Osteoporosis therapeutic delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells

Abstract

The present invention discloses an osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells. The present invention achieves the weakening of osteoclast multinucleation and bone absorption ability and retains osteoclast precursor cell related functions by inhibiting circRNA in osteoclast precursor cells using siRNA. At the same time, the above siRNA is delivered to osteoclast precursor cells in a targeted manner using cell membrane microvesicles homologous to osteoclast precursor cells, achieving the effect of treating osteoporosis, and provides a preparation method and application thereof, which solves the technical difficulty that the existing treatment methods cannot selectively inhibit specific cell stages in the osteoclast lineage.

Description

Technical Field

[0001] The present invention relates to biomaterials and applications thereof, and in particular to an osteoporosis treatment delivery system based on osteoclast precursor cell-targeted circRNA knockdown. Background Art

[0002] Osteoporosis is a common chronic bone disease in clinical practice. Its low bone mass and severe destruction of bone microstructure often increase the brittleness and fragility of bones. As unique bone-absorbing cells, mature multinucleated osteoclasts secrete a large amount of enzymes and acids to perform bone absorption functions due to their high transcriptional activity. However, excessive multinucleation of osteoclasts can lead to an imbalance in bone homeostasis, which is the main factor causing osteoporosis. Currently, the first-line treatment for osteolytic diseases, such as bisphosphonates, indiscriminately inhibits the osteoclast lineage, leading to apoptosis of all bone-absorbing cells, thereby destroying the necessary bone turnover. Therefore, it is urgent to develop a therapeutic system to selectively target osteoclast precursor cells at disease-related specific stages in the osteoclast lineage.

[0003] Circular RNA (circRNA) is a covalently closed loop structure that can be reverse-spliced ​​by pre-mRNA and expressed during cell development and differentiation. Given that circRNAs are resistant to RNase R, they are more stable in cells and exosomes than corresponding linear transcripts. CircRNAs can be effective endogenous regulators in miRNA-mediated RNA interference (RNAi). Therefore, regulating circRNAs can effectively intervene in the differentiation process of cells. However, the development of nucleic acid drugs targeting circRNAs has become a difficult problem.

[0004] Cell membrane engineering has been widely used in various fields, ranging from drug delivery and imaging to photoactivated therapy. Biomimetic nanoparticles camouflaged with cell membranes impart cell-like functions, which prolongs the circulation of nanoparticles in the blood and allows them to escape clearance by the immune system. In addition, cancer cell membrane-coated nanoparticles can specifically target homologous cells because they inherit the necessary fusion proteins and adhesion molecules from cells. Therefore, homotypic targeted delivery of these cell membrane materials is an available strategy for future disease treatment.

[0005] However, although cell membrane engineering technology has been used in various fields, selective targeted delivery of cells at specific stages in the process of cell multinucleation has not yet been achieved. Osteoclast precursor cells are derived from macrophages induced by RANKL for 3 days and have specific proteins involved in osteoclast cycling, recruitment, cell-to-cell recognition and fusion. Therefore, fused cell membranes with specific stage markers contribute to the selective targeted delivery of osteoclast precursor cells.

[0006] Therefore, based on the above background, this patent discovered that circRNA and its human homologs specifically expressed by osteoclasts are prominently expressed during osteoclast multinucleation and osteoporosis. Among them, circBBS9 was selected as a verification object. However, how to achieve precise targeted delivery of circRNA at a specific time in vivo is a bottleneck problem that limits its application. In order to solve this shutdown problem, we innovatively took the lead in using osteoclast precursor cell membrane materials to carry siRNA. Osteoclast precursor cell membrane microvesicles can target osteoclast precursor cells. Among them, carrying siRNA circBBS9 The osteoclast precursor cell membrane microvesicles effectively inhibited the multinucleation and bone resorption ability of osteoclasts without affecting the differentiation of precursor osteoclasts, and increased the bone density of osteoporotic mice in in vivo experiments.

[0007] In summary, osteoclast precursor cell membrane microvesicles loaded with siRNA-circRNA can be used for clinical research on nucleic acid drugs for osteoporosis. Summary of the invention

[0008] The present invention aims to solve the technical problem that the existing delivery system does not have the ability to efficiently and specifically target cells at a specific stage in the osteoclast lineage, and provides an osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] An osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells, comprising siRNA and cell membrane microvesicles targeting osteoclast precursor cells; using cell membrane microvesicles targeting osteoclast precursor cells to deliver siRNA in a targeted manner to osteoclast precursor cells;

[0011] The siRNA is a specific siRNA for circBBS9, and its nucleotide sequence is shown in SEQ ID NO.5 and SEQ ID NO.6; the circBBS9, its nucleotide sequence is shown in SEQ ID NO.1;

[0012] The method for preparing cell membrane microvesicles targeting osteoclast precursor cells is as follows:

[0013] (1) extracting mammalian monocytes, inducing them with 15-30 ng / mL M-CSF for 3-5 days to obtain macrophages, and then inducing them with 30-80 ng / mL RANKL for 3-5 days to obtain osteoclast precursor cells;

[0014] (2) washing, after the trypsin digestion, specifically after 3 to 5 minutes of trypsin digestion, the digestion is terminated and the cells are centrifuged at 1000 rpm for 5 minutes, and the cells are resuspended in 4°C TM buffer, wherein the TM buffer is a mixture of 1 mM MgCl2 and 10 mM Tris added to water, and the pH is adjusted to 7.4; after resuspending, the cells are squeezed out 30 to 40 times using a micro syringe to destroy the cells to obtain a cell homogenate;

[0015] (3) Add 1 M sucrose and mix with the cell homogenate to reach a final concentration of 0.25 M sucrose;

[0016] (4) centrifuging the mixture obtained in step (3) at 4°C and 2000 x g for 10 min, collecting the supernatant, centrifuging at 4°C and 3000 x g for 30-35 min, resuspending the precipitate in 0.25 M sucrose solution, washing it, and centrifuging again at 4°C and 3000 x g for 30-35 min to obtain a cell membrane;

[0017] (5) The obtained cell membrane is extruded through 400 nm and 200 nm polycarbonate filter membranes 5 to 10 times in sequence using an extruder to obtain cell membrane nanovesicles that can target osteoclast precursor cells.

[0018] Preferably, the mammalian monocytes are monocytes from the tibia and femur of 6-8 week old C57BL / 6J mice.

[0019] Preferably, the micro syringe is a 1 mL insulin syringe.

[0020] Preferably, the M-CSF concentration is 25 ng / mL.

[0021] Preferably, the concentration of RANKL is 50 ng / mL.

[0022] Preferably, the circBBS9 is used as an osteoporosis intervention target, and miR-423-3p is its downstream target.

[0023] Preferably, the siRNA expression vector is bionic bone-targeted nanoparticles.

[0024] Beneficial effects of the present invention:

[0025] Compared with existing osteoporosis drug treatments, the osteoclast precursor cell membrane microvesicle material of the present invention has significant improvements in:

[0026] 1) circRNA has good stability and is highly expressed during the multinucleation of osteoclast precursor cells. Intervention can inhibit osteoclast multinucleation and bone resorption ability while retaining the differentiation of osteoclast precursor cells.

[0027] 2) Using osteoclast precursor cells as raw materials, the extracted osteoclast precursor cell membrane microvesicles have the characteristics of good stability, good biocompatibility and low immunogenicity, providing an effective means for targeting osteoclast precursor cells.

[0028] 3) The osteoclast precursor cell membrane microvesicle material has obvious in vivo and in vitro targeting effect on osteoclast precursor cells. Combined with the specific expression pattern of circRNA, it solves the problem of non-selective destruction of osteoclast lineage by traditional drugs, thus having the prospect of becoming an efficient targeted nano-delivery system for the treatment of osteoporosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is the differential expression of circBBS9 in osteoclast multinucleation.

[0030] Figure 2 is the expression level of circBBS9 human homolog in the lumbar vertebrae of osteoporosis patients and normal subjects.

[0031] Figure 3 This is the expression level diagram of circBBS9 after RNase R digestion.

[0032] Figure 4 siRNA circBBS9 Knockdown effect on circBBS9.

[0033] Figure 5 Transfection of siRNA circBBS9 The effect of PD-1 on the expression of marker genes at different differentiation stages of osteoclasts.

[0034] Figure 6 siRNA circBBS9 TRAP staining at different stages of osteoclasts after transfection.

[0035] Figure 7 siRNA circBBS9 Bone resorption effect after transfection in different stages of osteoclasts.

[0036] Figure 8 siRNA circBBS9 Western Blot results and statistical graphs of the inhibitory effect on osteoclast marker proteins.

[0037] Fig. 9 This is the cryo-electron microscopy and particle size distribution of extracted osteoclast precursor cell membrane microvesicles.

[0038] Fig.10 Is loaded with siRNA circBBS9 TRAP staining of osteoclast precursor cell membrane microvesicles on the inhibitory effect of osteoclast formation.

[0039] Fig.11 Is loaded with siRNA circBBS9 Figure 3. RT-qPCR results of osteoclast precursor cell membrane microvesicles on key genes of osteoclast formation.

[0040] Fig.12 Is loaded with siRNA circBBS9 The inhibitory effect of osteoclast precursor cell membrane microvesicles on osteoclast bone resorption ability.

[0041] Fig.13 It is the specific entry effect of osteoclast precursor cell membrane microvesicles loaded with siRNA on osteoclast precursor cells in vitro.

[0042] Fig.14 This is the fluorescence distribution and statistical graph of various tissues of osteoclast precursor cell membrane microvesicles loaded with siRNA in the in vivo imaging experiment of mice.

[0043] Fig.15 This is a fluorescence co-localization image of osteoclast precursor cell membrane microvesicles loaded with siRNA and osteoclast precursor cell marker proteins in mouse bone sections.

[0044] Fig.16 Yes, it carries siRNA circBBS9 The therapeutic effect of osteoclast precursor cell membrane microvesicles on bone morphology in osteoporotic mice.

[0045] Fig.17 Is loaded with siRNA circBBS9 The inhibitory effect of osteoclast precursor cell membrane microvesicles on the number and morphology of osteoclasts in osteoporotic mice. DETAILED DESCRIPTION

[0046] The following is a further description of a circRNA-based osteoclast precursor selective inhibition delivery system and a preparation method thereof provided by the present invention in conjunction with the examples, but the following examples cannot be regarded as limiting the scope of protection of the present invention.

[0047] The present invention aims to solve the problem of non-specific osteoclast lineage targeting of existing drugs and provides a delivery system for selective inhibition of osteoclast precursors based on circRNA and a preparation method and application thereof.

[0048] Example 1 Analysis of the expression of circBBS9 in osteoclasts and osteoporosis patients

[0049] 1. The present invention uses RNA-seq to detect differentially expressed circRNAs during osteoclast multinucleation.

[0050] 2. Design specific primers based on the obtained circRNA, and use RT-qPCR to verify the expression levels of these primers. The results showed that the expression level of circBBS9 increased significantly after RANKL stimulation.

[0051] 3. Using circBBS9-specific reverse primers, the expression of circBBS9 in osteoporotic mice and osteoclast differentiation was analyzed by RT-qPCR. It was found that the upregulation trend of circBBS9 was most obvious on the third day after RANKL stimulation (osteoclast multinucleation stage). Figure 1 The sequence is shown in (SEQ ID NO.1). The primers used are shown in (SEQ ID NO.2) and (SEQ ID NO.3).

[0052] mmu_circ_0001757 (SEQ ID NO.1)

[0053] GTGGCTGTACTCCAATCCCAGAGTCAGACCTAGAGGAAAGGTCACTAGATGACTCCACAGAGCTGTTTACCAACCACAAGCACCTCATGACCGAGCCCCCCATGCCTGAAGTCTCAGCCCGCCAAGGAGTTTTGGAATAGTCTGGAGTAATGCTAATGAGTTGAGGGGAGAGGCCATTACAGAGGCTACCCTGTCTGGACACTGTGTTCCCATCCCGGTGCTGTGCCAAGCTCATCTCTGGAG

[0054] primer-circBBS9-F(SEQ ID NO.2)

[0055] TGGAGTAATGCTAATGAGTTGAGG

[0056] primer-circBBS9-R(SEQ ID NO.3)

[0057] GCTGAGACTTCAGGCATGG

[0058] 4. We searched for human homologs of circBBS9 in the circBase database and found hsa_circ_0134188. We designed specific primers and measured its expression in the lumbar spine of healthy people and osteoporosis patients, and found that hsa_circ_0134188 was significantly highly expressed. We detected human peripheral blood mononuclear cells and osteoclasts derived from peripheral blood mononuclear cells and found that hsa_circ_0134188 expression was significantly increased. The results are as follows Figure 2Its sequence is shown in (SEQ ID NO.4).

[0059] hsa_circ_0134188 (SEQ ID NO.4)

[0060] GTGGTTGTACTACAATCCCAGAGTCAGACCTAGAAGAAAGATCAGTAGAACAAGACTCTACAGAACTGTTTACCAACCACAGACATCTCACTGCAGAGACACCCAGGCCTGAAGTTTCACCCCTCCAAGGAGTCTCGGAATAATTCAAGTAGAGTTGTTTGG TTGAGAGGAACATCCCCATCTCAAGGCCGAACCTGTGTGAACCTCATGCCAAGCACAGATATAGGGCTGGCGCAGGTGCTTCCTAAAGCTCACCTTCCTGGATGACATGCATAGAAAGAGGGGTTGGGACTTTTTACTTCACTAGGAGAACTTGTAACAC CATGGGGAAGTCAGCTGAAACTTGTCTTGTTTTGCCAGGAAAGGAAGTAGTTGCCTTTGGTCATCCATCTGCTAATAGTCACAGAATACAGTGAAATGACATAGTTTTGGGTTAGATTTTATAATGCAAAGATTCAGATCCAAAATAATTTCATACCCCATT TTTTCACAGAATTCTTATATAGTAAATGTATCAAGTTTAATAAAAGCATCTCATTGTCAAAATAATATCTTGGATTTTATTTATAATTAGAGGGATTTATGAGTGATTGCTCTACATTATTTCTTCAAAGGAAAGGAAAGGAATTGAAGACTTTGCTACTCTCTG

[0061] 5. After extracting osteoclast lysate, RNase R was used for digestion, and then the expression of circBBS9 was measured by RT-qPCR. It was found that circBBS9 had stronger stability than GAPDH and its linear mRNA. Figure 3 shown.

[0062] Example 2 Transfection of siRNA circBBS9 Effects of different differentiation stages of osteoclasts

[0063] 1. Design siRNA specific for circBBS9, whose sequences are shown in (SEQ ID NO.5) and (SEQ ID NO.6). Figure 4 siRNA circBBS9 The expression of circBBS9 and its linear transcript was measured after transfection, and it was found that circBBS9 was significantly inhibited while its linear transcript was not affected.

[0064] siRNA-circBBS9-sense(SEQ ID NO.5):

[0065] CUCUGGAGGUGGCUGUACUTT

[0066] siRNA-circBBS9-antisense(SEQ ID NO.6):

[0067] AGUACAGCCACCUCCAGAGTT

[0068] 2. After stimulating BMMs with RANKL for three days, transfect siRNA into them circBBS9 RT-qPCR was used to analyze the marker genes of osteoclasts at different differentiation stages. circBBS9 After the osteoclasts were induced, the marker genes of osteoclasts in the multinucleation stage were significantly suppressed, while the marker genes of osteoclast precursors did not change significantly. Figure 5 .

[0069] 3. Transfect siRNA on the 1st, 3rd or 5th day after RANKL stimulation circBBS9 , and TRAP staining was performed on the sixth day, and it was found that siRNA was transfected on the third day. circBBS9 The formation of multinuclear osteoclasts was significantly inhibited. Figure 6 Shown

[0070] 4. Transfect siRNA on day 1, day 3, or day 5 after RANKL stimulation circBBS9 , and bone resorption capacity was tested on the sixth day. It was found that after transfection with siRNA on the third day circBBS9 Significantly inhibit the bone resorption pit area of ​​osteoclasts.

[0071] The results are as follows Figure 7 Shown

[0072] 5. Transfection of siRNA on day 3 after RANKL stimulation circBBS9 On the sixth day, cell lysate was extracted and siRNA was found by WB analysis. circBBS9 Significantly weakened osteoclast maturation-related proteins. Figure 8 shown.

[0073] Example 3 Preparation of osteoclast precursor cell membrane microvesicles

[0074] Collection of osteoclast precursor cells: Femurs and tibias of 6-8 week old C57BL / 6J mice were taken, and the bone marrow cavity was flushed with α-MEM + 10% FBS + penicillin G and streptomycin (complete α-MEM medium). The flushed cells were cultured in complete α-MEM medium containing 25ng / mL M-CSF for 5 days, during which the medium was changed once to obtain macrophages. The obtained macrophages were cultured in complete α-MEM medium containing 25ng / mL M-CSF and 50ng / mL RANKL for 3 days to obtain osteoclast precursor cells.

[0075] Preparation of osteoclast precursor cell membranes: Osteoclast precursor cells were suspended in ice-cold TM buffer solution (pH 7.4; 1 mM MgCl2 + 10 mM Tris) and extruded at least 30 times by a micro extruder to destroy the cells. The cell homogenate was then mixed with 1 M sucrose to a sucrose concentration of 0.25 M, and the mixture was centrifuged at 4°C, 2000 x g for 10 minutes. The resulting supernatant was collected and further centrifuged at 4°C, 3000 x g for 30 minutes. The resulting precipitate was the collected cell membrane, and was washed twice with ice-cold 0.25 M sucrose for purification.

[0076] Preparation of osteoclast precursor cell membrane microvesicles: The obtained cell membrane is squeezed through 400 nm and 200 nm polycarbonate filter membranes in sequence, and the extrusion is repeated 5-10 times to obtain osteoclast precursor cell membrane microvesicles.

[0077] Example 4 Preparation of osteoclast precursor cell membrane microvesicles

[0078] Collection of osteoclast precursor cells: Femurs and tibias of 6-8 week old C57BL / 6J mice were taken, and the bone marrow cavity was flushed with α-MEM + 10% FBS + penicillin G and streptomycin (complete α-MEM medium). The flushed cells were cultured in complete α-MEM medium containing 15ng / mL M-CSF for 5 days, during which the medium was changed once to obtain macrophages. The obtained macrophages were cultured in complete α-MEM medium containing 15ng / mL M-CSF and 30ng / mL RANKL for 3 days to obtain osteoclast precursor cells.

[0079] Preparation of osteoclast precursor cell membranes: Osteoclast precursor cells were suspended in ice-cold TM buffer solution (pH 7.4; 1 mM MgCl2 + 10 mM Tris) and extruded at least 30 times by a micro extruder to destroy the cells. The cell homogenate was then mixed with 1 M sucrose to a sucrose concentration of 0.25 M, and the mixture was centrifuged at 4°C, 2000 x g for 10 minutes. The resulting supernatant was collected and further centrifuged at 4°C, 3000 x g for 30 minutes. The resulting precipitate was the collected cell membrane, and was washed twice with ice-cold 0.25 M sucrose for purification.

[0080] Preparation of osteoclast precursor cell membrane microvesicles: The obtained cell membrane is squeezed through 400 nm and 200 nm polycarbonate filter membranes in sequence, and the extrusion is repeated 5-10 times to obtain osteoclast precursor cell membrane microvesicles.

[0081] Example 5 Preparation of osteoclast precursor cell membrane microvesicles

[0082] Collection of osteoclast precursor cells: Femurs and tibias of 6-8 week old C57BL / 6J mice were taken, and the bone marrow cavity was flushed with α-MEM + 10% FBS + penicillin G and streptomycin (complete α-MEM medium). The flushed cells were cultured in complete α-MEM medium containing 30ng / mL M-CSF for 5 days, during which the medium was changed once to obtain macrophages. The obtained macrophages were cultured in complete α-MEM medium containing 30ng / mL M-CSF and 80ng / mL RANKL for 3 days to obtain osteoclast precursor cells.

[0083] Preparation of osteoclast precursor cell membranes: Osteoclast precursor cells were suspended in ice-cold TM buffer solution (pH 7.4; 1 mM MgCl2 + 10 mM Tris) and extruded at least 30 times by a micro extruder to destroy the cells. The cell homogenate was then mixed with 1 M sucrose to a sucrose concentration of 0.25 M, and the mixture was centrifuged at 4°C, 2000 x g for 10 minutes. The resulting supernatant was collected and further centrifuged at 4°C, 3000 x g for 30 minutes. The resulting precipitate was the collected cell membrane, and was washed twice with ice-cold 0.25 M sucrose for purification.

[0084] Preparation of osteoclast precursor cell membrane microvesicles: The obtained cell membrane is squeezed through 400 nm and 200 nm polycarbonate filter membranes in sequence, and the extrusion is repeated 5-10 times to obtain osteoclast precursor cell membrane microvesicles.

[0085] like Fig. 9As shown, the osteoclast precursor cell membrane microvesicles prepared in this example were detected by cryo-TEM and laser particle size analyzer, indicating that the osteoclast precursor cell membrane microvesicles were lipid bilayers with spherical structures. The particle size of the osteoclast precursor cell membrane microvesicles was about 141.9 nm.

[0086] Experimental Example 1: Carrying siRNA circBBS9 Evaluation of the ability of osteoclast precursor cell membrane microvesicles to inhibit osteoclast multinucleation and bone resorption.

[0087] As in Example 1, the osteoclast precursor cell membrane (1 mg / mL) was mixed with siRNA circBBS9 40μg / mL, mixed in equal volumes, sonicated for 5 minutes, and then squeezed through 400nm and 200nm polycarbonate filters 5-10 times. siRNA NC The macrophage membrane group was used as the control group. circBBS9 The osteoclast precursor cell membrane microvesicles were co-cultured with osteoclast precursor cells for 4 hours. After 24 hours, the number of mature osteoclasts in each group was detected by TRAP staining. Fig.10 As shown, loaded with siRNA circBBS9 The osteoclast precursor cell membrane microvesicles significantly inhibited the formation of multinuclear osteoclasts. The formation of osteoclasts was detected by RT-qPCR. Fig.11 As shown, loaded with siRNA circBBS9 The osteoclast precursor cell membrane microvesicles significantly reduced the expression of osteoclast maturation-related genes. The bone resorption environment was simulated in vitro using bone resorption slices to evaluate the osteoclast bone resorption function. Fig.12 As shown, loaded with siRNA circBBS9 The osteoclast precursor cell membrane microvesicles significantly inhibited the bone resorption ability of osteoclasts.

[0088] Experimental Example 2: Evaluation of targeting ability of osteoclast precursor cell membrane microvesicles in vivo and in vitro

[0089] In vitro targeting ability test of osteoclast precursor cell membrane microvesicles: 1 mg / mL of osteoclast precursor cell membrane obtained in Example 1 was mixed with siRNA cy5 The mixture was mixed with 40 μg / mL of equal volume, sonicated for 5 minutes, and then squeezed through 400 nm and 200 nm polycarbonate filters 5-10 times. It was incubated with macrophages, osteoclast precursor cells, and osteoclasts for 12 hours. The intracellular fluorescence intensity was analyzed using confocal microscopy and flow cytometry. The results are shown in Fig.13 As shown, osteoclast precursor cell membrane microvesicles loaded with siRNA can selectively enter osteoclast precursor cells but not macrophages or osteoclasts.

[0090] Establishment of osteoporosis animal model in mice: C57BL / 6J mice (female, 11 weeks) were anesthetized with 4% chloral hydrate, and bilateral ovariectomy was performed after skin disinfection to induce osteoporosis. After 8 weeks, the decrease of bone mass index detected by microCT indicated that the model was successfully established.

[0091] Detection of in vivo targeting ability of osteoclast precursor cell membrane microvesicles: 1 mg / mL of osteoclast precursor cell membrane obtained in Example 1 was mixed with 2.5 mg / mL of indocyanine green (ICG) in equal volumes, ultrasonically treated for 5 minutes, and then squeezed through 400nm and 200nm polycarbonate filter membranes 5-10 times in sequence. The simple ICG and macrophage membrane groups served as the control groups. After the osteoporosis mouse model was successfully established, the ICG wrapped in the osteoclast precursor cell membrane was injected into the tail vein. After 6 hours, 1 day, and 3 days, the fluorescence intensity of the heart, liver, spleen, kidneys, lower limbs and spine was detected using a small animal in vivo imaging device, using an excitation wavelength of 710nm and an emission wavelength of 785nm. The results are as follows: Fig.14 As shown, at each time period, the fluorescence intensity of both lower limbs and spine of mice in the osteoclast precursor cell membrane group was significantly higher than that in the control group, indicating that osteoclast precursor cell membrane microvesicles have an in vivo targeting effect.

[0092] To further verify the in vivo targeting ability, osteoclast precursor cell membrane microvesicles were labeled with DiO using the above method, and DiO-labeled osteoclast precursor cell membrane microvesicles were injected into the tail vein of osteoporosis mouse model. Femoral tissue was obtained 1 day later, fixed with 4% paraformaldehyde, 14% EDTA, 37°C, decalcified for 12 hours and embedded in paraffin. After slicing, the sections were incubated with DC-STAMP (labeled osteoclast precursor cells) primary antibody at 4°C overnight, washed 4 times with PBST, 5 minutes each time, then stained with Alexa Fluor 594 secondary antibody, washed 4 times with PBST, 5 minutes each time, and sealed with anti-fluorescence quencher containing DAPI, and the results were photographed with laser confocal microscope. Fig.15 As shown, green spots (DiO) overlap with red spots (DC-STAMP) on the bone surface and in the bone marrow, suggesting osteoclast precursor cell targeting of osteoclast precursor cell membrane microvesicles.

[0093] Experimental Example 3: Carrying siRNA circBBS9 Evaluation of the effect of osteoclast precursor cell membrane microvesicles in the treatment of osteoporosis

[0094] Establishment of osteoporosis animal model in mice: C57BL / 6J mice (female, 11 weeks) were anesthetized with 4% chloral hydrate, and bilateral ovariectomy was performed after skin disinfection to induce osteoporosis. After 8 weeks, the decrease of bone mass index detected by microCT indicated that the model was successfully established.

[0095] As in Example 1, the osteoclast precursor cell membrane (1 mg / mL) was mixed with siRNA circBBS940μg / mL, mixed in equal volumes, sonicated for 5 minutes, and then squeezed through 400nm and 200nm polycarbonate filters 5-10 times. siRNA NC The macrophage membrane group was used as the control group. One week after osteoporosis mice were established, the mice were injected with the tail vein once every 3 days for a total of 6 times. MicroCT was used to analyze the histological parameters of the femoral bone of mice 4 weeks after the administration. Fig.16 siRNA circBBS9 The osteoclast precursor cell membrane microvesicles significantly improved the trabecular volume ratio (BV / TV), the number of trabeculae (TB.N), the trabecular thickness (Tb.Th) and the space between trabeculae (Tb.Sp). Fig.17 As shown, TRAP staining and HE staining showed that the siRNA circBBS9 The osteoclast precursor cell membrane microvesicles significantly inhibited the size and number of osteoclasts.

[0096] As can be seen from the above examples, the siRNA provided by the present invention circBBS9 The preparation method of osteoclast precursor cell membrane microvesicle material has the characteristics of simple operation and low cost. The material can actively and specifically target osteoclast precursor cells in the osteoclast lineage, and has the therapeutic prospect of precise targeted drug delivery based on the characteristics of cells at different stages in the osteoclast lineage. It is a very promising cell membrane targeted delivery system. Sequence Listing <110> Run Run Shaw Hospital, Zhejiang University School of Medicine <120> Osteoporosis therapeutic delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 243 <212> DNA <213> Artificial Sequence <400> 1 gtggctgtac tccaatccca gagtcagacc tagaggaaag gtcactagat gactccacag 60 agctgtttac caaccacaag cacctcatga ccgagccccc catgcctgaa gtctcagccc 120 gccaaggagt tttggaatag tctggagtaa tgctaatgag ttgaggggag aggccattac 180 agaggctacc ctgtctggac actgtgttcc catcccggtg ctgtgccaag ctcatctctg 240 gag 243 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <400> 2 tggagtaatg ctaatgagtt gagg 24 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 gctgagactt caggcatgg 19 <210> 4 <211> 649 <212> DNA <213> Artificial Sequence <400> 4 gtggttgtac tacaatccca gagtcagacc tagaagaaag atcagtagaa caagactcta 60 cagaactgtt taccaaccac agacatctca ctgcagagac acccaggcct gaagtttcac 120 ccctccaagg agtctcggaa taattcaagt agagttgttt ggttgagagg aacatcccca 180 tctcaaggcc gaacctgtgt gaacctcatg ccaagcacag atatagggct ggcgcaggtg 240 cttcctaaag ctcaccttcc tggagatgac atgcatagaa agaggggttg ggacttttta 300 cttcactagg agaacttgta acaccatggg gaagtcagct gaaacttgtc ttgttttgcc 360 aggaaaggaa gtagttgcct ttggtcatcc atctgctaat agtcacagaa tacagtgaaa 420 tgacatagtt ttgggttaga ttttataatg caaagattca gatccaaaat aatttcatac 480 cccatttttt cacagaattc ttatatagta aatgtatcaa gtttaataaa gcatctcatt 540 gtcaaataat atcttggatt ttatttataa ttagagggat ttatgagtga ttgctctaca 600 ttatttcttc aaaggaaagg aaaggaattg aagactttgc tactctctg 649 <210> 5 <211> 21 <212> DNA / RNA <213> 人工序列(Artificial Sequence) <400> 5 cucuggaggu ggcuguacut t 21 <210> 6 <211> 21 <212> DNA / RNA <213> 人工序列(Artificial Sequence) <400> 6 aguacagcca ccuccagagt t 21

Claims

1. An osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells, characterized in that: The method comprises siRNA and cell membrane microvesicles targeting osteoclast precursor cells; the cell membrane microvesicles targeting osteoclast precursor cells are used to deliver siRNA in a targeted manner to osteoclast precursor cells; The siRNA is a specific siRNA for circBBS9, and its nucleotide sequence is shown in SEQ ID NO.5 and SEQ ID NO.6; the circBBS9, its nucleotide sequence is shown in SEQ ID NO.1; The method for preparing cell membrane microvesicles targeting osteoclast precursor cells is as follows: (1) extracting mononuclear cells from mammalian femur and tibia, inducing them with 15-30 ng / mL M-CSF for 3-5 days to obtain macrophages, and then inducing them with 30-80 ng / mL RANKL for 3-5 days to obtain osteoclast precursor cells; (2) Washing: After 3-5 min of trypsin digestion, the cells were terminated and centrifuged at 1000 rpm for 5 min, and resuspended in 4°C TM buffer, wherein the TM buffer is a mixture of 1 mM MgCl2 and 10 mM Tris added to water, and the pH is adjusted to 7.4; after resuspending, the cells were squeezed out 30-40 times using a micro syringe to destroy the cells and obtain a cell homogenate; (3) Add 1 M sucrose and mix with the cell homogenate to reach a final concentration of 0.25 M sucrose; (4) centrifuging the mixture obtained in step (3) at 4°C and 2000×g for 10 min, collecting the supernatant, centrifuging at 4°C and 3000×g for 30-35 min, resuspending the precipitate with 0.25 M sucrose solution, washing it, and centrifuging again at 4°C and 3000×g for 30-35 min to obtain a cell membrane; (5) The obtained cell membrane is extruded through 400 nm and 200 nm polycarbonate filter membranes 5 to 10 times in sequence using an extruder to obtain cell membrane microvesicles that can target osteoclast precursor cells.

2. The osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells according to claim 1, characterized in that: The mononuclear cells are mononuclear cells from the tibia and femur of C57BL / 6J mice of 6 to 8 weeks.

3. The osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells according to claim 1, characterized in that: The micro syringe is a 1mL insulin syringe.

4. The osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells according to claim 1, characterized in that: The M-CSF concentration is 25 ng / mL.

5. The osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells according to claim 1, characterized in that: The RANKL concentration was 50 ng / mL.

6. The osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells according to claim 1, characterized in that: The circBBS9 is used as an osteoporosis intervention target, and miR-423-3p is its downstream target.

7. The osteoporosis treatment delivery system based on targeted knockdown of circBBS9 in osteoclast precursor cells according to claim 1, characterized in that: The siRNA expression vector is bionic bone-targeted nanoparticles.

Images