A method for improving the activity of phospholipase d in synthesizing ps by single-point mutation
By performing specific mutations and optimizations on the amino acid sequence of phospholipase D, the problem of insufficient catalytic performance of phospholipase D was solved, and the efficient synthesis of phosphatidylserine (PS) from phospholipase D was achieved. The yield of PS was significantly improved after the mutation.
Patent Information
- Application Number
- CN202211699856.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-28
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2042-12-28
AI Technical Summary
The catalytic performance and reaction selectivity of existing phospholipase D need to be improved, making it difficult to efficiently synthesize phosphatidylserine (PS), and there are few studies on virtual mutation of PLD catalytic performance.
By performing point mutations on the amino acid sequence of phospholipase D, particularly mutations in D175A, D175L, S451A, S451L, T194A, T194L, S457A, or S457L, combined with molecular docking and molecular dynamics simulations, the active site and substrate binding site of the enzyme can be optimized, increasing the size of the binding pocket between phospholipase D and its substrate, inhibiting hydrolytic activity, and improving PS synthesis rate.
The mutation significantly improved the PS synthesis rate of phospholipase D. The hydrolytic activity of phospholipase D decreased after mutation. The PS yield of specific mutants such as T194A and T194L increased to 53.52% and 49.23%, respectively, and the mutation efficiency was significantly improved.
Smart Images

Figure CN116334032B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a single-point mutation method for improving the PS synthesis activity of phospholipase D. Background Technology
[0002] Phospholipids are a collective term for compounds containing phosphate groups. Their molecular structure consists of two hydrophobic long carbon chains and one polar head. First discovered in egg yolks, phospholipids are major components of cell membranes in living organisms, widely distributed in various cell tissues of animals and plants, playing a crucial role in signal transduction and promoting metabolism. The main physiological functions of phospholipids are determined by their polar head. Based on the type of polar head, phospholipids can be classified as: phosphatidylcholine (PC), phosphatidylerhanolamine (PE), phosphatidylserine (PS), phosphatidylinositol (PI), phosphatidylglycerol (PG), etc. Although phospholipids are widely distributed and diverse in nature, their distribution is quite uneven. PS (phospholipids) is an essential active substance present on cell membranes. It can regulate the rapid absorption of membrane proteins by the human body, efficiently cross the blood-brain barrier, and safely slow down or even repair damaged cell membranes of nerve cells in the human brain. This can improve patients' cognitive, learning, and memory abilities, and has a certain auxiliary effect in the treatment of Alzheimer's disease. It is mainly extracted from soybeans, but also exists in brain cells and peanuts. In animals, PS is mainly found in brain and liver cells; however, the safety of the product is threatened due to the susceptibility of animals to disease. In plants, PC (polyphospholipids) is the most abundant phospholipid, while PS is relatively scarce and difficult to extract. Therefore, the enzymatic conversion method for synthesizing PS has emerged, offering advantages such as operational stability and high specificity.
[0003] Phospholipase D (PLD) is a specialized phospholipid hydrolase that catalyzes the hydrolysis of phospholipids, releasing the polar head of the original phospholipid to generate phosphatidic acid (PA). Furthermore, in the presence of a second substrate (a nucleophile, such as serine, ethanolamine, or glycerol), PLD can catalyze the cleavage of the phosphodiester bond in phospholipids, promoting the binding of the phosphoryl group to the nucleophile and generating new phospholipids. The PLD-catalyzed phosphatidyl transfer reaction is currently the most widely used and efficient method for the artificial synthesis of phospholipids (PS).
[0004] However, the known phosphatidyl transfer activity, reaction selectivity, and stability of PLD need further improvement. Molecular docking techniques are used to study the potential for substrate-enzyme binding, combined with molecular dynamics simulations to determine the stability of the binding complex, and further, binding-free energy analysis is used to determine the direction and extent of the reaction. Utilizing rational protein design can minimize the experimental workload of site-directed mutagenesis. Considering that each mutation site has 20 possible mutation scenarios (19 substitution mutations and 1 deletion mutation), biomolecular simulation techniques can be used to virtually screen mutant libraries, greatly improving the actual mutagenesis efficiency. Currently, there are almost no reports on the catalytic performance of PLD through virtual mutation, and the catalytic performance of PLD needs further improvement. Summary of the Invention
[0005] The present invention aims to provide a single-point mutation method to improve the activity of phospholipase D in synthesizing PS, thereby enhancing the catalytic performance of PLD.
[0006] To achieve the above objectives, the present invention provides the following technical solution:
[0007] This invention provides a mutant protein of phospholipase D by point mutation of the amino acid sequence of phospholipase D, wherein the amino acid sequence of the phospholipase includes the sequence shown in SEQ ID NO.1; the mutation site is: D175A, D175L, S451A, S451L, T194A, T194L, S457A or S457L.
[0008] The present invention also provides a recombinant bacterium expressing the above-mentioned mutant protein.
[0009] Preferably, as an improvement, the base strain of the recombinant bacteria includes Escherichia coli.
[0010] The present invention also provides a method for constructing the above-mentioned recombinant bacteria, comprising the following steps:
[0011] (1) Cultivate wild-type E. coli TOP10 / pBADKP-PLD2, wherein the vector is plasmid pBADKP and the host cell is E. coli TOP10. For the specific construction method, see patent CN109136207B.
[0012] (2) Plasmid pBADKP containing the gene encoding the amino acid sequence shown in SEQ ID NO.1 was extracted from strain E. coli TOP10 / pBADKP-PLD2 using the Plasmid Mini Kit Ⅰ kit, and plasmid pBADKP was used as a template for mutant PCR.
[0013] (3) The plasmid was amplified by PCR using site-directed mutagenesis primers to obtain the amplification product;
[0014] (4) The template DNA of the amplified product was digested with DpnI enzyme to obtain the digestion product;
[0015] (5) The digestion product was introduced into E. coli top10 competent cells by heat stimulation, and the recombinant bacteria were obtained by screening for single clones in LB solid medium containing kanamycin resistance.
[0016] Preferably, as an improvement, the site-directed mutation primers in step (3) include: mutation primers D175A-F and D175A-R for D175A site mutations, wherein the nucleotide sequence of D175A-F is as shown in SEQ ID NO.2 and the nucleotide sequence of D175A-R is as shown in SEQ ID NO.3;
[0017] The mutant primers D175L-F and D175L-R are for the D175L point mutation, wherein the nucleotide sequence of D175L-F is as shown in SEQ ID NO.4 and the nucleotide sequence of D175L-R is as shown in SEQ ID NO.5;
[0018] The mutant primers D451A-F and D451A-R are for the D451A point mutation, wherein the nucleotide sequence of D451A-F is as shown in SEQ ID NO.6 and the nucleotide sequence of D451A-R is as shown in SEQ ID NO.7;
[0019] The mutant primers D451L-F and D451L-R are for the D451L point mutation, wherein the nucleotide sequence of D451L-F is as shown in SEQ ID NO.8 and the nucleotide sequence of D451L-R is as shown in SEQ ID NO.9.
[0020] The mutation primers T194A-F and D194A-R are for the T194A point mutation, wherein the nucleotide sequence of T194A-F is as shown in SEQ ID NO.10 and the nucleotide sequence of T194A-R is as shown in SEQ ID NO.11;
[0021] The mutant primers T194L-F and D194L-R are for the T194L point mutation, wherein the nucleotide sequence of T194L-F is as shown in SEQ ID NO.12 and the nucleotide sequence of T194L-R is as shown in SEQ ID NO.13;
[0022] The mutant primers D457A-F and D457A-R are for the D457A point mutation, wherein the nucleotide sequence of D457A-F is as shown in SEQ ID NO.14 and the nucleotide sequence of D457A-R is as shown in SEQ ID NO.15;
[0023] The mutant primers D457L-F and D457L-R are for the D457L point mutation, wherein the nucleotide sequence of D457L-F is as shown in SEQ ID NO.16 and the nucleotide sequence of D457L-R is as shown in SEQ ID NO.17.
[0024] The mutant primers T194I-F and D194I-R are for the T194I point mutation, wherein the nucleotide sequence of T194I-F is as shown in SEQ ID NO.18 and the nucleotide sequence of T194I-R is as shown in SEQ ID NO.19;
[0025] The mutation primers T194V-F and D194V-R are for the T194V point mutation, wherein the nucleotide sequence of T194V-F is as shown in SEQ ID NO.20 and the nucleotide sequence of T194V-R is as shown in SEQ ID NO.21;
[0026] The mutant primers T194M-F and D194M-R are for the T194M point mutation, wherein the nucleotide sequence of T194M-F is as shown in SEQ ID NO.22 and the nucleotide sequence of T194M-R is as shown in SEQ ID NO.23;
[0027] The mutant primers T194F-F and D194A-R are for the T194F point mutation, wherein the nucleotide sequence of T194F-F is as shown in SEQ ID NO.24 and the nucleotide sequence of T194F-R is as shown in SEQ ID NO.25;
[0028] The mutant primers T194C-F and D194C-R are for the T194C point mutation, wherein the nucleotide sequence of T194C-F is as shown in SEQ ID NO.26 and the nucleotide sequence of T194C-R is as shown in SEQ ID NO.27;
[0029] The mutant primers T194P-F and D194P-R are for the T194P point mutation, wherein the nucleotide sequence of T194P-F is as shown in SEQ ID NO.28 and the nucleotide sequence of T194P-R is as shown in SEQ ID NO.29.
[0030] Preferably, as an improvement, the PCR amplification program in step (3) includes: 98°C pre-denaturation for 5 min; 98°C denaturation for 10 s, 55~65°C annealing for 30 s, 72°C extension for 2 min, extension at 1 min / kb, 30 cycles; 72°C extension for 10 min; 4°C hold.
[0031] Preferably, as an improvement, the recombinant bacteria described in step (5) are mixed with 40% glycerol at a 1:1 ratio and stored at -80°C for later use.
[0032] Preferably, as an improvement, step (1) uses LB culture based on 37°C and 200 rpm for 12 h.
[0033] The present invention also provides a method for preparing phospholipase D from the above-mentioned recombinant bacteria expressing phospholipase D, comprising the following steps: after the recombinant bacteria expressing phospholipase D is revived in LB medium, it is transferred to TB medium and cultured for 5-6 h, and then transferred to TB adjustment medium, where an inducer is added to induce the expression of phospholipase D.
[0034] Preferably, as an improvement, the inducing agent comprises: arabinose, DTT, ethanol, butanol, and an antibiotic, wherein the arabinose concentration is 0.035%·OD. 600 -1 After adding the inducer to the TB conditioning medium, expression was induced for 16 h at 18°C and 200 rpm in a shaker.
[0035] This method provides a mutant protein of phospholipase D. The mutant protein is obtained by comparing the amino acid sequence of PLD (2ZE4) with that of PLD from Streptomyces sp. PMF, PDB number 1V0S, as reported in the literature, to determine the active site of the enzyme. Then, the amino acids near the active site of the enzyme are mutated into hydrophobic amino acids. Using the software AutoDock Vina, PLD (2ZE4) is molecularly docked with the substrates PC and L-ser, respectively, to determine the binding sites between the substrate molecules and the enzyme molecules. Then, the amino acids at the binding sites on PLD are mutated into hydrophobic amino acids to inhibit the hydrolytic activity of PLD and increase the pocket size of the PLD-substrate binding site. Compared with the original strain, this method significantly reduced the hydrolytic activity of phospholipase D by mutating the amino acids at four sites (D175, S451, T194, and S457) to A and L. This means that mutating the binding site amino acids to hydrophobic amino acids can inhibit the hydrolytic activity of PLD. Among them, S457A, D175A, S451A, S457L, D175L, and S451L have almost no transacylation activity and cannot convert PC to PS. The yield of PS synthesis by T194A and T194L was significantly improved. Under the same reaction conditions, the PS yield increased from 27.46% to 53.52% and 49.23%, respectively. Attached Figure Description
[0036] Figure 1 This is a schematic diagram of the active center of the PLD (2ZE4) in Embodiment 1 of the present invention.
[0037] Figure 2 This is a diagram showing the docking results of PLD (2ZE4) with the substrate PC molecule in Example 1 of the present invention.
[0038] Figure 3 This is a diagram showing the docking results of PLD (2ZE4) with the substrate L-ser molecule in Example 1 of the present invention.
[0039] Figure 4 This is a protein electrophoresis diagram of a partial mutant strain of phospholipase D designed for MOE molecular docking in Example 2 of the present invention.
[0040] Figure 5 The hydrolase activity and PS yield of the partial mutant strain of phospholipase D designed for MOE molecular docking in Example 3 of this invention.
[0041] Figure 6 This is a protein electrophoresis diagram of phospholipase D after a single-point mutation of T194 in Example 4 of the present invention.
[0042] Figure 7 The hydrolase activity and PS yield of phospholipase D after a single-point mutation at the T194 site in Example 4 of this invention. Detailed Implementation
[0043] The following detailed description illustrates the specific implementation method:
[0044] This invention discloses a phospholipase D mutant, its preparation method and application, the DNA molecule encoding the phospholipase D mutant, and the host cell. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0045] This invention utilizes conventional techniques and methods found in the fields of genetic engineering and molecular biology, and these general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in this invention, employ other conventional methods, experimental protocols, and reagents, without being limited to the specific embodiments of this invention. For example, the following experimental materials and reagents may be used in this invention:
[0046] PLD (2ZE4): Derived from Streptomyces antibioticus, PDB number is 2ZE4 ligandless PLD, PLD gene number is Genebank no. MH237968.
[0047] PLD (1V0S): Derived from Streptomyces sp. PMF, PLD with PDB number 1V0S.
[0048] AutoDock Vina: An open-source molecular simulation software primarily used for performing ligand-protein molecular docking.
[0049] E. coli TOP10 / pBADKP-PLD2: Wild-type E. coli TOP10 / pBADKP-PLD2 containing the PLD gene from Streptomyces antibioticus (Genebank no. MH237968) was deposited at -80°C by our research group (Lu Yinghua's research group, College of Chemistry and Chemical Engineering, Xiamen University). The construction method of this strain has been disclosed in the form of a patent, patent application number: CN201810843255.2.
[0050] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride.
[0051] Plasmid Mini Kit Ⅰ Reagent Kit: Plasmid Extraction Kit.
[0052] Primer X is an online tool for designing mutant PCR primers.
[0053] TB culture medium (g·L) -1 ): Yeast extract 24, peptone 12, potassium dihydrogen phosphate 2.31, dipotassium hydrogen phosphate 12.54.
[0054] TB adjustment medium: 10 g·L -1 Peptone; 5 g·L -1 Yeast powder; 5 g·L -1 Glycerol; 0.1 M potassium phosphate buffer, pH 7.2.
[0055] The present invention will be further illustrated below with reference to the embodiments.
[0056] Example 1. A method for constructing a phospholipase D mutant Escherichia coli strain
[0057] This invention proposes to modify the active site of PLD and the amino acids near the active site into hydrophobic amino acids with less steric hindrance, so as to inhibit the hydrolytic activity of PLD and increase the pocket size of the PLD-substrate binding site, which is conducive to the entry of small molecule substrates into the active site and react with PLD, thereby improving the conversion rate of PS.
[0058] 1.1 Determine the active sites and binding sites of PLDs
[0059] The amino acid sequence of PLD (2ZE4) was compared with that of PLD derived from Streptomyces sp. PMF, PDB number 1V0S, as reported in the literature. The amino acid composition of the enzyme's active site was determined to be D467, N459, H442, K444, H168, N185, K170 and D200, as detailed in the attached figure. Figure 1 As shown.
[0060] Using the software AutoDock Vina, PLD (2ZE4) was molecularly docked with the substrates PC and L-ser, respectively, to determine the binding sites between the substrate molecules and the enzyme molecules, as detailed in the attached figure. Figure 2 and attached Figure 3As shown, when the binding free energy is -5.3260 kcal / mol, the binding sites of PC and 2ZE4 are 31 amino acid sites among 85-95, 120-130, 165-175, 185-195, 340-350, 370-390, and 440-470; when the binding free energy is -5.7780 kcal / mol, the binding sites of L-ser and 2ZE4 are 12 amino acid sites among 70-90, 170-185, and 200-205.
[0061] 1.2 Determine the mutation point of PLD
[0062] After determining the active site of PLD and the binding sites of substrates PC and L-ser with PLD, the first consideration was to modify the active site of PLD and the amino acids surrounding the active site to hydrophobic amino acids with less steric hindrance. This would inhibit the hydrolytic activity of PLD and increase the pocket size of the PLD-substrate binding site, facilitating the entry of small molecule substrates into the active site to react with PLD, thereby improving the conversion rate of PS. Therefore, D175, S451, T194, and S457 were first mutated to the hydrophobic amino acids alanine (A) and leucine (L) with less steric hindrance, resulting in D175A, S451A, T194A, S457A and D175L, S451L, T194L, S457L. The amino acids corresponding to D175, S451, T194, and S457 are Asp, Ser, Thr, and Ser, respectively.
[0063] 1.3 Design of PLD mutant primers
[0064] Wild-type E. coli TOP10 / pBADKP-PLD2 containing the PLD gene derived from Streptomyces antibioticus (Genebank no. MH237968) was constructed by our research group and stored at -80°C. The phospholipase D nucleotide sequence expressed by this PLD gene is shown in SEQ ID NO.1. An appropriate amount of frozen bacterial culture was cultured in LB medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride) at 37°C and 200 rpm for 12 h. Then, the plasmid pBADKP containing the target gene PLD was extracted using the Plasmid MiniKit I kit and used as a template for mutant PCR. Mutation primers D175A, S451A, T194A, S457A and D175L, S451L, T194L, S457L were designed using Primer X online software. The specific primer sequences are shown in Table 1.
[0065] The upstream and downstream mutation primers for D175A are SEQ ID NO.2 and SEQ ID NO.3, the upstream and downstream mutation primers for D175L are SEQ ID NO.4 and SEQ ID NO.5, the upstream and downstream mutation primers for D451A are SEQ ID NO.6 and SEQ ID NO.7, the upstream and downstream mutation primers for D451L are SEQ ID NO.8 and SEQ ID NO.9, the upstream and downstream mutation primers for T194A are SEQ ID NO.10 and SEQ ID NO.11, the upstream and downstream mutation primers for T194L are SEQ ID NO.12 and SEQ ID NO.13, the upstream and downstream mutation primers for D457A are SEQ ID NO.14 and SEQ ID NO.15, and the upstream and downstream mutation primers for D457L are SEQ ID NO.16 and SEQ ID NO.17.
[0066] Table 1 Mutant Primers
[0067] mutation site 5'→3' primer 3'→5' primer D175A caaactgctggttgttgcgggtaaaacagcaattacc ggtaattgctgttttacccgcaacaaccagcagtttg S451A ctggtgagcgttgatgatgccgcattttatattggtag ctaccaatataaaatgcggcatcatcaacgctcaccag T194A gatgattatctggatgcggcgcatccggtgagtg cactcaccggatgcgccgcatccagataatcatc S457A gatagcgcattttatattggtgcgaaaaatctgtatccggcatg catgccggatacagatttttcgcaccaatataaaatgcgctatc D175L catagcaaactgctggttgttctgggtaaaacagcaattaccgg ccggtaattgctgttttaccccagaacaaccagcagtttgctatg S451L ggtgagcgttgatgatctggcattttatattggtag ctaccaatataaaatgccagatcatcaacgctcacc T194L gaaagatgattatctggatctggcgcatccggtgagtgatg catcactcaccggatgcgccagatccagataatcatctttc S457L gatagcgcattttatattggtctgaaaaatctgtatccggcatgg ccatgccggatacagatttttcagaccaatataaaatgcgctatc
[0068] 1.4 PCR Amplification
[0069] The plasmid was amplified by PCR using site-directed mutagenesis primers to obtain the amplification products. The specific amplification system and temperature program are shown in Table 2 and Table 3, respectively.
[0070] Table 2 Mutant PCR Amplification System
[0071] reagents Volume (μL) Takara PrimerSTAR Max DNA Polymerase 25 μL Primer (5'→3') 1 μL Primer (3'→5') 1 μL Template 0.5 μL <![CDATA[ddH2O]]> Add to a total volume of 50 μL
[0072] Table 3 Mutant PCR Amplification Program
[0073] Cycle number temperature time 1 cycle 98℃ 5 min 98℃ 10 s 30 cycles 55-65℃ (set according to primer Tm value) 30 s 72℃ 2 min (1 min / kb) 1 cycle 72℃ 10 min 1 cycle 4℃ Hold
[0074] 1.5 Construction of expression vectors
[0075] After PCR amplification, 2 μL of DpnⅠ was added and the mixture was reacted at 37°C for 1.5 h to digest the unmutated template DNA, yielding the digestion product.
[0076] 1.6 Conversion and Screening
[0077] The digested product was heat-excited and introduced into E. coli top10 competent cells, and single-clonal selection was performed using LB solid medium containing kanamycin resistance. After gene sequencing, the target mutant strain was obtained, mixed with 40% glycerol at a 1:1 ratio, and stored at -80°C for later use.
[0078] Example 2. Expression verification of the 8 mutant strains obtained in Example 1.
[0079] 1. Extraction of phospholipase D from cell culture medium
[0080] Take a small amount of bacterial cells from a TOP10 / pBADKP-PLD2 glycerol cryopreservation tube and inoculate them into a 50 mL Erlenmeyer flask containing 10 mL of LB medium. Incubate overnight (12-16 h) at 37°C with a shaker at 200 rpm. Transfer the 1% inoculum to a 250 mL conical flask containing 20 mL of TB medium and incubate at 37°C with a shaker at 200 rpm for 5-6 h, until the OD600 reaches 5-6. Collect the bacterial cells by centrifugation at 10°C and 5000 rpm for 5 min. Resuspend the cells in the same volume of TB medium as before centrifugation, and add 0.035%·OD600⁻¹ arabinose and different concentrations of chemical substances (such as DTT, ethanol, butanol, antibiotics, etc.). Induce expression for 16 h at 18°C with a shaker at 200 rpm. Centrifuge 1 mL of bacterial culture at 10°C and 10,000 rpm for 5 min. Resuspend the cells in 1 mL of PLD extraction buffer (10 mM EDTA, 0.05% sodium deoxycholate, 200 mM Tris-HCl, pH 7.5) and incubate at room temperature for 1 h, vortexing for 5 s every 20 min. Centrifuge at 4°C and 13,000 rpm for 10 min, and collect the supernatant as the intracellular phospholipase D fraction to determine enzyme activity.
[0081] The expression patterns of the original strain and some mutant strains are as follows: Figure 4 As shown.
[0082] Example 3. The activity of phospholipase D hydrolase expressed by eight mutant strains from Example 2 was measured, as well as the activity of phosphatidylserine (PS) catalyzed by lecithin synthesis.
[0083] 1. Determination of phospholipase D hydrolase activity
[0084] The specific steps of the method for measuring phospholipase D activity include:
[0085] (1) Substrate solution: 76 mg phosphatidylcholine (PC, source: soybean, >98%, Aladdin Reagent, Shanghai, China) dissolved in 10 mL of 5% Triton X-100 (w / v) solution;
[0086] (2) Reaction solution: 0.1 mL of 0.1 M Tris-maleate-NaOH (pH 5.5) solution, 0.1 mL of 2.5% Triton X-100 solution and 0.05 mL of 0.01 M CaCl2 solution; 0.1 mL of enzyme sample is mixed with 0.25 mL of reaction solution;
[0087] (3) 0.15 L of substrate solution and the above mixed solution were incubated in a 37°C water bath for 5 min;
[0088] (4) Add 0.1 mL of enzyme sample to the reaction solution and react in a 37°C water bath for 10 min;
[0089] (5) Immediately add 0.2 mL of stop solution (1 M Tris-HCl, pH 8.0, 0.5 M EDTA), and incubate in a 100°C metal bath for 15 min; (6) Cool the reaction solution to room temperature, add 0.2 mL of colorimetric solution (0.1 M Tris-HCl (pH 8.0), 1.25 U choline oxidase, 1 U peroxidase, 1 µmol 4-aminoantipyrine and 1.6 µmol phenol), and incubate in a 37°C water bath for 1 h;
[0090] (7) Dilute the reaction solution at a ratio of 1:8 and add 1% Triton X-100. Take 0.2 mL of the sample and measure the absorbance at 500 nm using a microplate reader. Use different concentrations of choline chloride solution instead of enzyme samples to determine the standard curve. The absorbance values are in the range of 0-0.22, and the choline concentration is in the range of 0-0.25 µmol, showing a good linear correlation between the two.
[0091] Under the above conditions, the amount of phospholipase D that releases 1 µmol of choline per minute is defined as one enzyme activity unit (U).
[0092] 2. Phospholipase D catalyzes the synthesis of phosphatidylserine (PS) from lecithin.
[0093] Take 0.75 mL of crude enzyme solution and 0.75 mL of PLD extract containing 1 M L-serine, 50 mM anhydrous calcium chloride (10 mM EDTA, 0.05% sodium deoxycholate, 200 mM Tris-HCl, pH 7.5), add 3 mL of 10 mM PC in ether solution, and react at 32°C and 200 rpm for two hours. After centrifugation at 4000 rpm at room temperature for 3 min, take 2 mL of the upper layer containing PS in ether solution, dry it under nitrogen, and freeze it at -20°C. Then, the concentration of PS is determined by HPLC.
[0094] 3. Detection and analysis of the product PS
[0095] The PS product, after being dried under nitrogen, was reconstituted with 2 mL of mobile phase (n-hexane:isopropanol:1% acetic acid solution = 8:8:1 (V:V:V)) and the PS content was determined by HPLC. The HPLC conditions were as follows: column: ShimNex S-Sil-SB (250 mm × 4.6 mm, 5 μm); column temperature: 30°C; flow rate: 1.5 mL / min; injection volume: 10 μL; detector: UV detector; wavelength: 203 nm.
[0096] The yield of PS is calculated as follows:
[0097]
[0098] The results of the hydrolytic enzyme activity and transacyl activity of PLD expressed by the above mutant strains are attached. Figure 5 As shown in Figure 1 and Table 4.
[0099] Table 4. Hydrolytic enzyme activity and transacylation activity of PLD expressed by the original strain and mutant strain.
[0100] Mutation site Cell growth error Protein concentration error Hydrolytic activity error PS yield error <![CDATA[OD 600 ]]> mg / mL U / mL % PLD 6.09 0.04 0.86 0.04 26.29 0.02 27.46 0.72 D175A 8.32 0.36 0.94 0.04 3.24 0.02 0.00 0.00 S451A 7.67 0.21 0.76 0.03 4.42 0.24 4.50 0.87 T194A 7.00 0.33 0.72 0.04 3.37 0.04 53.52 1.93 S457A 6.31 0.05 0.87 0.04 3.99 0.10 0.00 0.00 D175L 5.95 0.14 1.17 0.05 3.33 0.01 0.00 0.00 S451L 6.12 0.16 1.15 0.05 4.11 0.50 0.00 0.00 T194L 7.17 0.38 0.72 0.04 3.47 0.02 49.23 1.54 S457L 8.08 0.14 1.21 0.06 3.31 0.03 0.00 0.00
[0101] After single-point mutation, compared with the original strain (WT), the hydrolytic activity of phospholipase D was significantly reduced after the amino acids at four sites (D175, S451, T194, and S457) were mutated to A and L. This result is consistent with the original intention of the mutation, which is to mutate the binding site amino acid to a hydrophobic amino acid to inhibit the hydrolytic activity of PLD. Among them, S457A, D175A, S451A and S457L, D175L, and S451L had almost no transacylation activity and could not convert PC to PS. However, after the threonine (T) at position 194 was mutated to A and L, the PS yield was significantly improved. Under the same reaction conditions, the PS yield increased from 27.46% to 53.52% and 49.23%, respectively.
[0102] Example 4. Single-point mutation of the T194 site in PLD.
[0103] Based on the conclusions of Example 3, among the eight mutant PLDs at sites D175, S451, T194, and S457, T194A and T194L exhibited significantly enhanced PS synthesis activity. Therefore, it is considered to further mutate the threonine at position 194 into other hydrophobic amino acids, including isoleucine (I), valine (V), phenylalanine (F), cysteine (C), methionine (M), and proline (P). The specific mutation primers are shown in Table 4.
[0104] The upstream and downstream mutation primers for T194I are SEQ ID NO.18 and SEQ ID NO.19, the upstream and downstream mutation primers for T194V are SEQ ID NO.20 and SEQ ID NO.21, the upstream and downstream mutation primers for T194M are SEQ ID NO.22 and SEQ ID NO.23, the upstream and downstream mutation primers for T194F are SEQ ID NO.24 and SEQ ID NO.25, the upstream and downstream mutation primers for T194C are SEQ ID NO.26 and SEQ ID NO.27, and the upstream and downstream mutation primers for T194P are SEQ ID NO.28 and SEQ ID NO.29.
[0105] Table 5 Primers used for single-point mutation PCR of T194
[0106] mutation site 5'→3' primer 3'→5' primer T194I gaaagatgattatctggatattgcgcatccggtgagtgatg catcactcaccggatgcgcaatatccagataatcatctttc T194V gaaagatgattatctggatgtggcgcatccggtgagtgatg catcactcaccggatgcgccacatccagataatcatctttc T194M gatgattatctggatatggcgcatccggtgagtg cactcaccggatgcgccatatccagataatcatc T194F gaaagatgattatctggattttgcgcatccggtgagtgatg catcactcaccggatgcgcaaaatccagataatcatctttc T194C gatgattatctggattgcgcgcatccggtgag ctcaccggatgcgcgcaatccagataatcatc T194P gatgattatctggatccggcgcatccggtgagtg cactcaccggatgcgccggatccagataatcatc
[0107] Specifically, the mutant strains were constructed, expression was verified, and the activity of hydrolytic enzymes and PS products were detected according to the methods in Examples 1, 2 and 3.
[0108] The expression of PLD in the mutant strain constructed after a single-point mutation at the T194 site is detailed in the attached figure. Figure 6 As shown in Figure 6 and Table 6.
[0109] Table 6. PLD expression in mutant strains with single-point mutation at T194.
[0110] Mutation site Cell growth error Protein concentration error Hydrolytic activity error PS yield error <![CDATA[OD 600 ]]> mg / mL U / mL % PLD 6.09 0.04 0.86 0.04 26.29 0.02 27.46 0.72 T194I 7.09 0.03 0.85 0.04 3.59 0.15 58.32 3.08 T194V 8.21 0.09 0.95 0.04 4.27 0.14 48.14 3.62 T194M 8.66 0.07 0.71 0.03 3.69 0.13 43.23 3.04 T194F 8.19 0.03 0.70 0.04 3.04 0.06 48.91 3.71 T194C 7.14 0.07 0.95 0.04 4.55 0.13 56.21 2.67 T194P 8.84 0.06 0.99 0.05 4.59 0.11 50.60 2.60
[0111] From the appendix Figure 6 As shown in Table 6, mutating the T at position 194 into different hydrophobic amino acids significantly reduced the activity of all hydrolytic enzymes. (From the appendix...) Figure 7 As can be seen, the conversion rate of PS by PLD was improved to varying degrees. Among them, the PS yield of mutant strain T194I phospholipase D was the highest, reaching 58.32%, which was 112% higher than that of the original strain phospholipase D under the same reaction conditions.
[0112] The size of the channel for substrate molecules to enter the enzyme active site before and after mutation was calculated using the Caver software. It was found that the acyl entrance radius of 194I is 1.46 Å, which is larger than the radius of 1.00 Å of 194W. This means that the amino acid at the binding site between the substrate and the enzyme molecule near the active site is mutated to an amino acid with less steric hindrance in order to increase the binding pocket and thus facilitate the interaction between the enzyme and the substrate.
[0113] The above descriptions are merely embodiments of the present invention, and common knowledge such as specific technical solutions and / or characteristics are not described in detail here. It should be noted that those skilled in the art can make various modifications and improvements without departing from the technical solutions of the present invention, and those skilled in the art can understand the specific meaning of the above terms in the present invention according to the specific circumstances. The scope of protection claimed in this application shall be determined by the content of its claims, and the specific embodiments described in the specification can be used to interpret the content of the claims.
Claims
1. A mutant protein of phospholipase D, wherein a point mutation is made to the amino acid sequence of phospholipase D, and the amino acid sequence of the phospholipase D is the sequence shown in SEQ ID NO.
1. The point mutation is T194A, T194L, T194V, T194M, T194F, T194C or T194P. 2.A recombinant bacterium expressing the mutant protein of claim 1. 3.The recombinant bacterium of claim 2, wherein the base strain of the recombinant bacterium comprises E. coli.
4. The method for constructing a recombinant bacterium according to claim 2 or 3, wherein the nucleic acid is introduced into the host bacterium by electroporation. The method comprises the following steps: (1) Culturing wild-type E. coli TOP10 / pBADKP-PLD2, wherein the vector is plasmid pBADKP and the host cell is E. coli TOP10; (2) Extracting plasmid pBADKP containing the gene encoding the amino acid sequence shown in SEQ ID NO. 1 from the strain E. coli TOP10 / pBADKP-PLD2 using Plasmid Mini Kit I kit, and using the plasmid pBADKP as a template for mutation PCR; (3) Performing PCR amplification on the plasmid using site-directed mutation primers to obtain an amplification product; (4) Digesting the non-mutated template DNA of the amplification product using Dpn I enzyme to obtain a digestion product; (5) Introducing the digestion product into E. coli top10 competent cells using heat shock, and performing single colony screening on LB solid medium containing kanamycin to obtain the recombinant bacterium.
5. The construction method according to claim 4, characterized in that, The site-directed mutation primers of step (3) comprise: For the T194A point mutation, the mutation primers T194A-F and D194A-R, wherein the nucleotide sequence of T194A-F is shown in SEQ ID NO. 10, and the nucleotide sequence of T194A-R is shown in SEQ ID NO. 11; For the T194L point mutation, the mutation primers T194L-F and D194L-R, wherein the nucleotide sequence of T194L-F is shown in SEQ ID NO. 12, and the nucleotide sequence of T194L-R is shown in SEQ ID NO. 13; For the T194V point mutation, the mutation primers T194V-F and D194V-R, wherein the nucleotide sequence of T194V-F is shown in SEQ ID NO. 20, and the nucleotide sequence of T194V-R is shown in SEQ ID NO. 21; For the T194M point mutation, the mutation primers T194M-F and D194M-R, wherein the nucleotide sequence of T194M-F is shown in SEQ ID NO. 22, and the nucleotide sequence of T194M-R is shown in SEQ ID NO. 23; For the T194F point mutation, the mutation primers T194F-F and D194F-R, wherein the nucleotide sequence of T194F-F is shown in SEQ ID NO. 24, and the nucleotide sequence of T194F-R is shown in SEQ ID NO. 25; The nucleotide sequence of the mutant primer T194C-F is shown in SEQ ID NO. 26, and the nucleotide sequence of the mutant primer D194C-R is shown in SEQ ID NO.
27. The nucleotide sequence of the mutant primer T194P-F is shown in SEQ ID NO. 28, and the nucleotide sequence of the mutant primer D194P-R is shown in SEQ ID NO.
29.
6. The method of construction of claim 4, wherein: The PCR amplification procedure of step (3) comprises: 98°C pre-denaturation for 5 min; 98°C denaturation for 10 s, 55-65°C annealing for 30 s, 72°C extension for 2 min, extension for 1 min / kb, 30 cycles; 72°C extension for 10 min; 4°C keeping.
7. The method of construction of claim 4, wherein: The recombinant bacteria in step (5) are mixed with 40% glycerol at a ratio of 1:1 and stored at -80°C.
8. The construction method of claim 4, wherein: The LB culture in step (1) is based on 37°C, 200 rpm for 12 h.
9. A method for preparing phospholipase D using the recombinant bacteria according to claim 2 or 3, wherein the method comprises the steps of: culturing the recombinant bacteria in a culture medium; and recovering the phospholipase D from the culture medium. After the recombinant bacteria are recovered with LB medium, they are transferred to TB medium for 5-6 h, then transferred to TB adjusted medium, and an inducer is added to induce the expression of phospholipase D.
10. The method of claim 9, wherein: The inducers include: arabinose, DTT, ethanol, butanol and antibiotics, the concentration of arabinose is 0.035%·OD 600 -1 After adding the inducers to the TB adjustment medium, the expression is induced at 18°C, 200 rpm, for 16 h.
Citation Information
Patent Citations
Method for producing phospholipase D through recombinant escherichia coli
CN109136207A
A method for producing phospholipase D from recombinant Escherichia coli
CN109136207B
Reasonable directed evolution method for improving PS synthesis activity of phospholipase D
CN116103264A