of Vibrio harveyi pathogens, warning of the occurrence and prevalence of diseases, and effectively preventing and controlling the diseases.

[0004] luxR, toxRvh, chiA, serine protease, and vhh have been confirmed to be key virulence genes of Vibrio harveyi. Currently, there are few means for detecting and identifying Vibrio harveyi based on virulence genes. Therefore, designing detection means or detection systems for identifying Vibrio harveyi targeting characteristic virulence genes is the focus of the research and development of the present invention. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide primers for detecting and identifying Vibrio harveyi and their applications.

[0006] The present invention provides a primer pair for identifying Vibrio harveyi, which includes chiA-F and chiA-R.

[0007] Further, the nucleic acid of the chiA-F is as shown in SEQ ID NO:1; the nucleic acid of the chiA-R is as shown in SEQ ID NO:2.

[0008] Furthermore, the primer pair is designed according to the 1306-1424 conserved region of the virulence gene chiA of Vibrio harveyi, with a full length of 129bp, and has high specificity and sensitivity when used for the identification of Vibrio harveyi.

[0009] The present invention provides a kit, which comprises the primer pair described in the present invention and amplification reagents.

[0010] Furthermore, the amplification reagents include MgCl2, KCl, dNTP, AceTaq DNA Polymerase and ddH2O.

[0011] Moreover, the usage concentrations of the components in the kit respectively include: DNA template 2.0 - 4.0 μL, chiA-F 10 pmol / L, chiA-R 10 pmol / L, MgCl2 1.5 mmol / L, KCl 50 mmol / L, dNTP 250 μmol / L, AceTaq DNA Polymerase 0.2 U / mL.

[0012] The present invention provides the application of the primer pair described above, and / or the kit in the detection and identification of Vibrio harveyi.

[0013] The present invention provides a method for detecting and identifying Vibrio harveyi, which includes methods for detecting and identifying Vibrio harveyi for diagnostic and non-diagnostic purposes, and the present invention does not limit this. The non-diagnostic detection method includes detecting whether Vibrio harveyi is contained in environmental samples, food or drinking water.

[0014] Furthermore, the present invention provides a method for non-diagnostic detection and identification of Vibrio harveyi, which includes the following steps:

[0015] (1) Using the DNA sample as an amplification template, performing PCR amplification with the primer pair described in the present invention or the kit described in the present invention;

[0016] (2) Detecting the amplification product. If a 129-bp DNA fragment is amplified, the sample contains Vibrio harveyi; otherwise, the sample does not contain Vibrio harveyi.

[0017] Moreover, the DNA sample includes but is not limited to DNA purifications, crude extracts containing DNA or bacterial solutions, and the present invention does not limit this; the PCR amplification program includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min; repeating the above steps 30 times; extension at 72°C for 10 min; storing at 4°C.

[0018] The present invention designs a detection primer pair and a kit for detecting and identifying Vibrio vulnificus based on the conserved region of the virulence gene of Vibrio vulnificus. The results show that when using the primer pair described in the present invention or the kit containing the primer pair to identify Vibrio vulnificus, it has strong specificity and high sensitivity, and has certain application value in the detection of Vibrio vulnificus in complex water bodies. Description of the Drawings

[0019] Figure 1 Showing the primer design for the region 1306 - 1424 of the Vibrio harveyi virulence gene chiA;

[0020] Figure 2 Showing the amplification effect diagrams of 4 pairs of universal primers for virulence genes on Vibrio harveyi (V) and Pseudomonas piscicida (P);

[0021] Figure 3 Showing the gel electrophoresis diagram in the specificity evaluation experiment: Among them, the M lane is the DNA marker; the 1 - 6 lanes are Vibrio harveyi, Pseudomonas piscicida, Enterococcus faecalis, Bacillus subtilis, Vibrio parahaemolyticus, and Vibrio alginolyticus respectively; the C lane is the negative control;

[0022] Figure 4 Showing the sensitivity test of the detection kit. Adjust the concentration range of Vibrio harveyi to 1 - 10 8 CFU / mL;

[0023] Figure 5 Showing the application of the kit to actual aquaculture water and lake water. "+" means adding 10 4 CFU / mL of Vibrio harveyi, "-" means no Vibrio harveyi added, sterile water is used as the negative control, and 10 4 CFU / mL of Vibrio harveyi is used as the positive control. Specific embodiments

[0024] The present invention provides primers for detecting and differentiating Vibrio harveyi and their applications. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate alterations and combinations to the methods and applications in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0025] The sequence of the upstream primer chiA - F is: GAATGAGCCACAGTAAAGAG (as shown in SEQ ID NO:1); the sequence of the downstream primer chiA - R is: AAGATTGAAGACGTAGATTA (as shown in SEQ ID NO:2)

[0026] The test materials used in the present invention are all ordinary commercially available products and can be purchased in the market.

[0027] The following further elaborates the present invention in combination with embodiments:

[0028] Example 1 Specificity of the detection method

[0029] (1) Amplification specificity comparison of primers for traditional virulence genes:

[0030] Universal primers for four virulence genes, namely ToxR, chiA, trh, and serine (as shown in Table 1), were selected to investigate their specificity for detecting Vibrio harveyi and Pseudomonas piscicida. The experimental results showed ( Figure 2 ), the universal primers for these four independent genes could not specifically identify and detect Vibrio harveyi and Pseudomonas piscicida.

[0031] Table 1. Universal primers for four virulence genes, ToxR, chiA, trh, and serine

[0032] Primer name Sequence ToxR-F 5’-ATGGACTCAATTGCAAAGAG-3’ ToxR-R 5’-TTAGTGATGTTCACGGTTGT-3’ chiA-1F 5’-GGAAGATGGCGTGATTGACT-3’ chiA-1R 5’-GGCATCAATTTCCCAAGAGA-3’ trh-F 5’-CGACAACCAAAATACGGAA-3’ trh-R 5’-AGAGCAATTTGCTGAAGCTA-3’ serine-F 5’-TGCACGACCAGTTGCTTTAG-3’ serine-R 5’-AAGTGGTCGTCAGCAAATCC-3’

[0033] (2) To improve the detection specificity, in the present invention, the virulence gene chiA of Vibrio harveyi was used as the target gene, and the upstream primer chiA-F (5'-GAATGAGCCACAGTAAAGAG-3'), with the sequence number SEQ ID NO:1, and the downstream primer chiA-R (5'-AAGATTGAAGACGTAGATTA-3'), with the sequence number SEQ ID NO:2, were designed on the conserved region 1306 - 1434 of this gene. The selected positions are as Figure 1 shown, and the amplification length is 129bp. If a 129bp DNA fragment is amplified, the sample contains Vibrio harveyi; otherwise, the sample does not contain Vibrio harveyi. Six kinds of bacteria, namely Vibrio harveyi, Pseudomonas piscicida, Enterococcus faecalis, Bacillus subtilis, Vibrio parahaemolyticus, and Vibrio alginolyticus, were selected as experimental objects for primer specificity verification. The verification PCR system includes: 2.0 - 4.0 μL; chiA-F: 10 pmol / L; chiA-R: 10 pmol / L; 2×PCR Master Mix: 25 μL; add ddH2O to 50 μL. (Note: 2×PCR Master Mix consists of 3 mmol / L MgCl2, 100 mmol / L KCl, 500 μmol / L dNTP, and 0.4 U / mL AceTaq DNA Polymerase.) The PCR amplification program includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min; the above steps are cycled 30 times; extension at 72°C for 10 min; and preservation at 4°C.

[0034] As Figure 3As shown, lanes 1 - 6 of the SDS - PAGE electrophoresis correspond to Vibrio harveyi, Pseudomonas piscicida, Enterococcus faecalis, Bacillus subtilis, Vibrio parahaemolyticus, and Vibrio alginolyticus respectively. Lane C is the sterile water control. When diluting various genomes to 2.0 ng / μL, it was found that the primer pair targeting the virulence gene chiA was highly specific for Vibrio harveyi( Figure 3 ).

[0035] Example 2 Detection Sensitivity of the Detection Method

[0036] The designed detection primer pair and the amplification reagent were combined to form an amplification kit. The composition of the kit is shown in Table 2, and the addition amounts of each component in the detection PCR system are as shown in the verification PCR system of Example 1. The concentration range of Vibrio harveyi was adjusted to 1 - 10 8 CFU / mL to detect the sensitivity of the designed primer pair. The experimental results showed that the lowest detection concentration of this kit was as low as 3 CFU / mL( Figure 4 ), with high sensitivity.

[0037] Table 2. Composition and Usage Concentration of the Kit

[0038] Component Concentration chiA-1F 10 pmol / L chiA-1R 10 pmol / L <![CDATA[MgCl2]]> 1.5 mmol / L KCl 50 mmol / L dNTP 250 μmol / L AceTaq DNA Polymerase 0.2 U / mL <![CDATA[ddH2O]]>

[0039] Example 3 Detection Sensitivity of Vibrio harveyi in Aquaculture Water and Lake Water

[0040] The above - mentioned kit was applied to detect Vibrio harveyi in actual aquaculture water and lake water. The detection PCR system was the same as above. The aquaculture water and lake water were directly taken as the amplification templates for the detection of Vibrio harveyi. As Figure 5 shown, where "+" means adding 10 4 CFU / mL of Vibrio harveyi, "-" means no Vibrio harveyi was added, and sterile water was used as the negative control. The results showed that the said kit had certain application value in the detection of Vibrio harveyi in complex water bodies( Figure 5 ).

[0041] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A primer pair for identifying Vibrio harveyi, wherein the nucleic acid of the upstream primer is as shown in SEQ ID NO:1, and the nucleic acid of the downstream primer is as shown in SEQ ID NO:

2.

2. Kit, characterized in that, 2. Comprising the primer pair according to claim 1 and amplification reagents.

3. The kit according to claim 2, characterized in that, 3. The amplification reagents include MgCl2, KCl, dNTP and Taq DNA Polymerase.

4. Use of the primer pair according to claim 1 and / or the kit according to claim 2 for detecting and identifying Vibrio harveyi for non-diagnostic purposes.

5. A method for differentiating Vibrio harveyi for non-diagnostic purposes, characterized in that, 5. Comprising the following steps: (1) Using the DNA sample as an amplification template, performing PCR amplification with the primer pair according to claim 1 or the kit according to claim 2; (2) Detecting the amplification product, and judging whether Vibrio harveyi is contained in the sample according to the amplification situation of the sample.

6. The method according to claim 5, wherein 6. The DNA sample includes a DNA pure product, a crude extract containing DNA or a bacterial suspension.

7. The method according to claim 5, wherein 7. The reaction system of the PCR amplification includes: 2.0 - 4.0 μL of DNA template, 10 pmol / L of the upstream primer shown in SEQ ID NO:1, 10 pmol / L of the downstream primer shown in SEQ ID NO:2, 1.5 mmol / L of MgCl2, 50 mmol / L of KCl, 250 μmol / L of dNTP, 0.2 U / mL of AceTaq DNA Polymerase and ddH2O.

8. The method according to claim 5, characterized in that, 8. The procedure of the PCR amplification includes: Pre-denaturation at 94°C for 5 min; Denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for 30 cycles; Extension at 72°C for 10 min; preservation at 4°C.

9. The method according to claim 5, wherein the method of determination comprises:

9. If a 129-bp DNA fragment is amplified, the sample contains Vibrio harveyi; otherwise, the sample does not contain Vibrio harveyi.

Images