Multiplex qpcr primer set for detection of superficial mycosis pathogens

By designing specific primer and probe combinations using multiplex real-time quantitative PCR technology, the problems of low detection efficiency and high cost of superficial fungal pathogens have been solved, achieving efficient, rapid, and accurate multiplex pathogen detection and reducing detection costs.

CN116287389BActive Publication Date: 2026-05-01KUNMING UNIV OF SCI & TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310152792.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-23
Publication Date
2026-05-01
Estimated Expiration
2043-02-23

AI Technical Summary

Technical Problem

Existing technologies for detecting pathogens of superficial fungal diseases suffer from low detection efficiency, high cost, complex operation, and inaccurate results. In particular, traditional methods such as direct microscopic examination and fungal culture identification have high false negative and false positive rates. Molecular biological detection technologies such as PCR-first generation sequencing, LAMP, gene chips, and NGS are expensive and have high operational requirements.

Method used

Multiplex real-time quantitative PCR was employed, and specific primer and probe combinations were designed. Using the human β-actin gene as an internal control, high-throughput detection of eight superficial fungal pathogens was achieved, including Trichophyton rubrum, Epidermophyton floccosum, Microsporum canis, Trichophyton mentagrophytes, Microsporum gypseum, Candida albicans, Malassezia furfur, and Microsporum audouinii. After nucleic acid extraction from the samples, multiplex qPCR detection was performed.

Benefits of technology

It achieves efficient, rapid, and accurate pathogen diagnosis, reduces detection costs, improves detection efficiency, and enables the detection of multiple samples in a single experiment, greatly reducing the detection cost of superficial fungal infection samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287389B_ABST
    Figure CN116287389B_ABST
Patent Text Reader

Abstract

The application discloses a kind of multiple qPCR detection primer combinations of superficial mycosis pathogen, it includes the specific primer and probe of detecting Trichophyton rubrum, Trichophyton mentagrophytes, Epidermophyton floccosum, Microsporum canis, Microsporum audouinii, Microsporum gypseum, Candida albicans, Malassezia furfur;The application detects pathogen target gene using real-time fluorescent quantitative PCR technology;The method has the advantages of short time consumption, high specificity, low cost, and can detect multiple pathogens at a time, provides a convenient method for the detection of superficial mycosis pathogen, and has important significance for the early molecular diagnosis of superficial fungal infection patients.
Need to check novelty before this filing date? Find Prior Art

Description

Primer combination for multiplex qPCR detection of superficial fungal pathogens Technical Field

[0001] This invention belongs to the field of pathogen detection technology and relates to a multiplex qPCR primer combination for detecting superficial fungal pathogens. This invention utilizes multiplex real-time quantitative PCR technology to detect superficial fungal pathogens. Background Technology

[0002] Superficial fungal infections (SFI) refer to fungal invasion of superficial areas of the human body such as skin, hair, or nails, which can cause superficial fungal diseases, including tinea corporis, tinea cruris, tinea pedis, tinea capitis, and onychomycosis. The main pathogens are dermatophytes and non-dermatophytes, such as Candida and Malassezia furfur.

[0003] Dermatophytes invade keratinized tissues, such as the skin (epidermis) and its appendages. Within this group, pathogenic species are anthropophilic, zoophilic, and terrestrial fungi, belonging to three genera: Trichophyton, Microsporum, and Epidermophyton.

[0004] Besides dermatophytes, superficial fungal infections (SFI) are usually caused by yeasts primarily belonging to the genus *Candida*, especially *Candida albicans*, which can cause thrush, oropharyngeal candidiasis, vaginal candidiasis, cutaneous candidiasis, paratocaridiosis, onychomycosis, and chronic mucocutaneous candidiasis. Furthermore, fungi of the genus *Malassezia* are also pathogens causing superficial fungal infections, leading to pityriasis versicolor (PV), Malassezia folliculitis, and seborrheic dermatitis. In recent years, due to changes in lifestyle and the widespread use of immunosuppressants, the incidence of fungal infections has been increasing year by year. Domestic and international literature reports that the global incidence of superficial fungal infections can reach 20%–25%. Therefore, accurate species identification is crucial for selecting the most appropriate medical approach and determining the source of infection, thereby helping to prevent reinfection. Based on this, it is necessary to strengthen the diagnosis of common clinical pathogens of superficial fungal infections, such as *Trichophyton rubrum*, *Trichophyton mentagrophytes*, *Candida albicans*, and *Malassezia furfur*.

[0005] There are numerous methods for detecting pathogens causing superficial fungal infections. Traditional direct microscopic examination in clinical settings is rapid but nonspecific and relies heavily on the observer's skill. Fungal culture identification is slow, requiring 1-3 weeks, and has a high false-negative rate; up to 30% of microscopically positive samples do not grow on the culture (especially nail samples), resulting in low detection rates. Commercially available test strips (kits) based on antigen-antibody reactions offer the advantages of simplicity and speed, but their lower sensitivity and false-positive results limit their application. In recent years, molecular biology-related detection technologies have flourished, with PCR-first-generation sequencing, LAMP, gene chips, digital PCR, and NGS all being used for the detection of various clinical pathogens; however, these methods still suffer from drawbacks such as high cost, demanding operational requirements, and time-consuming processes. Summary of the Invention

[0006] This invention provides a primer set for multiplex qPCR detection of superficial fungal pathogens, comprising specific primers and probes for detecting eight superficial fungal pathogens. The multiplex qPCR detection also involves other conventional reagents used in the process. This method uses the human β-actin gene as an internal control. Through this method, high-throughput detection of superficial skin samples can be achieved. It is simple, rapid, accurate, and economical, providing a new approach for the early clinical diagnosis and detection of superficial fungal pathogens.

[0007] The multiplex qPCR primer set of this invention includes specific primers and probes for detecting *Trichophyton rubrum*, *Epidermophyton floccosum*, *Microsporum canis*, *Trichophyton mentagrophytes*, *Microsporum gypseum*, *Candida albicans*, *Malassezia furfur*, and *Microsporum audouinii*. Specifically, the specific primers for *Trichophyton rubrum* are GCCGTACGCCCCCATTCTTG and CGCCGGAGGACAGAGTCCAA, and the probe is TCCCCCTGCCAGGGAGAGCCGT; the specific primers for *Epidermophyton floccosum* are CCATAGGTGGTTCACACTGA and CGAAATGCGATAAGTAATGCG, and the probe is TCAAAACTTTCAACAACGGATA; the specific primers for *Microsporum canis* are...

[0008] The probes are ATCCCCTTCCCCACCCGTGA and ATTCCCATTCCCACTCTGTGG, and the specific primers for Trichophyton mentagrophytes are AGCAGCAACAGCAGCAACAGA;

[0009] CCGTACCGCCCCATTCTCGT and GGCTAAACGCTGGACCGCGC, with probes TTGCCTCGGCGCTGCGCGCT; specific primers for Microsporum gypseum are...

[0010] CCGGCCACACGCCCATTCTT and ACAATCAACTCCCTGGAGAG, with the probe being TCGGCGGGTTACGCACTCGT; specific primers for Candida albicans are...

[0011] AAAGCTCGTAGGGGAACC and ATTAGAGTGTTCAATCCA, the probe is

[0012] TTTGATGTGTACTGCACCCA; Specific primers for Malassezia furfur are:

[0013] AAAGCTAAGTATCGGGGATTGA and AGCACTTTGGAAAGAGAGTTAAGT, with probes ACAGTACCGTGAGGGAAGATA. Specific primers for *Microsporum audouinii* are...

[0014] CTCGTGCCGTGATGGTTGAT and TCCGTCCAGACAACTTCCTCT, with the probe being CGCTCGAGGCAGTCCGTGC.

[0015] The method for using the above-mentioned multiplex qPCR detection primer combination is as follows:

[0016] 1. Nucleic acid (DNA) extraction from samples, which may be skin swabs or secretions;

[0017] A. Place the collected skin swab or secretion samples into a storage tube containing nucleic acid preservation solution and shake thoroughly to promote the release of pathogens;

[0018] B. Place the pathogen preservation solution from step A into a centrifuge tube, and then add cell lysis buffer to lyse the cells;

[0019] C. Take the lysis buffer from step B and extract nucleic acid using the Tiangen Virus DNA / RNA Genome Extraction Kit;

[0020] 2. Using the nucleic acid from step 1 as a template, specific primers and probes targeting eight pathogens were used for detection via multiplex real-time quantitative PCR. Results were determined based on Ct values. Specific primers and probes for Trichophyton rubrum, Epidermophyton floccosum, and Microsporum canis were used together in the detection. Specific primers and probes for Trichophyton mentagrophytes and Microsporum gypseum were used together in the detection. Specific primers and probes for Candida albicans, Malassezia furfur, and Microsporum audouinii were used together in the detection, with the human β-actin gene as an internal control.

[0021] 3. Interpretation of test results

[0022] (1) The internal control (human β-actin gene, β-Actin gene) Ct value ≤ 36, and the negative control group and template-free control group have no Ct value; if they do not meet the requirements, multiplex real-time quantitative PCR detection must be performed again, or nucleic acid must be extracted again for multiplex real-time quantitative PCR detection.

[0023] (2) The pathogen Ct value is ≤36.0. If the Ct value is >36.0, single real-time quantitative PCR verification is required for the pathogen.

[0024] (3) The amplification curve is a standard “S” shape and there are no abnormal fluctuations.

[0025] Compared with the prior art, the present invention has the following advantages and technical effects:

[0026] 1. The primer and probe set provided by this invention for detecting eight superficial fungal pathogens has high detection efficiency and accurate detection results, and can complete pathogen diagnosis quickly and at low cost.

[0027] 2. This invention is based on the real-time fluorescence quantitative PCR technology platform to qualitatively detect pathogen-specific target genes. Multiple samples can be tested in one experiment. It has the characteristics of being rapid, specific and economical, which greatly reduces the detection cost of superficial fungal infection samples. Attached Figure Description

[0028] Figure 1 shows the results of multiplex qPCR specificity tests for Trichophyton rubrum, Epidermophyton floccosum, and Microsporum canis.

[0029] Figure 2 shows the results of multiplex qPCR specificity tests for Trichophyton mentagrophytes and Microsporum gypseum.

[0030] Figure 3 shows the results of multiplex qPCR specificity tests for Candida albicans, Malassezia furfur, and Microsporum audouinii;

[0031] Figure 4 shows the results of the multiplex qPCR sensitivity test for Trichophyton rubrum;

[0032] Figure 5 shows the results of the multiplex qPCR sensitivity test for Epidermophyton floccosum;

[0033] Figure 6 shows the results of the multiplex qPCR sensitivity test for Microsporum canis;

[0034] Figure 7 shows the results of the multiplex qPCR sensitivity test of Trichophyton mentagrophytes;

[0035] Figure 8 shows the results of the multiplex qPCR sensitivity test for Microsporum gypseum;

[0036] Figure 9 shows the results of the multiplex qPCR sensitivity test for Candida albicans;

[0037] Figure 10 shows the results of the multiplex qPCR sensitivity test of Malassezia furfur;

[0038] Figure 11 shows the results of the multiplex qPCR sensitivity test for Microsporum audouinii;

[0039] Figure 12 shows the results of the multiplex qPCR sensitivity test of the internal reference β-Actin gene. Detailed Implementation

[0040] The following examples further illustrate the specific implementation of the present invention, but the implementation and protection of the present invention are not limited thereto. It should be noted that any processes not specifically described below are those that can be implemented or understood by those skilled in the art by referring to existing technology; reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0041] Example 1: Primer and probe design

[0042] 1. Download the following pathogen gene reference sequences from the NCBI (National Center for Biotechnology Information) website: 20 each of the following: Trichophyton rubrum ITS coding gene, Epidermophyton floccosum ITS coding gene, Microsporum canis VelB coding gene, Trichophyton mentagrophytes ITS coding gene, Microsporum gypseum ITS coding gene, Candida albicans SSU rRNA coding gene, Malassezia furfur LSU rRNA coding gene, and Microsporum audouinii β-tubulin 2 coding gene;

[0043] 2. Use Mega 7 software to align nucleotide sequences, and use Primer Select software to design primers and probes, meeting the following conditions:

[0044] (1) Tm value: Generally, the probe Tm value is 8-10℃ higher than the primer Tm, and the probe Tm value is generally 60℃;

[0045] (2) GC content: generally not less than 40%;

[0046] (3) No primer dimers are generated, and the hairpin structure software evaluation result is OK;

[0047] (4) The size of the amplified fragment is generally less than 200bp;

[0048] 3. Primer and probe BLAST evaluation: The nucleotide sequences of the initially designed primers and probes are compared again using the BLAST search function on the NCBI website to select primers and probe sequences with high specificity.

[0049] The nucleotide sequences of specific primers and probes targeting eight superficial fungal pathogens and the internal reference β-Actin gene (SEQ ID NO:1-SEQ ID NO:27) are shown in the table below;

[0050]

[0051]

[0052] Example 2: Establishment of Real-Time Quantitative PCR Method

[0053] 1. Construction of plasmids

[0054] The specific sequences of eight pathogens and the sequence of the internal reference gene β-Actin (SEQ ID NO:1 SEQ ID NO:9) were ligated into the pUC57 vector to synthesize plasmid standards. Specifically, *Trichophyton rubrum*, *Epidermophyton floccosum*, and *Microsporum canis* were synthesized on one plasmid; *Trichophyton mentagrophytes*, *Microsporum gypseum*, and β-Actin were synthesized on another plasmid; and *Candida albicans*, *Malassezia furfur*, and *Microsporum audouinii* were synthesized on yet another plasmid. Plasmid construction was completed by Sino-American Taihe Biotechnology Beijing Co., Ltd. Concentrations were determined using a UV spectrophotometer, and the copy number of each plasmid was calculated based on its length and concentration.

[0055] The copy number results are shown in the table below:

[0056]

[0057]

[0058] The plasmid was serially diluted using a 10-fold dilution method, with a total of 7 dilutions set up. 6 10 5 10 4 10 3 10 2 101 10 0 The quantity is on the order of copies / μL.

[0059] 2. Specificity, sensitivity, and repeatability tests

[0060] (1) Specificity

[0061] Using the plasmid standard synthesized in step 1 as a template (dilution concentration of 10), 3 The pathogen multiplex quantitative PCR reaction system and amplification conditions are as follows: (copies / μL);

[0062]

[0063] Amplification conditions: 95℃, 30s; (95℃, 5s; 58℃, 30s) 45 cycles;

[0064] The results are shown in Figures 1-3. As can be seen from the figures, all eight pathogens and the internal reference β-Actin gene showed amplification curves, and the primers and probes did not interfere with each other after combination.

[0065] (2) Sensitivity

[0066] To validate the sensitivity of the established multiplex qPCR detection method, a concentration gradient of 10 was used. 6 10 5 10 4 10 3 10 2 10 1 10 0 The experiment used plasmid templates in copies / μL to determine the lowest plasmid copy number that the multiplex qPCR detection method could detect. The multiplex real-time PCR reaction system and amplification conditions are as follows:

[0067]

[0068] Amplification conditions: 95℃, 30s; (95℃, 5s; 58℃, 30s) 45 cycles;

[0069] The results are shown in Figure 4-12. The lower limits of detection (LDDs) for *Trichophyton rubrum*, *Epidermophyton floccosum*, and *Microsporum canis* were 1.03 × 10⁻⁶, 1.04 × 10⁻⁶, and 1.02 × 10⁻⁶ copies / μL, respectively; for *Trichophyton mentagrophytes* and *Microsporum gypseum*, the LTDs were 3.33 × 10⁻⁶ and 3.34 × 10⁻⁶ copies / μL, respectively; and for *Candida albicans*, *Malassezia furfur*, and *Microsporum audouinii*, the LTDs were 7.15 × 10⁻⁶, 7.30 × 10⁻⁶, and 7.27 × 10⁻⁶ copies / μL, respectively. The multiplex qPCR sensitivity assay for the β-Actin gene showed that the detection limit for the internal reference β-Actin gene reached the order of 10 copies / μL.

[0070] (3) Repeatability

[0071] To verify the stability of the established multiplex qPCR detection method, 10 3 Experiments were conducted using plasmids at the copy / μL level, with intra-batch and inter-batch repeatability tests performed. Quantitative real-time PCR was performed on the plasmids using pathogen-specific primers and probes for each pathogen. The multiplex quantitative real-time PCR reaction system and amplification conditions are as follows:

[0072]

[0073] Amplification conditions: 95℃, 30s; (95℃, 5s; 58℃, 30s) 45 cycles;

[0074] The CV values ​​were calculated for intra-batch and inter-batch experiments over three consecutive weeks. The repeatability results are shown in the table below:

[0075]

[0076] Based on the above repeatability test results, it can be seen that the established multiplex real-time fluorescence quantitative method based on 8 superficial fungal pathogens and 1 internal reference gene has high stability (CV less than 5%).

[0077] Example 3: Detection of skin swabs and other skin samples

[0078] 1. Sample collection

[0079] Use a swab to collect microorganisms from the skin surface. When sampling, do not hold the swab beyond the broken edge to avoid contaminating the sample. For normal skin, a sampling area of ​​5cm x 5cm is recommended, with a minimum sampling area of ​​4cm x 4cm. Exposed skin (face, hands) has a richer microbial population, while covered areas (abdomen, lower legs) have fewer microorganisms, requiring a larger sampling area. During collection, divide the target area into four rectangular sections from top to bottom. Place a sterile cotton swab moistened with physiological saline on the sampling surface, bending it at a 45-degree angle to the surface. Wipe the sampling surface smoothly and slowly, repeating this process at least five times in each area. After wiping one area, rotate the swab 90 degrees before wiping the next area to ensure sufficient microbial sample is collected.

[0080] If a skin sample with wounds or inflammation and pus is required, it should be taken directly from the wound or purulent tissue. Skin lesions generally have a rich microbial population, but excessive pus or tissue fluid can interfere with subsequent microbial genetic testing. One collection swab is used for each sample. The patient's name and identification information are recorded on the label. The sampling tube is transported to the laboratory, stored at approximately 4°C during transport, and then stored at -80°C until analysis.

[0081] 2. Genomic DNA extraction

[0082] Genomic DNA extraction: Nucleic acid was extracted from the collected samples using a viral genomic DNA / RNA extraction kit. The specific steps are as follows:

[0083] (1) Use a pipette to add 20 μL of Proteinase K to a clean 1.5 mL centrifuge tube;

[0084] (2) Add 200 μL of sample to the centrifuge tube;

[0085] (3) Add 200 μL of Carrier RNA working solution (a mixture of buffer GB and Carrier RNA solution, prepared according to the formula: n × 0.22 mL = y mL; y mL × 28 μL / mL = z μL; where n = the number of samples extracted at the same time, y = the volume of buffer GB to be added, and z = the volume of Carrier RNA solution to be added), cap the tube, and vortex for 15 seconds to mix thoroughly to ensure that the sample and Carrier RNA working solution are thoroughly mixed and that the lysis is complete.

[0086] (4) Incubate at 56°C for 15 min, then briefly centrifuge to collect the liquid adhering to the tube wall and tube cap;

[0087] (5) Add 250 μL of anhydrous ethanol. At this time, flocculent precipitate may appear. Cover the tube and vortex for 15 seconds to mix thoroughly. Let it stand at room temperature (15-25℃) for 5 minutes.

[0088] (6) Brief centrifugation to collect the liquid adhering to the tube wall and tube cap;

[0089] (7) Carefully transfer all the solution and flocculent precipitate in the centrifuge tube to the RNase-Free adsorption column CR2 (place the adsorption column in the collection tube), cover the tube, centrifuge at 8000 rpm for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.

[0090] (8) Carefully open the cap of the adsorption column, add 500 μL of buffer GD (please check before use whether anhydrous ethanol has been added), cap the tube, centrifuge at 8000 rpm for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.

[0091] (9) Carefully open the adsorption column cap, add 600 μL of washing solution PW (please check whether anhydrous ethanol has been added before use), cap the tube, let stand for 2 min, centrifuge at 8000 rpm for 1 min, discard the waste liquid, and put the adsorption column back into the collection tube.

[0092] (10) Repeat step 9;

[0093] (11) Carefully open the adsorption column cap, add 500 μL of anhydrous ethanol, close the cap, centrifuge at 8000 rpm for 1 min, and discard the waste liquid.

[0094] (12) Place the adsorption column back into the collection tube, centrifuge at 12000 rpm for 3 min to completely dry the adsorption membrane, and discard the waste liquid.

[0095] (13) Place the adsorption column into an RNase-Free centrifuge tube (1.5 mL), carefully open the cap of the adsorption column, place it at room temperature for 3 min to allow the adsorption membrane to dry completely, add 50 μL of RNase-Free ddH2O dropwise to the middle part of the adsorption membrane, close the cap, place it at room temperature for 5 min, and centrifuge at 12000 rpm for 1 min.

[0096] (14) Collect nucleic acid in centrifuge tubes, label the information, and store at -80℃.

[0097] 3. Fifteen positive skin swab and secretion samples were collected from the hospital. After nucleic acid extraction, they were subjected to first-generation sequencing (Sanger sequencing). The sequencing results were compared with NCBI Blast to determine the pathogen species. At the same time, the multiplex qPCR method of this invention was used to test these 15 samples, and the test results were recorded as follows:

[0098] qPCR results and first-generation sequencing results of the tested samples: Sample-1: Trichophyton rubrum; Sample-2: Malassezia furfur, Trichophyton rubrum; Sample-3: Trichophyton mentagrophytes; Sample-4: Microsporum audouinii, Malassezia furfur; Sample-5: Trichophyton rubrum, Malassezia furfur; Sample-6: Candida albicans; Sample-7: Trichophyton rubrum, Trichophyton rubrum Sa Sample-8 Malassezia furfur, Malassezia furfur; Sample-9 Trichophyton mentagrophytes, Malassezia furfur, Trichophyton mentagrophytes; Sample-10 Microsporum canis, Microsporum hominis; Sample-11 Microsporum gypseum, Microsporum gypseum; Sample-12 Trichophyton mentagrophytes, Trichophyton mentagrophytes; Sample-13 Epidermophyton floccosum, Epidermophyton floccosum; Sample-14 Trichophyton mentagrophytes, Trichophyton mentagrophytes; Sample-15 Trichophyton rubrum, Candida albicans, Trichophyton rubrum. surface

[0099] As shown in the table above, the primer and probe set designed in this invention for multiplex qPCR detection of eight pathogens of superficial fungal diseases is faster and more convenient than the first-generation sequencing detection method.

[0100] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A multiplex qPCR primer set for detecting superficial fungal pathogens, characterized in that: This includes specific primers and probes for detecting *Trichophyton rubrum*, *Epidermophyton floccosum*, *Microsporum canis*, *Trichophyton mentagrophytes*, *Microsporum gypseum*, *Candida albicans*, *Malassezia furfur*, and *Microsporum audouinii*. Specifically, the specific primers for *Trichophyton rubrum* are GCCGTACGCCCCCATTCTTG and CGCCGGAGGACAGAGTCCAA, and the probe is TCCCCCTGCCAGGGAGAGCCGT; the specific primers for *Epidermophyton floccosum* are CCATAGGTGGTTCACACTGA and CGAAATGCGATAAGTAATGCG, and the probe is TCAAAACTTTCAACAACGGATA; the specific primers for *Microsporum canis* are ATCCCCTTCCCCACCCGTGA and ATTCCCATTCCCACTCTGTGG, and the probe is AGCAGCAACAGCAGCAACAGA; and the specific primers for *Trichophyton mentagrophytes* are CCGTACCGCCCCATTCTCGT and GGCTAAACGCTG. The specific primers for GACCGCGC are TTGCCTCGGCGCTGCGCGCT; for Microsporum gypseum, the specific primers are CCGGCCACACGCCCATTCTT and ACAATCAACTCCCTGGAGAG, and the probe is TCGGCGGGTTACGCACTCGT; for Candida albicans, the specific primers are AAAGCTCGTAGGGGAACC and ATTAGGTGTTCAATCCA, and the probe is TTTGATGTGTACTGCACCCA; for Malassezia furfur, the specific primers are AAAGCTAAGTATCGGGGATTGA and AGCACTTTGGAAAGAGAGTTAAGT, and the probe is ACAATACCGTGAGGGAAGATA; for Microsporum audouinii, the specific primers are CTCGTGCCGTGATGGTTGAT and TCCGTCCAGACAACTTCCTCT, and the probe is CGCTCGAGGCAGTCCGTGC.

Citation Information

Patent Citations

  • Method and kit for detecting multiple skin fungi once

    CN111961745A