Application of PpERF98 gene in regulating resistance to peach gummosis

Abstract

This invention relates to PpERF98 The application of genes in regulating resistance to peach gummosis: This invention utilizes genetic engineering techniques to... PpERF98 A specific target fragment was obtained from the open reading frame sequence of a gene, and primers for amplification of the target fragment were designed. The target fragment was fused with the virus-mediated gene silencing (VIGS) vector pCaRNA3 via enzyme digestion to successfully construct the VIGS vector. The VIGS vector was then transformed into peach plants using Agrobacterium-mediated transformation, reducing the... PpERF98 The expression of the gene was used to obtain plant materials resistant to gummosis; the full-length open reading frame primers were SEQ ID NO: 1 and SEQ ID NO: 2. This invention improves the resistance of peach trees to gummosis pathogens through transgenic methods, significantly reduces the incidence of gummosis, and reduces the economic losses caused by peach gummosis.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of peach gummosis prevention and treatment methods, and particularly relates to application of PpERF98 gene in regulating peach gummosis resistance. BACKGROUND

[0002] Peach gummosis is an accumulative branch and stem disease, which is common in the Yangtze River Basin and the areas south of it, and is one of the most serious diseases in peach production in China. The disease causes tissue necrosis in the main stem, main branches and other parts of the peach tree, weakens the tree, reduces fruit yield and quality, shortens the life of the peach tree, and seriously affects the economic benefits. The pathogenic bacteria causing peach gummosis mostly belong to the family of grape coelomycetes, which is a semi-vital fungus that can invade the peach tree wood, which makes it difficult to prevent and treat peach gummosis. At present, no resistant material against peach gummosis has been found. Therefore, analyzing the resistance genes of peach trees is an urgent problem in peach production, and the research results will provide an important theoretical basis for the prevention and treatment of gummosis and the creation of gummosis-resistant materials. SUMMARY

[0003] The purpose of the present application is to overcome the problem that there is no effective prevention and treatment method and peach resources resistant to gummosis, and to provide application of PpERF98 gene in regulating peach gummosis resistance.

[0004] The technical solution of the present application to solve the above technical problems is as follows:

[0005] The application of PpERF98 gene in regulating peach gummosis resistance is characterized in that the sequence of the PpERF98 gene is SEQ ID NO: 5.

[0006] The application of the above PpERF98 gene in regulating peach gummosis resistance is to improve the gummosis resistance of peach by silencing the peach PpERF98 gene through genetic engineering method.

[0007] The specific application method is to select a target fragment from the full-length sequence of PpERF98 gene, design a primer pair VIGS-PpERF98 for amplification of the target fragment, and connect the target fragment with the virus-mediated silencing vector pCaRNA3 through enzyme digestion method to construct a VIGS vector, and introduce the VIGS vector into peach plants to improve the resistance of peach to gummosis; the sequence of the target fragment is SEQ ID NO: 6.

[0008] Further, the primer pair VIGS-PpERF98 of the target fragment has the sequences of SEQ ID NO: 3 and SEQ ID NO: 4.

[0009] The application has the beneficial effects that the application finds that the PpERF98 gene is related to the resistance to peach gummosis, the resistance to gummosis can be improved by silencing the PpERF98 gene of the peach through genetic engineering means, the incidence of gummosis can be significantly reduced, and the economic loss caused by the peach gummosis can be reduced. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 It is an electrophoretogram of the full length of the PpERF98 gene;

[0011] Figure 2 It is a schematic diagram of the alignment analysis of the ERF98 amino acid sequences in different species;

[0012] Figure 3 It is a schematic diagram of the disease symptoms and lesion area of different peach varieties inoculated with peach gummosis bacteria;

[0013] Figure 4 It is a schematic diagram of the relative expression amount of the PpERF98 gene in different peach varieties inoculated with peach gummosis bacteria;

[0014] Figure 5 It is a schematic diagram of the silencing efficiency of the PpERF98 gene in the peach plants;

[0015] Figure 6 It is a schematic diagram of the disease symptoms and lesion area of the peach plants with the silenced PpERF98 gene inoculated with peach gummosis bacteria;

[0016] Figure 7 It is a schematic diagram of the relative expression amount of the disease-related genes in the peach plants with the silenced PpERF98 gene inoculated with peach gummosis;

[0017] Figure 8 It is a schematic diagram of the efficiency of the peach plants with the overexpressed PpERF98 gene;

[0018] Figure 9 It is a schematic diagram of the disease symptoms and lesion area of the peach plants with the overexpressed PpERF98 gene inoculated with peach gummosis bacteria;

[0019] Figure 10 It is a schematic diagram of the relative expression amount of the disease-related genes in the peach plants with the overexpressed PpERF98 gene inoculated with peach gummosis;

[0020] Figure 11 It is a schematic diagram of the relative expression amount of the PpERF98 gene in the transgenic tomato plants;

[0021] Figure 12 It is a schematic diagram of the disease symptoms of the transgenic tomato plants and the control plants inoculated with peach gummosis bacteria;

[0022] Figure 13The relative expression amount of disease-related genes of transgenic tomato plants and control plants after inoculation with Lasiodiplodia theobromae is shown in the schematic diagram.

[0023] Figure 14 The salicylic acid content of PpERF98 silenced plants and overexpression plants is shown in the schematic diagram. DETAILED DESCRIPTION

[0024] The principles and features of the present application are described below, and the examples are only used to explain the present application and are not intended to limit the scope of the present application.

[0025] We screened a transcription factor PpERF98 responding to Lasiodiplodia theobromae strain through transcriptome data, and found that the expression level of PpERF98 in different sensitive peach varieties was positively correlated with the sensitivity of peach to Lasiodiplodia theobromae. Based on transgenic technology, we found that the resistance of transgenic plants to peach Lasiodiplodia theobromae was reduced by heterologous overexpression of the gene in common tomato A57. At present, there is no stable transgenic genetic system for peach, and the present application uses VIGS technology to silence the target gene in peach seedlings through an Agrobacterium-mediated infection system, and finds that the resistance of peach plants to Lasiodiplodia theobromae is enhanced by silencing PpERF98.

[0026] The main experimental process is as follows:

[0027] 1. Full-length cloning of PpERF98 gene

[0028] Based on the transcriptome data obtained in the early stage, an ERF family transcription factor responding to peach Lasiodiplodia theobromae was screened, which was numbered as Prupe.8G224700. The amino acid sequence was analyzed by NCBI database BlastP comparison and analysis, and it was found that the homology with Arabidopsis thaliana ERF98 was the highest (67.74%), so it was named as PpERF98.

[0029] The total RNA was extracted from the phloem tissue of the current year branches of peach inoculated with Lasiodiplodia theobromae using EASY spin Plus plant RNA rapid extraction kit (Aidlab, Beijing), and the RNA concentration and quality were detected by Nanodrop one (Thermo, USA). The reverse transcription kit The qualified RNA samples were reversely transcribed to obtain cDNA by using RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China), and finally the open reading frame fragments were amplified by using Phanta Max Super-Fidelity DNA Polymerase (Vazyme, Nanjing). The full-length amplification primers SEQ ID NO: 1 and SEQ ID NO: 2 were designed according to the sequence information obtained on NCBI by using Primer 5.0 software, and the primer sequences were as follows:

[0030] PpERF98-Full length-F: 5’-ATGCACTATATATCTTGCATGTCACAA-3’

[0031] PpERF98-Full-length-R: 5’-CTAATGGGTTGGTTTCCCCTGTCTA-3’

[0032] The obtained product was recovered by using DNA gel recovery kit (Sangon Biotech, Shanghai), and the positive clone was obtained by using pEASY-Blunt Zero Cloning Kit (Transgene, Beijing) to connect the vector, then the sequence was obtained by sending to TSINGKE company (TSINGKE, Wuhan) for sequencing, and the full-length sequence SEQ ID NO: 5 of PpERF98 was as follows:

[0033] ATGCACTATATATCTTGCATGTCACAAGCACAACCCATATTTTTGCCACCAAATTTGAATAAAGACCTGTTTCTGCTTAACATGGAAGGGAAGGGAGTGGAGAACCAGCAGAAGGAGCAGACTAAGGTAAGAGATCAAACCCGGTATCGAGGGATTCGGAGGCGACCGTGGGGCAAGTTTGCTGCTGAAATACGTGACCCTTCAAGAAATGGGGCACGCCTATGGCTAGGCACATTTGAGACAGCTGAAGAGGCAGCTAGGGCTTATGATCGAGCTGCTTTCGGCTTCCGGGGTCATTTGGCCATCCTCAACTTCCCTAATGACTACCAGTATCATAACCCATCAAGCTCTTTGATCAGCACTTCATCCTCTTCATCATCATCTCCATTTTCTGCTGCTGATATTGGAAAGAGTACTAATTTTGGCAGAGGCCAAGAAGAAGAAGAAGTTATAGAGTTTGAGTACCTGGACAACATGGTTTTGGAGGAGCTTCTTGACACAAAAGAGGATCATCATAGACAGGGGAAACCAACCCATTAG

[0034] The full length of the sequence is 540 bp, and the electrophoresis photograph is shown in Figure 1 Using MEGA7, the protein sequence of PpERF98 was subjected to multiple sequence alignment with ERF98 protein sequences of Arabidopsis, Prunus mume, Prunus armeniaca, Malus domestica and Citrus species. It was found that the AP2 domain of ERF family characteristics was contained in the N terminal, and the acidic activation domain (EDLL) was contained in the C terminal. Figure 2

[0035] 2. Analysis of the relative expression amount of PpERF98

[0036] The method of inoculating peach branches was referred to Gao Lei (2016). The disease symptoms of branches were observed at 1, 2 and 3 d after inoculation; the phloem tissue of 0.5-1 cm around the lesion was taken at 0, 6, 12, 24, 48 and 72 h, and was placed in -80℃ for freezing. The total RNA of plants was extracted using EASY spin Plus plant RNA rapid extraction kit (Aidlab, Beijing), and the RNA concentration and quality were detected using Nanodrop one (Thermo, USA); the cDNA synthesis used reverse transcription kit ​RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). qRT-PCR was performed using a Hieff™ qPCR SYBR & Green Master Mix (Low Rox Plus) (YEASEN, Shanghai) and a QuantStudio 6 (ABI, USA). Quantitative primers for candidate genes were designed using Primer5 software. The housekeeping gene PpTEF2 (Translation enlongation factor 2) (Tong et al. 2009) was used as the peach internal control gene, and the calculation method followed Livak and Schmittgen (2001). Sequence-specific primers are as follows:

[0037] PpERF98 fluorescence quantitative primer sequence:

[0038] PpERF98-F: 5'--TGATCAGCACTTCATCCTCTTCA--3'

[0039] PpERF98-R: 5'--CTCCTCCAAAACCATGTTGTCC--3'

[0040] Primer sequences for the peach internal reference gene PpTEF2 (Tong et al 2009):

[0041] PpTEF2-F:5'--AGCAAGTCACCCAACAAGCATA--3'

[0042] PpTEF2-R:5'--CCAACCAAACTCTTCAGCCAAT--3'

[0043] The current-year branches of peach 'Chunxue' and 'Dahongpao' varieties were inoculated in vitro with the peach gummosis pathogen L. theobromae. The results showed a significant difference in susceptibility to the pathogen between 'Chunxue' and 'Dahongpao', specifically, the lesions on 'Chunxue' were significantly larger than those on 'Dahongpao', confirming that 'Chunxue' was more susceptible than 'Dahongpao'. Figure 3 Analysis of the relative expression levels of PpERF98 in branches of two peach varieties after inoculation with gummosis pathogens revealed a positive correlation between PpERF98 and the susceptibility of peach varieties to gummosis pathogens. Figure 4 ).

[0044] 3. VIGS-mediated silencing of the PpERF98 gene in peach seedlings

[0045] A 100bp specific target fragment was selected from the full-length sequence of PpERF98. The sequence of the target fragment is SEQ ID NO: 6.

[0046] AAGAAGAAGAAGAAGTTATAGAGTTTGAGTACCTGGACAACATGGTTTTGGAGGAGCTTCTTGACACAAAAGAGGATCATCATAGACAGGGGAAACCAAC

[0047] The specific primer was designed to amplify the target fragment of VIGS-PpERF98, and the FastDigest Xbal fast enzyme of Thermo Company and T4 DNA Ligase of TaKaRa Company were used to connect it with the virus vector pCaRNA3, and the VIGS recombinant vector PNRSV-PpERF98 was obtained. The primer sequence for amplifying VIGS-PpERF98 fragment is SEQ ID NO: 3 and SEQ ID NO: 4:

[0048] VIGS-PpERF98-F: 5'-GCTCTAGACAAGAAGAAGAAGAAG-3'

[0049] VIGS-PpERF98-R: 5'-GCTCTAGAGTTGGTTTCCCCTGTCTAT-3'

[0050] The method of Cui and Wang (2017) was used for VIGS transient transformation of peach seedlings. PNRSV-PpERF98 and pCaRNA1&2 were respectively introduced into Agrobacterium GV3101 competent cells, and after positive detection, the Agrobacterium liquid carrying PNRSV-PpERF98 and pCaRNA1&2 was cultured overnight, and then resuspended with resuspension liquid MMA (10 mmol / L MES, 10 mmol / L MgCl2, 200 μmol / L acetyl-syringone, pH = 5.6-5.7) to OD about 1.0, and then mixed according to the volume ratio of 1:1, and then the bacterial liquid was injected into the leaf of 6-8 leaf stage of peach seedlings, and the seedlings were cultured in the dark for 2 days. pCaRNA3 and pCaRNA1&2 were used as negative control, and PNRSV-PpPDS and pCaRNA1&2 were used as positive control. After 4 weeks, the qRT-PCR analysis was carried out on the functional leaves of the silenced peach seedlings which were not injected, and the results showed that this method could effectively silence the expression level of PpERF98 gene in peach seedlings. Figure 5 ).

[0051] 4. Resistance identification of silenced peach plants to L. theobromae strain

[0052] Leaf inoculation of P. theobromae was performed on detached leaves of silenced PpERF98 peach plants and control plants according to the method of Zhao Lina (2012). The disease symptoms were observed at 1 and 2 d after inoculation. The results showed that the disease spot area of the silenced PpERF98 peach plants was significantly smaller than that of the control plants, and the resistance to P. theobromae was significantly enhanced. Figure 6 ).

[0053] 5. qRT-PCR analysis of disease-related genes in silenced P. persica plants

[0054] The tissues 5 mm around the inoculation points of the silenced P. persica plants and the control plants were taken at 1 and 2 d after the above inoculation, and the relative expression of the disease-related genes was analyzed. The results showed that the expression of the salicylic acid-dependent disease-related genes PpPR1 and PpPR2 in the leaves of the silenced P. persica plants was significantly up-regulated Figure 7 ). PpERF98 in the silenced peach seedlings may enhance the resistance of the silenced P. persica plants to P. theobromae by increasing the expression of the PpPR1 and PpPR2 disease-related protein genes.

[0055] Primers of peach disease-related protein genes:

[0056] PpPR1-F: 5'-TGACAAGGTGTGTGGGCATT-3'

[0057] PpPR1-R: 5'-CGGATCATAGTTGCACCCGA-3'

[0058] PpPR2-F: 5'-ACAGGAGGACCATTGGCTTG-3'

[0059] PpPR2-R: 5'-ACGGCCATGGTATGAAGCTC-3'

[0060] 6. Construction of overexpression vector

[0061] The target fragment was given adapters by two rounds of PCR reactions using the Gateway vector homologous recombination technology and Phanta Max Super-Fidelity DNA Polymerase (Vazyme, Nanjing). The template for the first round of PCR was a plasmid containing the target gene, and the primer sequences were:

[0062] attB-PpERF98-F:

[0063] 5'-AAAAAGCAGGCTCCATGCACTATATATCTTGCATGTCACAAG-3'

[0064] attB-PpERF98-R:

[0065] 5' - AGAAAGCTGGGTTCTAATGGGTTGGTTTCCCCTGTCTA - 3'

[0066] Template of the previous round of PCR, primer sequence:

[0067] attB-F: 5' - GGGGACAAGTTTGTACAAAAAAGCAGGCT - 3'

[0068] attB-R: 5' - GGGGACCACTTTGTACAAGAAAGCTGGGT - 3'

[0069] Then, the BP reaction and the LP reaction were performed using the Gateway kit of Thermo to connect the PpERF98 full-length fragment to the entry vector pDONR207 and the overexpression vector pK7WG2D, respectively, to complete the construction of the overexpression vector pK7WG2D-PpERF98.

[0070] The overexpression vector pK7WG2D-PpERF98 was transformed into E. coli DH5a by heat shock, and then sequenced after PCR positive detection by 2x Es Taq MasterMix(Dye) of Kangweishijie Company. The plasmid was extracted by EASY pure Plasmid MiniPrep Kit of QiaGen Company, and finally transformed into Agrobacterium GV3101 (WEIDI, Shanghai) by heat shock.

[0071] 7. Peach seedlings transiently overexpressing PpERF98 and inoculation treatment

[0072] Peach seedlings with 8-10 fully expanded leaves were selected for Agrobacterium injection. 1 mL syringe was used to inject Agrobacterium containing pK7WG2D and pK7WG2D-PpERF98 into the peach leaves from the back of the leaves, respectively. Each peach seedling was injected with 4-5 fully expanded functional leaves and marked. After injection, the seedlings were placed in darkness at 22°C for 2 days, and then inoculation treatment was performed. The disease symptoms were observed after 1 and 2 days of inoculation. The results showed that Agrobacterium-mediated transient overexpression could significantly increase the transcription level of PpERF98 in peach leaves ( Figure 8 ), the disease spot diameter of the overexpression peach plants was significantly larger than that of the control ( Figure 9 ), and the resistance to the strain of P. prunicola was significantly weakened ( Figure 10 ), and the expression of PpPR1 and PpPR2 was significantly down-regulated.

[0073] 8. Genetic transformation of tomato and positive screening of T2 generation plants

[0074] Following the method of Ouyang et al. (2003), Agrobacterium-mediated genetic transformation of tomato cotyledons was performed. The relative phenotypic ratios of the T0 generation plants were analyzed by qRT-PCR, and the results are as follows: Figure 11 Transgenic lines with the highest relative expression of PpERF98 were selected for further screening to obtain T2 generation seeds. Nine days after sowing T2 generation seeds, kanamycin was sprayed on the leaves twice daily for four consecutive days. Non-positive plants with yellowing and deformed leaves were removed. DNA was extracted from individual plants using the Adley EASYspin Plusplant DNA Kit and PCR was performed with vector primers. The results showed that positive plants exhibited the target band of the expected size.

[0075] Positive detection primer sequences for the overexpression vector pK7WG2D:

[0076] pK7WG2D-F: 5'--TTTCATTTGGAGAGGACTCC--3'

[0077] pK7WG2D-R:5'--TAACGTGACTCCCTTAATTC--3'

[0078] 9. Identification of resistance of T2 generation transgenic and wild-type tomatoes to L. theobromae, the pathogen causing peach gummosis.

[0079] Using detached leaves from the second compound leaves of T2 generation transgenic tomatoes and wild tomato control lines, the abaxial surface of the leaves was inoculated with the peach gummosis pathogen *L. theobromae*. Symptoms were observed 3 and 5 days after inoculation. The results showed that the T2 generation transgenic lines OX#1 and OX#2 exhibited significantly reduced resistance to *L. theobromae*, with more infection spots appearing on the abaxial surface of their leaves and an increased lesion area. Figure 12 ).

[0080] 10. qRT-PCR analysis of disease-related protein genes in transgenic tomatoes

[0081] At 24 and 48 hours post-inoculation, tissue samples (5 mm around the inoculation site) were collected from leaves of T2 generation transgenic tomatoes and control plants and frozen in liquid nitrogen at -80℃ for qRT-PCR analysis of disease-related protein genes. The results showed that after inoculation with peach gummosis pathogen, the expression of salicylic acid-dependent disease-related genes SlPR1, SlPR2, SlPR5, and SlPRNP24 in T2 generation transgenic tomato leaves was inhibited. Figure 13 PpERF98 may weaken the resistance of T2 generation transgenic tomato lines to peach gummosis by inhibiting the expression of these disease-related protein genes.

[0082] Primer sequences for tomato pathogenesis protein-related genes:

[0083] SlPR1-F: 5'-GATGTGGGACGATGAGAAGCAATG-3'

[0084] SlPR1-R: 5'-GTTGCATCGAACCCTAGCACAACCT-3'

[0085] SlPR2-F: 5'-CAGATTTCACTTCCGTATGCTCTT-3'

[0086] SlPR2-R: 5'-CCATCCACTCTCTGACACAACAAT-3'

[0087] SlPRNP24-F: 5'-GAGGGGAACTAAGATGGCACGTAT-3'

[0088] SlPRNP24-R: 5'-CTCCACCACAATCACCAGTCTGAC-3'

[0089] SlPR5-F: 5'-AACTGCCCCTACACCGTTTG-3'

[0090] SlPR5-R: 5'-GCCCAAAACCACCAACTCTG-3'

[0091] Tomato internal reference primer sequence:

[0092] SlActin-F: 5'-ATGGCAGACGGAGAGGATATTCA-3'

[0093] SlActin-R: 5'-GCCTTTGCAATCCACATCTGCTG-3'

[0094] 11. PpERF98 overexpression or silencing affects the accumulation of salicylic acid in plants

[0095] After silencing PpERF98 in peach seedlings, the content of salicylic acid was significantly increased, while after overexpression, the content of salicylic acid was significantly lower than that of the control group, which indicated that PpERF98 might affect the resistance of peach to P. prunicola by regulating the plant salicylic acid pathway. Figure 14 ).

[0096] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. The use of silencing the peach PpERF98 gene in improving the resistance of peach to peach gummosis, characterized in that, The sequence of the PpERF98 gene is SEQ ID NO:

5.

2. Use according to claim 1, characterized in that, The specific application method is to select a target fragment from the full-length sequence of the PpERF98 gene, design primers of the target fragment for amplification, connect the target fragment with a virus-mediated silencing vector pCaRNA3 through enzyme digestion, construct a VIGS vector, and introduce the VIGS vector into a peach plant to improve the resistance of the peach to flow gum disease; the sequence of the target fragment is SEQ ID NO: 6, and the primer sequences of the target fragment are SEQ ID NO: 3 and SEQ ID NO: 4.

Images