A GFAP antigen, a GFAP antigen expression gene, a GFAP antigen expression vector, and their uses.

Abstract

This invention relates to a GFAP antigen, a GFAP antigen expression gene, a GFAP antigen expression vector, and their uses. The GFAP antigen consists of the GFAP protein and a polymerized protein motif at the C-terminus of the GFAP protein. This invention constructs a eukaryotic expression vector for the GFAP antigen and creatively introduces a polymerized fusion expression protein motif at the C-terminus of the GFAP protein, which can promote the protein phase transition of the GFAP protein in vivo. This invention discovers that adding a polymerized protein motif can transform the diffuse wild-type GFAP protein into a more dense aggregated structure, locally increasing the concentration of the GFAP antigen protein and causing the positive signal to exhibit a unique aggregation morphology, with the aggregation effect of the tetrameric GFAP-Tetramer plasmid being particularly significant. This invention introduces mCherry fluorescent protein on the basis of the tetramerization of the GFAP protein, enabling dual-fluorescence detection. Compared with existing immunofluorescence detection methods, the detection method provided by this invention further increases the detection sensitivity and specificity, making the interpretation of detection results more clear.

Description

Technical Field

[0001] This invention relates to the field of bioanalytical detection technology, and in particular to a GFAP antigen, a GFAP antigen expression gene, a GFAP antigen expression vector, and their uses. Background Technology

[0002] In recent years, our understanding of nervous system diseases has gradually deepened. However, the pathogenesis of nervous system diseases is extremely complex. Diseases such as neurodegenerative diseases and neuroinflammation pose significant challenges to treatment. Further in-depth research is needed to achieve more accurate diagnosis and effective treatment. Glial fibrillary acidic protein (GFAP), as a mature astrocyte marker, plays a crucial role in the diagnosis and treatment of nervous system diseases. GFAP is a type III intermediate filamentous protein existing in monomeric form. It is mainly found in mature astrocytes, serving as an important component and major cytoskeleton of astrocytes. Besides high expression in nervous system astrocytes, GFAP is also expressed in chondrocytes, fibroblasts, myoepithelial cells, lymphocytes, and hepatic stellate cells. GFAP expression is influenced by various factors, such as brain injury and neurological tumors. Astrocyte proliferation is often accompanied by increased expression of glial fibrillary acidic protein (GFAP). Therefore, GFAP can serve as a biomarker for astrocyte proliferation in central nervous system injury.

[0003] Glial fibrillary acidic protein (GFAP) is commonly used in pathology for the following purposes: 1. GFAP is expressed in astrocytes, ependymal cells, and retinal Muller cells, thus it can be used to diagnose tumors derived from these cells and to differentiate gliomas from meningiomas. However, GFAP is not expressed in mature oligodendrocytes (oligodendrocytes are negative); 2. GFAP can react with Schwann cells, myoepithelial cells, Kupffer cells, and some chondrocytes, thus it can be used for diagnosis by detecting the reaction of GFAP with tumors containing these components (50% of soft tissue myoepitheliomas express GFAP); 3. GFAP can be used as a second-line marker antibody for malignant peripheral nerve sheath tumors (30% of cases focally express GFAP).

[0004] GFAP astrocytopathy is a type of meningoencephalomyelitis or localized meningoencephalomyelitis associated with IgG-bound glial fibrillary acidic protein (GFAP). GFAP is a cytoplasmic protein with eight different splice variants, and GFAPa is commonly used as an antigen (Flanagan EP, Hinson SR, Lennon VA, et al. Glial fibrillary acidic protein immunoglobulin G as biomarker Of autoimmune astrocytopathy: analysis of 102 patients. Ann Neurol. (2017) 81: 298-309). GFAP is diffuse in the cytoplasm and lacks a fixed morphological characteristic. Detecting the presence of specific antibodies in serum or cerebrospinal fluid using GFAP as an antigen is an important indicator for the qualitative diagnosis of GFAP astrocytopathy. Therefore, GFAP, as a biomarker, can be used for the differential diagnosis of GFAP astrocytopathy, and the detection of GFAP antibodies can provide effective assistance for early diagnosis and subsequent treatment of patients.

[0005] Currently, methods for detecting GFAP antibodies include enzyme-linked immunosorbent assay (ELISA) and cell-based indirect immunofluorescence assay (CBA). ELISA involves coating in vitro expressed and purified GFAP protein into wells and drying the resulting material. Compared to ELISA, CBA utilizes cells to express the full-length GFAP protein, allowing for in vivo protein folding and modification. This maximizes the preservation of the antigen's native spatial conformation, thus facilitating antigen-antibody reactions. Current evidence suggests that CBA has significantly higher sensitivity than ELISA. Therefore, GFAP cell-based indirect immunofluorescence assay is widely used for the qualitative diagnosis of GFAP astrocytosis.

[0006] In actual laboratory testing, when using the CBA method to screen patient blood samples, the high concentration of total antibodies in the blood (approximately 10 g / L) and the complex protein system in serum lead to strong non-specific adsorption during antibody detection, resulting in high noise and typically strong background fluorescence signals. GFAP is a cytoplasmic protein, diffusely distributed in the cytoplasm without a fixed morphological characteristic. During antibody detection, the target fluorescence signal is often very close to the background fluorescence signal; that is, the positive signal generated by the reaction between the antibody in the sample and the antigen expressed by the cell does not have good distinguishability from the cellular background staining. This is especially problematic for low-titer positive patients, easily leading to false negatives. Therefore, improving the signal-to-noise ratio of GFAP autoimmune antibody detection is an urgent issue to be addressed.

[0007] Furthermore, on the one hand, there are differences in understanding among those skilled in the art; on the other hand, the applicant studied a large number of documents and patents when making this invention, but due to space limitations, not all details and contents were listed in detail. However, this does not mean that the present invention does not possess the features of these prior art. On the contrary, the present invention already possesses all the features of the prior art, and the applicant reserves the right to add relevant prior art to the background art. Summary of the Invention

[0008] In actual laboratory testing, when using cell-based immunofluorescence assay (CBA) to screen patient blood samples, the high concentration of total antibodies in the blood (approximately 10 g / L) and the complex protein system in serum lead to strong non-specific adsorption during antibody detection, resulting in high noise levels and typically strong background fluorescence signals. Consequently, the positive signal generated by the reaction between antibodies and cell-expressed antigens in the sample is not well distinguished from the cell background staining. For patients with low-titer positive results, the positive signal generated by the test cannot be distinguished from the background fluorescence signal, easily leading to false negatives. Therefore, improving the signal-to-noise ratio of GFAP autoimmune antibody detection is an urgent problem to be solved.

[0009] To address the shortcomings of existing technologies, this invention provides a GFAP antigen, which is composed of a GFAP protein and a multimeric protein motif at the carboxyl terminus of the GFAP protein. The multimeric protein motif is a dimerized, trimerized, or tetramerized protein motif. The nucleotide sequence of the dimerized protein motif is shown in SEQ ID NO. 2. The amino acid sequence of the dimerized protein motif is shown in SEQ ID NO. 3. The nucleotide sequence of the trimerized protein motif is shown in SEQ ID NO. 4. The amino acid sequence of the trimerized protein motif is shown in SEQ ID NO. 5. The nucleotide sequence of the tetramerized protein motif is shown in SEQ ID NO. 6. The amino acid sequence of the tetramerized protein motif is shown in SEQ ID NO. 7.

[0010] This invention utilizes genetic engineering to modify the GFAP antigen, introducing a protein motif that promotes protein polymerization at the carboxyl terminus. After adding this polymerizing motif, the GFAP protein undergoes homologous polymerization within the cell, altering its aggregation morphology and forming a unique aggregate structure. The wild-type diffuse GFAP antigen transforms into a more dense aggregate structure, locally increasing the concentration of the GFAP antigen protein and resulting in a unique aggregation pattern for the positive signal. This achieves the goal of distinguishing the generated positive signal from the background fluorescence signal. This invention provides a feasible solution for the expression of similar autoimmune antigens.

[0011] The antigen provided by this invention carries a protein tag for detection. Preferably, the antigen carries a his tag. Preferably, the antigen carries a Flag tag.

[0012] The present invention also provides a nucleic acid molecule that encodes an antigen composed of a GFAP protein and a polymerized protein motif at the carboxyl terminus of the GFAP protein, said antigen having a protein tag for detection.

[0013] The present invention provides a nucleic acid molecule linked to a fluorescent tag. Preferably, the fluorescent tag is an mCherry fluorescent tag. Preferably, the fluorescent tag is an eCFP fluorescent tag. Preferably, the fluorescent tag is an eYFP fluorescent tag.

[0014] The present invention also provides a eukaryotic expression vector for GFAP antigen, comprising the aforementioned nucleic acid molecule and plasmid vector.

[0015] According to a preferred embodiment, an mCherry fluorescent tag is attached to the N-terminus of a nucleic acid molecule bearing a tetramerized protein motif. The full sequence of the mCherry-GFAP-Tetramer gene is shown in SEQ ID NO. 8.

[0016] The present invention also provides the use of the GFAP antigen, the nucleic acid molecule, and the eukaryotic expression vector in improving the detection sensitivity of GFAP-specific autoantibodies.

[0017] The present invention also provides a method for preparing GFAP antigen, comprising the following steps: obtaining the nucleic acid molecule encoding an antigen composed of GFAP protein and a polymerized protein motif at the carboxyl terminus of GFAP protein; digesting and ligating the nucleic acid molecule with enzymes to insert it into a plasmid vector to obtain an expression vector; transfecting the expression vector into a host cell; and culturing the host cell to produce GFAP antigen.

[0018] This invention improves the detection sensitivity of GFAP autoantibodies using the CBA method by genetically modifying the GFAP expression plasmid. The invention involves genetically modifying the GFAP antigen by introducing a protein motif that promotes protein polymerization at the carboxyl terminus. After adding this polymerizing motif, the GFAP protein undergoes homologous polymerization within the cell, altering its aggregation morphology and forming a unique aggregate structure. The diffuse wild-type GFAP antigen transforms into a more dense aggregate structure, locally increasing the concentration of the GFAP antigen protein and resulting in a unique aggregation pattern for the positive signal, thus achieving the goal of distinguishing the detected positive signal from the background fluorescence signal. Compared to the diffuse wild-type GFAP antigen, this invention found that the modified GFAP-Tetramer (tetramerized) antigen protein, due to its more dense aggregate structure, exhibits a higher signal-to-noise ratio in immunofluorescence experiments, meaning the positive signal can be clearly distinguished from the background fluorescence signal, thereby significantly improving the detection sensitivity of GFAP-specific autoantibodies.

[0019] Furthermore, this invention discovered that the tetrameric GFAP-Tetramer plasmid exhibits a particularly significant aggregation effect. Therefore, based on the tetramerization tag, this invention introduces an mCherry fluorescent tag, which is not present in the human body. This facilitates the observation of plasmid transfection efficiency and expression levels, and also adds a dual-color fluorescence observation method. The GFAP fusion protein expressed by the cells and the mCherry fluorescent protein work together, exhibiting excellent co-localization effects and enabling the detection of a clear positive signal. Using this mCherry-GFAP-Tetramer plasmid and the modified antigen to prepare the detection cell material further increases the detection sensitivity and specificity compared to current methods that directly use the full-length GFAP protein for immunofluorescence detection. This makes the interpretation of detection results easier and clearer, and can be efficiently used to detect GFAP autoantibodies in patients. Attached Figure Description

[0020] Figure 1 This is the GFAP-Internal Disorder Region (IDR) prediction map provided by the present invention;

[0021] Figure 2 This is the GFAP-polymerized-his plasmid map provided by the present invention;

[0022] Figure 3 This is a graph showing the results of the expression levels of wild-type and polymerized GFAP immunofluorescence (Anti-his) and tetrameric GFAP antigens provided by this invention.

[0023] Figure 4 This is the mCherry-GFAP-Tetramer plasmid map provided by the present invention;

[0024] Figure 5 These are the immunofluorescence map of tetramerized GFAP and the expression level map of tetramerized GFAP antigen (Anti-GFAP verification) provided by this invention;

[0025] Figure 6 This is a serum detection diagram of anti-GFAP positive patients provided by the present invention. Detailed Implementation

[0026] The following is a detailed explanation with reference to the accompanying drawings.

[0027] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. The present invention is not limited to the embodiments described herein; these embodiments are provided to provide a thorough and complete understanding of the disclosure. Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0028] This invention uses PONDR to predict the GFAP protein and finds that the GFAP protein contains a long internal disorder region (IDR), such as... Figure 1 As shown, GFAP protein is a potential phase transition protein, but its phase transition ability is insufficient to form a liquid droplet structure. This invention attempts to use a smaller coiled-coil motif for the aggregation and concentration of GFAP protein. The coiled-coil domain is typically a heptapeptide repeat of hydrophobic (H) and polar (P) residues, HPPHPPP. Most coiled-coils contain more than four consecutive heptapeptide repeats. It has been found that the coiled-coil domain can form homopolymers with different valence states, such as dimerization and trimerization. This invention found that introducing a polymerizing motif can significantly alter the distribution of GFAP expression after transfection, resulting in a phase transition-like aggregation structure within the cell.

[0029] Main reagents, instruments, and sources used in this invention: PCR enzyme: Max DNA Polymerase (Takara, catalog number: R045A); KOD DNA Polymerase (Toyobo, product number: KOD-201); Nhe I (NEB product number: R3131); Not I (NEB product number: R3189); T4 DNA ligase (NEB catalog number: M0202T); Cell lines: HEK293T and Hep2 cells; Gel extraction kit: Omega Gel Extraction Kit; Plasmid: pEGFP-N1 (purchased from Clontech, catalog number: 6085-1); Plasmid extraction kit: Omega plasmid mini kit; Pure water system: Millipore 5UV Water Purification System; Pipettes: Eppendorf; PCR Instrument: Bio-Rad T100; His antibody (Engibody, product number AT0025); GFAP antibody (ThermoFisher, product number 13-0300); Fluorescent secondary antibody Alexa Fluor TM 488 (ThermoFisher product number A-11001).

[0030] This invention provides a GFAP antigen, which is composed of GFAP protein and a multiplied protein motif at the C-terminus of the GFAP protein. This invention involves fusing various Coiled-Coil domains with the GFAP antigen to obtain expression plasmids containing multiple GFAP protein multiplies. These plasmids are then transfected into host cells, and the host cells are cultured to produce the GFAP antigen. The antigen consists of the GFAP protein, the multiplied protein motif, and either a his tag or an mCherry tag. The generated GFAP antigen is then subjected to immunofluorescence assays with anti-his antibodies, commercially available GFAP antibodies, and GFAP autoantibodies-positive serum.

[0031] Example 1

[0032] Analysis of the disordered region within the GFAP protein:

[0033] Download the GFAP protein sequence (NP_002046.1) from the NCBI database, save it in FASTA format, and input the sequence into an online website (http: / / www.pondr.com / ). Select Predictor: VLXT, enter the protein name: GFAP, paste the GFAP protein sequence, and submit to obtain the analysis results. Figure 1As shown, the GFAP protein contains three consecutive IDR regions, suggesting that it may be a phase transition protein. However, no significant phase transition was observed when natural GFAP was transfected into 293 cells. Figure 1 The GFAP-his in the liquid droplet or aggregation structure is formed. Therefore, it is speculated that GFAP has the potential for phase transition, but its own phase transition ability is insufficient, requiring additional stimulation.

[0034] Example 2

[0035] The steps for GFAP antigen protein polymerization screening are as follows:

[0036] 1. GFAP and genes coupled with dimerizing, trimerizing, and tetramerizing tags were artificially synthesized. The optimized nucleotide sequence of GFAP is shown in SEQ ID NO.1, corresponding to the GFAP protein (NP_002046.1); the dimerizing, trimerizing, and tetramerizing tag sequences are shown in SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.7, respectively. Gene synthesis was performed by General Biotech, and subcloning was completed. The gene was inserted into the pEGFP-N1 plasmid vector at the NheI / NotI insertion site. The GFP tag inherent in the vector was removed, and a his tag (General Biotech production numbers G0234847, G0230887, G0233840) was uniformly added to the C-terminus of the gene. Three plasmids carrying the target gene were obtained and named GFAP-dimer-his, GFAP-trimer-his, and GFAP-Tetramer-his, respectively. The plasmid maps are shown below. Figure 2 As shown.

[0037] 2. Take GFAP-dimer-his, GFAP-trimer-his and GFAP-Tetramer-his respectively, and transfect the cultured HEK293 cells according to the PEI transfection reagent transfection method to obtain HEK293 cells expressing GFAP-dimer-his, GFAP-trimer-his and GFAP-Tetramer-his genes. Culture at 37℃ and 5% CO2 for 24h.

[0038] Transfection methods also include lipofectamin 2000, lipofectamin 3000, other liposome transfection reagents, electroporation, or other transfection methods.

[0039] 3. After transfection, cells were cultured for 24 hours, fixed with 2% PFA for 10 minutes, and then punched with 0.2% Triton-100 PBS solution.

[0040] 4. His antibody immunofluorescence staining.

[0041] (1) His antibody (Engibody product number AT0025) was diluted 1:1000 and incubated for 1 hour for cell crawling.

[0042] (2) Wash with PBS 3 times, 5 min each time;

[0043] (3) Fluorescently labeled secondary antibody Alexa Fluor 488 (purchased from Thermo Fisher Scientific) was diluted 1:1000 and incubated for 45 min;

[0044] (4) Wash with PBS 3 times, 5 min each time;

[0045] (5) Take photos of the observation results under the microscope. The photo results are as follows: Figure 3 As shown.

[0046] Figure 3 The left image shows immunofluorescence images of wild-type and multiplied GFAP (Anti-his). GFAP-his is the result of reacting wild-type GFAP expressed by the GFAP-his plasmid with his antibody. GFAP-dimer is the result of reacting dimerized GFAP expressed by the GFAP-dimer-his plasmid with his antibody (Engibody product number AT0025). GFAP-trimer is the result of reacting trimerized GFAP expressed by the GFAP-trimer-his plasmid with his antibody. GFAP-Tetramer is the result of reacting tetramerized GFAP expressed by the GFAP-Tetramer-his plasmid with his antibody. Figure 3 The results on the left show that, compared with the fluorescence signal displayed by GFAP-his, the fluorescence signals of GFAP-dimer, GFAP-trimer, and GFAP-Tetramer show a gradual aggregation trend. Among them, the fluorescence signal of GFAP-Tetramer is the brightest and the fluorescence signal of GFAP-his is the weakest. This indicates that after the addition of the multimerized protein motif, the aggregation morphology of GFAP antigen changes from a diffuse state to a dense aggregated state. Compared with the wild type, the GFAP antigen with the added tetramerized protein motif has a more aggregated fluorescence signal after reacting with the antibody, indicating that the GFAP protein changes from a diffuse state to a more dense aggregated state. Figure 3The experimental results show that with the introduction of the multimerization tag, GFAP protein changes from a diffuse state to a dense aggregated state, and the tetramerized GFAP aggregated state is particularly obvious. We also collected 293 cells transfected with GFAP-Tetramer-his and GFAP-his plasmids and performed Western blotting experiments using a commercially available GFAP antibody (Thermofisher, 13-0300). Figure 3 The right side shows the results of tetrameric GFAP antigen expression levels. The results indicate that adding the multimerizing motif did not increase GFAP antigen expression, but it did change the diffuse distribution of GFAP protein to an aggregated state. Furthermore, this invention found that dimerizable fluorescent tags such as GFP can also promote GFAP protein aggregation.

[0047] This embodiment constructs a eukaryotic expression plasmid conjugated with a his tag by GFAP and provides a series of GFAP-his protein fusion proteins with different multiplying protein tags (the tags are located at the carboxyl terminus). GFAP can also be linked to a flag tag, which typically does not interact with the target protein and usually does not affect the function or properties of the target protein. As a tag protein, the flag can be recognized by anti-flag antibodies. Therefore, fusion proteins containing flags can be detected and identified by methods such as Western blotting, ELISA, and CBA. Figure 5 The image on the left is an immunofluorescence image of tetrameric GFAP. Figure 5 The right side shows the expression level of tetrameric GFAP antigen. Immunofluorescence assays revealed that the addition of tetrameric protein motifs significantly increased the aggregation of GFAP antigen protein. Figure 5 As shown on the left, after transfecting cells with the GFAP-his fusion expression plasmid carrying a tetramerization tag (28 amino acids), it was found that although the plasmid did not increase the expression level of GFAP antigen protein, as shown on the left... Figure 5 As shown on the right, however, the introduction of additional tetramerizing protein motifs enables the GFAP protein to transform from a diffuse state into an aggregate structure.

[0048] Example 3

[0049] This embodiment provides a GFAP antigen, which is composed of GFAP protein and a tetramerized protein motif at the carboxyl terminus of the GFAP protein, and the antigen carries a his tag. The nucleotide sequence of the tetramerized protein motif is shown in SEQ ID NO. 6. The amino acid sequence of the tetramerized protein motif is shown in SEQ ID NO. 7. The preparation method of the antigen in this embodiment is the method provided in Example 2.

[0050] Example 4

[0051] This embodiment provides a GFAP antigen, which is composed of GFAP protein and a dimerized protein motif at the carboxyl terminus of the GFAP protein, and the antigen carries a his tag. The nucleotide sequence of the dimerized protein motif is shown in SEQ ID NO.2. The amino acid sequence of the dimerized protein motif is shown in SEQ ID NO.3. The preparation method of the antigen in this embodiment is the method provided in Example 2.

[0052] Example 5

[0053] This embodiment provides a GFAP antigen, which is composed of GFAP protein and a trimerized protein motif at the carboxyl terminus of the GFAP protein, and the antigen carries a his tag. The nucleotide sequence of the trimerized protein motif is shown in SEQ ID NO.4. The amino acid sequence of the trimerized protein motif is shown in SEQ ID NO.5. The preparation method of the antigen in this embodiment is the method provided in Example 2.

[0054] Example 6

[0055] This embodiment provides a nucleic acid molecule that encodes an antigen composed of GFAP protein and a tetrameric protein motif at the carboxyl terminus of GFAP protein, wherein the antigen carries a His tag. The preparation method of the nucleic acid molecule in this embodiment is provided in Example 2.

[0056] Example 7

[0057] This embodiment provides a nucleic acid molecule that encodes an antigen composed of GFAP protein and a dimerized protein motif at the carboxyl terminus of GFAP protein, wherein the antigen carries a His tag. The method for preparing the nucleic acid molecule in this embodiment is provided in Example 2.

[0058] Example 8

[0059] This embodiment provides a nucleic acid molecule that encodes an antigen composed of GFAP protein and a trimerized protein motif at the carboxyl terminus of GFAP protein, the antigen bearing a His tag. The preparation method of the nucleic acid molecule in this embodiment is provided in Example 2.

[0060] Example 9

[0061] This embodiment provides a eukaryotic expression vector for a GFAP antigen, comprising a nucleic acid molecule and a plasmid vector. The nucleic acid molecule encodes an antigen composed of the GFAP protein and a tetrameric protein motif at the carboxyl terminus of the GFAP protein, and the antigen carries a His tag. The method for preparing the expression vector in this embodiment is provided in Example 2.

[0062] Example 10

[0063] This embodiment provides a eukaryotic expression vector for a GFAP antigen, comprising a nucleic acid molecule and a plasmid vector. The nucleic acid molecule encodes an antigen composed of the GFAP protein and a dimerized protein motif at the C-terminus of the GFAP protein, and the antigen carries a His tag. The method for preparing the expression vector in this embodiment is provided in Example 2.

[0064] Example 11

[0065] This embodiment provides a eukaryotic expression vector for a GFAP antigen, comprising a nucleic acid molecule and a plasmid vector. The nucleic acid molecule encodes an antigen composed of the GFAP protein and a trimerized protein motif at the C-terminus of the GFAP protein, and the antigen carries a His tag. The method for preparing the expression vector in this embodiment is provided in Example 2.

[0066] Example 12

[0067] The detection of GFAP antibodies requires the preparation of GFAP antigen or cells expressing the antigen. This embodiment provides a method for preparing GFAP autoantibody detection materials, the steps of which are as follows:

[0068] 1. Based on the above GFAP-Tetramer-his, a red light tag mCherry was introduced. Primers were designed using the overlap extension PCR method (20211063385.3): mCherry-F: GTGAACCGTCAGATCCGCTAGCACCGCCatggtgagcaagggcgaggagg, mCherry-R: GCGGAGGTGATGCGTCTCCTCTCCATAGAGCCTCCACCCCCCTTGTACAGCTCGTCCATGCCGC.

[0069] First round of PCR reaction

[0070] (1) First, dilute the primers for the first round of PCR amplification to a final concentration of 10 μM according to the concentration;

[0071] (2) The mixed PCR system is shown below:

[0072]

[0073] (3) After briefly centrifuging the well-mixed PCR reaction system, start PCR amplification;

[0074] The PCR reaction procedure is as follows:

[0075] Pre-variation: 94℃, 2 min. transsexual: 98℃, 10 seconds. annealing: 60℃*, 10 sec. extend: 72℃, 20s (1Kb / 1Os) Cycle number: 35 cycles extend: 72℃, 2min Storage conditions: 10℃

[0076] 2. After PCR is completed, run electrophoresis on the gel, cut the gel, and recover the PCR products according to the instructions of the gel recovery kit.

[0077] 3. Second round of PCR reaction

[0078] (1) The reaction system is shown below:

[0079] reagents Volume (μl) KOD buffer 5 2mM dNTPs 5 <![CDATA[25mM MgSO4]]> 2 First-round PCR product recovery 16 10-50 ng / μl GFAP-Tetramer-his plasmid 1 KOD DNA Polymerase 1 <![CDATA[ddH2O]]> 20 Total volume 50

[0080] (2) The PCR reaction procedure is as follows:

[0081] Pre-variation: 94℃, 2 min. transsexual: 98℃, 10 seconds. annealing: 55℃, 20 seconds. extend: 68℃, 7 minutes 30 seconds Cycle number 13 cycles extend: 68℃, 10min Storage conditions: 10℃

[0082] 4. Dpn1 digestion: After the second round of PCR reaction is completed, add 1 μl of Dpn1 enzyme to the reaction tube and react at 37℃ for 1 h to completely remove the template plasmid from the PCR reaction system.

[0083] 5. Transformation: Take 10 μl of the PCR product after digestion with Dpn1 and transform it into competent E. coli cells. After recovery, plate the cells onto Kan-resistant LB solid culture plates for culture.

[0084] 6. Pick a single colony and add it to LB medium containing Kan antibiotic, and incubate overnight at 37°C by shaking.

[0085] 7. Extract the recombinant plasmid mCherry-GFAP-Tetramer-his, send it for sequencing, and screen for recombinants with correct sequencing results.

[0086] The mCherry fluorescent tag was seamlessly ligated to the N-terminus of the GFAP-Tetramer-his gene, resulting in a new plasmid named mCherry-GFAP-Tetramer. After successful sequencing, the plasmid was extracted for subsequent experiments. The plasmid map is shown below. Figure 4 As shown.

[0087] 8. Take the mCherry-GFAP-Tetramer plasmid and transfect the cultured HEK293 cells according to the PEI transfection reagent transfection method to obtain HEK293 cells expressing the mCherry-GFAP-Tetramer gene.

[0088] 9. Cells transfected for 24 hours are fixed and prepared into cell slides using a fixative. The fixative can be acetone, formaldehyde, paraformaldehyde, methanol, ethanol, or other fixatives.

[0089] Immunofluorescence staining was performed on the fixed cell slides, and the specific steps are as follows:

[0090] (1) Incubate the fixed crawling slides with GFAP-positive human serum (1:10 dilution) for 1 hour;

[0091] (2) Wash with PBST 3 times, 5 min each time;

[0092] (3) Incubate with green fluorescent (FITC) labeled secondary antibody goat anti-human IgG for 45 min; wash 3 times with PBST, 5 min each time;

[0093] (4) Observe the results under a microscope and take pictures.

[0094] Experimental results are as follows Figure 6 As shown, the Alexa Fluo 488 results represent the detection of the reaction between GFAP expressed by the mCherry-GFAP-Tetramer-his plasmid and GFAP antibody in serum. mCherry represents the autofluorescence of GFAP expressed by the mCherry-GFAP-Tetramer plasmid, and Merged is the combined image of the autofluorescence and detection signals. The experimental results show that different concentrations of GFAP antibody in the sample result in different fluorescence intensities and different numbers of positive cells. Figure 6 It can be seen that cells expressing GFAP-GFAP-Tetramer-his antigen can effectively detect GFAP antibody signals of different concentrations, solving the problem of difficulty in distinguishing GFAP positive signals from background fluorescence signals in low-titer positive patients. Figure 6 As shown in sample 3, this demonstrates that the GFAP-GFAP-Tetramer-his antigen has good sensitivity, specificity, and accuracy in detecting anti-GFAP positive serum, providing an effective solution for determining the presence of GFAP antibodies in patients.

[0095] This invention utilizes a cell-based indirect immunofluorescence assay (CBA) detection system to construct a eukaryotic expression plasmid for the GFAP antigen protein. It innovatively introduces a fusion expression protein motif that promotes dimerization, trimerization, and tetramerization at the C-terminus of the GFAP protein. After adding the multimerizing protein motif, the GFAP antigen protein undergoes homologous multimerization within the cell, transforming its wild-type diffuse structure into a more dense aggregated structure. This locally increases the concentration of the GFAP antigen protein and results in a unique aggregation morphology for the positive signal, with the tetramerized GFAP-Tetramer plasmid exhibiting a particularly significant aggregation effect. In this embodiment, during the detection of actual patient samples, an mCherry fluorescent tag was introduced based on the tetramerization of the GFAP protein, resulting in the mCherry-GFAP-Tetramer expression vector. The invention of the mCherry-GFAP-Tetramer expression vector solves the problem of indistinct positive signals from cytoplasmic GFAP proteins, providing a qualitative solution for accurately determining the presence of GFAP antibodies in patients.

[0096] The method provided by this invention enhances the immunofluorescence signal of GFAP cells, offering an effective identification method for GFAP autoantibodies. Compared to conventional immunofluorescence methods, the GFAP antigen expressed by the mCherry-GFAP-Tetramer expression vector provided by this invention exhibits higher sensitivity and specificity in antibody detection. When conventional immunofluorescence methods cannot confirm the presence of GFAP antibodies in patient samples, cells expressing the mCherry-GFAP-Tetramer neoantigen can be used for further identification. The method provided by this invention further increases detection sensitivity and specificity compared to current methods that directly use full-length GFAP protein for immunofluorescence detection, making the interpretation of detection results clearer and enabling efficient detection of GFAP autoantibodies in patients.

[0097] Example 13

[0098] This embodiment provides a eukaryotic expression vector for a GFAP antigen, comprising a nucleic acid molecule and a plasmid vector. The nucleic acid molecule encodes an antigen composed of the GFAP protein and a tetrameric protein motif at the carboxyl terminus of the GFAP protein, and the antigen carries a his tag. The eukaryotic expression vector is linked to an mCherry fluorescent tag. The complete sequence of the mCherry-GFAP-Tetramer gene is shown in SEQ ID NO. 8. Furthermore, the fluorescent tag can also be an eCFP fluorescent tag or an eYFP fluorescent tag, etc. These fluorescent tags can display the expression status of the target gene in real time, and have stable fluorescence properties, offering advantages such as rapid, simple, and highly sensitive detection. The preparation of the expression vector provided in this embodiment is provided in Example 12.

[0099] Example 14

[0100] This embodiment describes the use of the GFAP antigen, nucleic acid molecules, and eukaryotic expression vector to improve the detection sensitivity of GFAP-specific autoantibodies. The GFAP antigen includes the antigens provided in Examples 2-5. The nucleic acid molecules include those provided in Examples 6-8. The eukaryotic expression vector includes the expression vectors provided in Examples 9-13. The experiment involved genetically modifying the GFAP antigen, introducing a protein motif that promotes protein polymerization at the carboxyl terminus. After adding the polymerizing protein motif, the GFAP protein undergoes homologous polymerization within the cell, altering the aggregation morphology of the GFAP antigen and forming a unique aggregation structure. The GFAP antigen changes from a diffuse wild-type structure to a more dense aggregation structure, locally increasing the concentration of the GFAP antigen protein and resulting in a unique aggregation pattern for the positive signal, thereby achieving the goal of distinguishing the generated positive signal from the background fluorescence signal. Compared with the diffuse wild-type GFAP antigen, the present invention found that the modified mCherry-GFAP-Tetramer (tetramer) antigen protein has a higher signal-to-noise ratio in immunofluorescence experiments due to its more compact aggregated structure and the addition of endogenous red light as an auxiliary means of judgment. That is, the positive signal can be clearly distinguished from the background fluorescence signal, thus significantly improving the detection sensitivity and accuracy of GFAP-specific autoantibodies.

[0101] It should be noted that the specific embodiments described above are exemplary. Those skilled in the art can devise various solutions inspired by the disclosure of this invention, and these solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and do not constitute a limitation on the claims. The scope of protection of this invention is defined by the claims and their equivalents. This specification contains multiple inventive concepts; terms such as "preferredly," "according to a preferred embodiment," or "optionally" indicate that the corresponding paragraph discloses an independent concept. The applicant reserves the right to file divisional applications based on each inventive concept. Throughout the text, features introduced by "preferredly" are merely optional and should not be construed as mandatory. Therefore, the applicant reserves the right to abandon or delete relevant preferred features at any time.

Claims

1. A GFAP antigen, characterized in that, The antigen is composed of GFAP protein and a polymerized protein motif at the carboxyl terminus of GFAP protein; The polymerized protein motif is a dimerized, trimerized, or tetramerized protein motif; The nucleotide sequence of the dimerized protein motif is shown in SEQ ID NO.2; The nucleotide sequence of the trimerized protein motif is shown in SEQ ID NO.4; The nucleotide sequence of the tetrameric protein motif is shown in SEQ ID NO. 6; After the addition of the polymerized protein motif, the GFAP protein undergoes homopolymerization within the cell, and the GFAP antigen changes from a diffuse wild-type structure to a more dense aggregated structure.

2. The antigen according to claim 1, characterized in that, The antigen carries a protein tag for detection.

3. A nucleic acid molecule, characterized in that, Its encoding is the antigen as described in claim 1 or 2.

4. The nucleic acid molecule according to claim 3, characterized in that, The nucleic acid molecule is linked to a fluorescent tag.

5. A eukaryotic expression vector for GFAP antigen, characterized in that, It includes nucleic acid molecules and plasmid vectors as described in claim 3 or claim 4.

6. The use of the GFAP antigen according to claim 1 or 2, the nucleic acid molecule according to claim 3 or 4, and the eukaryotic expression vector according to claim 5 in improving the detection sensitivity of GFAP-specific autoantibodies.

Images