Gene sequencing synthesis reaction reagent, sequencing method

Abstract

The present invention discloses a gene sequencing synthesis reaction reagent and a sequencing method. The synthesis reaction reagent contains ferulic acid, ethyl gallate and glycerol. In the present invention, ferulic acid, ethyl gallate and glycerol with a certain concentration are added to the conventional gene sequencing synthesis reaction reagent. The optimized synthesis reaction reagent can prevent the problems of reagent discoloration and precipitation, improve the stability of the product, enable the reagent to remain unchanged in color during long-term storage, and extend the shelf life of the product. At the same time, the synthesis reaction reagent can protect DNA on the basis of canceling the photographing reagent and reducing the types of reagents, and avoid the damage of laser to DNA. When the synthesis reaction reagent is used in the polymerization reaction of gene sequencing, the polymerization reaction and the signal acquisition step can be carried out simultaneously, effectively slowing down the quenching of the fluorescence signal in sequencing while ensuring the shortening of the sequencing cycle time, and improving the overall sequencing quality.

Description

Technical Field

[0001] The present invention belongs to the field of gene sequencing, and particularly relates to an optimized reagent for second-generation gene sequencing synthesis reaction and a sequencing method. Background Art

[0002] There are two representative techniques in current second-generation sequencing (sequencing by synthesis, SBS), namely the bridge amplification technique of Illumina and the DNBSEQ technique of BGI. The common feature of the two techniques is to identify and distinguish the four different bases (A, C, G, and T / U) in a DNA sequence by detecting fluorescence signals. Both techniques use dNTPs (dATP, dCTP, dGTP, dTTP) with four different fluorescent labels, and these four dNTPs carry the same blocking group. Based on the second-generation sequencing technology, the current sequencing method mainly includes three steps: 1. Polymerization reaction: Under the action of polymerase, dNTPs with fluorescent labels and blocking groups are added to the 3'-end of the sequencing synthesis strand; 2. Signal acquisition: It occurs after the polymerization reaction. The optical system in the sequencer will take pictures and collect the fluorescence signals through a laser; 3. Cleavage reaction: After the signal acquisition is completed, the fluorescent group and the blocking group contained in the dNTPs are removed by pumping in the cleavage reagent, so that the dNTPs can enter the next sequencing cycle in a natural state.

[0003] In recent years, the second-generation sequencing technology has developed rapidly, but there are still various limitations at present, such as the properties of related reagents, the optical acquisition system of the sequencer, etc. These limitations lead to the current second-generation sequencing method can only be carried out sequentially according to the above steps. If the polymerization reaction and the signal acquisition steps in sequencing are carried out synchronously, not only can the time of the sequencing cycle be shortened, but also the types of reagents in the sequencing kit can be reduced, and the sequencing cost can be lowered. However, during the signal acquisition process, due to the lack of protection of the imaging buffer, the fluorescence signal quenches very quickly, and the overall sequencing quality also drops significantly.

[0004] The R & D team of the present invention optimized a sequencing synthesis reagent in the previous work, realizing the simultaneous progress of the polymerization reaction and the signal acquisition, effectively shortening the reaction time in the sequencing process. This reagent can effectively slow down the quenching of the fluorescence signal generated when the synthesis and the signal acquisition are carried out simultaneously, protect the DNA strand from laser damage, and improve the overall sequencing quality. However, in the subsequent experimental process, it was found that this reagent had problems of color change and precipitation during long-term storage, could not ensure the accurate expiration date of the reagent, and affected the sequencing quality. Summary of the Invention

[0005] Based on this, the present invention provides a synthetic reaction reagent, which can solve the problems of discoloration and precipitation, improve the stability of the product, extend the shelf life of the product, and at the same time protect the DNA strand from laser damage, slow down the quenching of the fluorescence signal generated when synthesis and signal acquisition are carried out simultaneously, and improve the overall sequencing quality.

[0006] The present invention includes the following technical solutions.

[0007] A synthetic reaction reagent, wherein the synthetic reaction reagent contains ferulic acid, ethyl gallate and glycerol.

[0008] In some embodiments, the concentration of ferulic acid in the synthetic reaction reagent is 0.5 mM to 1.5 mM.

[0009] In some embodiments, the concentration of ethyl gallate in the synthetic reaction reagent is 1.5 mM to 2.5 mM.

[0010] In some embodiments, the mass concentration of glycerol in the synthetic reaction reagent is 0.5 to 5%.

[0011] In some embodiments, the concentration of ferulic acid in the synthetic reaction reagent is 0.8 mM to 1.2 mM, the concentration of ethyl gallate in the synthetic reaction reagent is 1.8 mM to 2.2 mM, and the mass concentration of glycerol in the synthetic reaction reagent is 1.8 to 2.2%.

[0012] In some embodiments, the synthetic reaction reagent further includes a buffer, a soluble salt, a polymerase and a nucleotide analogue.

[0013] In some embodiments, the buffer is selected from at least one of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffer, SSC (sodium citrate) buffer, Tricine (N-[Tris(hydroxymethyl)methyl]glycine) buffer and PBS (phosphate) buffer.

[0014] In some embodiments, the concentration of the buffer agent in the buffer is 0.1 mM to 1000 mM.

[0015] In some embodiments, the soluble salt is selected from at least one of ammonium salts, magnesium salts and sodium salts.

[0016] In some embodiments, the ammonium salt is ammonium sulfate and / or ammonium chloride.

[0017] In some embodiments, the magnesium salt is magnesium sulfate and / or magnesium chloride.

[0018] In some embodiments, the sodium salt is sodium chloride and / or EDTA (ethylenediaminetetraacetic acid).

[0019] In some of these embodiments, the final concentration of the ammonium salt in the synthesis reaction reagent is 1 mM to 50 mM.

[0020] In some of these embodiments, the ammonium salt is ammonium sulfate at 5 mM to 20 mM.

[0021] In some of these embodiments, the final concentration of the magnesium salt in the synthesis reaction reagent is 1 mM to 20 mM.

[0022] In some of these embodiments, the magnesium salt is magnesium sulfate at 1 mM to 5 mM.

[0023] In some of these embodiments, the sodium salts are sodium chloride and EDTA, the final concentration of the sodium chloride in the synthesis reaction reagent is 1 mM to 100 mM, and the final concentration of the EDTA in the synthesis reaction reagent is 0.1 mM to 10 mM.

[0024] In some of these embodiments, the nucleotide analog is a deoxynucleotide modified with a fluorescent group and / or a blocking group.

[0025] In some of these embodiments, the nucleotide analogs are dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group, and the final concentrations of dATP, dCTP, dGTP, and dTTP in the synthesis reaction reagent are each 0.1 μM to 10 μM.

[0026] In some of these embodiments, the polymerase is polymerase 9N or polymerase Slim.

[0027] In some of these embodiments, the final concentration of the polymerase in the synthesis reaction reagent is 0.001 mg / mL to 0.1 mg / mL.

[0028] In some of these embodiments, the synthesis reaction reagent consists of HEPES buffer, NaCl, (NH4)2SO4, MgSO4, EDTA, polymerase Slim, nucleotide analogs, ferulic acid, ethyl gallate, and glycerol;

[0029] The nucleotide analogs are dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group.

[0030] In some of these embodiments, the synthetic reaction reagent consists of components at the following concentrations: 45 - 55 mM HEPES buffer, 45 mM - 55 mM NaCl, 5 mM - 15 mM (NH4)2SO4, 2 mM - 4 mM MgSO4, 0.8 mM - 1.2 mM EDTA, 0.015 mg / mL - 0.025 mg / mL polymerase Slim, 1 μM - 1.2 μM each of dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group, 0.8 mM - 1.2 mM ferulic acid, 1.8 mM - 2.2 mM ethyl gallate, and 1.8 - 2.2% glycerol.

[0031] The present invention also provides a sequencing method, including the following technical solutions.

[0032] A sequencing method includes the following steps:

[0033] Polymerization reaction: The nucleic acid molecule to be tested reacts with the synthetic reaction reagent;

[0034] Signal acquisition: Exciting the fluorescent group to generate a fluorescent signal, and identifying the fluorescent signal to obtain the base type and position;

[0035] Cleavage reaction: Removing the blocking group and the fluorescent group;

[0036] Repeating the cycle of polymerization reaction - signal acquisition - cleavage reaction.

[0037] In some of these embodiments, signal acquisition starts immediately after 0 - 60 s from the start of the polymerization reaction.

[0038] In some of these embodiments, the temperature of the polymerization reaction is 45 - 70 °C.

[0039] In some of these embodiments, the reaction temperature for signal acquisition is 35 - 70 °C.

[0040] In some of these embodiments, the reaction temperature for the cleavage reaction is 45 - 80 °C.

[0041] The gene sequencing synthetic reaction reagent and the sequencing method of the present invention have the following beneficial effects:

[0042] In the present invention, ferulic acid, ethyl gallate and glycerol are added to the conventional gene sequencing synthesis reaction reagent at a certain concentration. The optimized synthesis reaction reagent can prevent the problems of reagent discoloration and precipitation, improve the stability of the product, enable the reagent to remain unchanged in color during long-term storage, and extend the shelf life of the product. At the same time, the synthesis reaction reagent can protect DNA on the basis of canceling the photographing reagent and reducing the type and dosage of reagents, and reduce the damage of laser to DNA. When the synthesis reaction reagent is used in the polymerization reaction of gene sequencing, the polymerization reaction and the signal acquisition step can be carried out simultaneously, effectively slowing down the quenching of fluorescence signals during sequencing while ensuring the shortening of the sequencing cycle time, and improving the overall sequencing quality.

[0043] In the sequencing method of the present invention, signal acquisition starts immediately after the polymerization reaction begins. Using the synthesis reaction reagent described in the present invention, signal acquisition and synthesis reaction can be carried out almost simultaneously. Signal acquisition can be started after nucleotide analogs are connected to the primer strands of some nucleic acid molecules, without waiting for all nucleic acid molecules to complete the synthesis of at least one nucleotide analog before signal acquisition, thus greatly shortening the sequencing time. At the same time, there is no need to separately add a signal acquisition reagent in the acquisition step, thereby reducing the sequencing cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is a graph showing the downward trend of signals obtained using a synthesis reagent containing 2 mM ethyl gallate, 1 mM ferulic acid and 2% glycerol.

[0045] Figure 2 It is a graph showing the change of four new synthesis reagents 1 added with different additives over storage time.

[0046] Figure 3 It is a Q30 curve of a synthesis reagent added with formulation combination ② 10 mM VC + 2 mM ethyl gallate over storage time.

[0047] Figure 4 It is a Q30 curve of a synthesis reagent added with formulation combination ③ 2 mM ethyl gallate + 1 mM ferulic acid over storage time.

[0048] Figure 5 It is a Q30 curve of a synthesis reagent added with formulation combination ④ 2 mM ethyl gallate + 1 mM ferulic acid + 2% glycerol over storage time. DETAILED DESCRIPTION OF THE INVENTION

[0049] The technical solution of the present invention will be further described below through specific examples. Those skilled in the art should understand that the examples are only for helping to understand the present invention and should not be regarded as specific limitations to the present invention.

[0050] Unless otherwise defined, all technical and scientific terms used in this invention have the same meanings as commonly understood by those skilled in the technical field to which this invention belongs. The terms used in the description of this invention are only for the purpose of describing specific embodiments and are not intended to limit this invention.

[0051] The terms "comprise" and "have" in this invention and any variations thereof are intended to cover non-exclusive inclusion. For example, a process, method, device, product or equipment that includes a series of steps is not limited to the listed steps or modules, but optionally further includes steps not listed, or optionally further includes other steps inherent to these processes, methods, products or equipment.

[0052] As used in this invention, "a plurality of" means two or more. "And / or" describes the relationship between associated objects and indicates that there can be three relationships. For example, A and / or B can mean: A exists alone, A and B exist simultaneously, or B exists alone. The character " / " generally indicates that the associated objects before and after are in an "or" relationship.

[0053] The formula of the currently commonly used sequencing-by-synthesis reaction reagent is as follows: 50 mM Tris-Hcl, 50 mM NaCl, 10 mM (NH4)2SO4, 0.02 mg / ml polymerase-9N (Salus-bio), 3 mM MgSO4, 1 mM EDTA, 1 μM each of dATP, dCTP, dGTP and dTTP with blocking groups and fluorescent groups. During the sequencing process, signals are excited and collected by laser. The energy generated by the laser will damage DNA, resulting in quenching of the fluorescent signal. In order to reduce this damage and thus achieve the purpose of protecting DNA, and in order to reduce the phenomenon of relatively fast signal quenching caused by simultaneous synthesis and signal collection, the R & D team of this application previously replaced Tris-Hcl with HEPES buffer and added 10 mM sodium L-ascorbate (VC), 2 mM gallic acid (GA) and 0.01 mM BSA to the reagent, hoping to improve the phenomenon of relatively fast signal quenching caused by simultaneous synthesis and signal collection, and the effect was significant. However, it was found in the subsequent experimental process that this reagent had problems of discoloration and precipitation during long-term storage, and the accurate shelf life of the reagent could not be guaranteed, thus affecting the sequencing quality.

[0054] Therefore, the technical problems to be solved by this invention are: further optimizing the reagent formula to avoid the problems of reagent discoloration and precipitation, improving the stability of the product, and extending the shelf life of the product; at the same time, protecting DNA from laser damage and improving the phenomenon of relatively fast signal quenching caused by simultaneous synthesis and signal collection while ensuring that the reagent does not discolor or precipitate, so as to improve the overall sequencing quality.

[0055] To solve the above problems, in one embodiment of the present invention, the present invention provides an optimized synthetic reaction reagent, which is obtained by adding ferulic acid, ethyl gallate and glycerol to a conventional synthetic reaction reagent. This synthetic reaction reagent can solve the problems of discoloration and precipitation, keep the reagent unchanged in color during long-term storage, improve the stability of the product, extend the shelf life of the product, and at the same time protect the DNA strand from laser damage, slow down the quenching of the fluorescence signal generated when synthesis and signal acquisition are carried out simultaneously, and improve the overall sequencing quality.

[0056] In some embodiments of the present invention, the concentration of ferulic acid in the synthetic reaction reagent is 0.5 mM to 1.5 mM.

[0057] In some embodiments of the present invention, the concentration of ferulic acid in the synthetic reaction reagent is 0.8 mM to 1.2 mM.

[0058] In some embodiments of the present invention, the concentration of ferulic acid in the synthetic reaction reagent is 0.9 mM to 1.1 mM.

[0059] In some embodiments of the present invention, the concentration of ethyl gallate in the synthetic reaction reagent is 1 mM to 3 mM.

[0060] In some embodiments of the present invention, the concentration of ethyl gallate in the synthetic reaction reagent is 1.5 mM to 2.5 mM.

[0061] In some embodiments of the present invention, the concentration of ethyl gallate in the synthetic reaction reagent is 1.8 mM to 2.2 mM.

[0062] In some embodiments of the present invention, the concentration of ethyl gallate in the synthetic reaction reagent is 1.9 mM to 2.1 mM.

[0063] In some embodiments of the present invention, the mass concentration of glycerol in the synthetic reaction reagent is 0.5 to 5%.

[0064] In some embodiments of the present invention, the mass concentration of glycerol in the synthetic reaction reagent is 1 - 3%.

[0065] In some embodiments of the present invention, the mass concentration of glycerol in the synthetic reaction reagent is 1.5 to 2.5%.

[0066] In some embodiments of the present invention, the mass concentration of glycerol in the synthetic reaction reagent is 1.8 to 2.2%.

[0067] In some embodiments of the present invention, the mass concentration of glycerol in the synthetic reaction reagent is 1.9 to 2.1%.

[0068] In some embodiments of the present invention, the concentration of ferulic acid in the synthesis reaction reagent is 0.8 mM to 1.2 mM, the concentration of ethyl gallate in the synthesis reaction reagent is 1.8 mM to 2.2 mM, and the mass concentration of glycerol in the synthesis reaction reagent is 1.8% to 2.2%.

[0069] In some embodiments of the present invention, the concentration of ferulic acid in the synthesis reaction reagent is 1 mM, the concentration of ethyl gallate in the synthesis reaction reagent is 2 mM, and the mass concentration of glycerol in the synthesis reaction reagent is 2%.

[0070] The conventional synthesis reaction reagent in the present invention refers to the conventional reagent used in the polymerization reaction in DNA sequencing, generally including components such as buffer, soluble salt, polymerase, and nucleotide analogs.

[0071] Among them, the buffer includes but is not limited to: HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffer, SSC (sodium citrate) buffer, Tricine (N-tris(hydroxymethyl)methylglycine) buffer, PBS (phosphate) buffer, etc. The concentration of the buffer agent in the buffer is 0.1 mM to 1000 mM. Specifically, it can be 0.1 mM, 0.2 mM, 0.5 mM, 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 200 mM, 300 mM, 400 mM, 500 mM, 600 mM, 700 mM, 800 mM, 900 mM, 1000 mM. Further, the concentration of the buffer agent is 1 mM to 500 mM, 10 mM to 100 mM, 40 mM to 60 mM, 45 to 55 mM. Among them, the buffer agent refers to the component that plays a buffering role in the buffer. For example, the buffer agent in the HEPES buffer is 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid.

[0072] The soluble salts in the present invention include one or more of ammonium salts (such as ammonium sulfate, ammonium chloride, etc.), magnesium salts (such as magnesium sulfate, magnesium chloride, etc.), sodium salts (sodium chloride, EDTA, etc.), etc.

[0073] The final concentration of the ammonium salt in the synthesis reaction reagent is 1 mM to 50 mM. Specifically, it can be 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM. Further, the final concentration of the ammonium salt is 1 mM to 30 mM, 5 mM to 20 mM, 8 mM to 12 mM, 9 mM to 11 mM. Further, the ammonium salt is ammonium sulfate at 5 mM to 20 mM.

[0074] The final concentration of the magnesium salt in the synthesis reaction reagent is 1 mM to 20 mM. Specifically, it can be 1 mM, 2 mM, 5 mM, 10 mM, 15 mM, 20 mM. Further, it can be 1 mM to 10 mM, 1 mM to 5 mM, 2 mM to 4 mM, 2.5 mM to 3.5 mM. Further, the magnesium salt is magnesium sulfate at 1 mM to 5 mM.

[0075] In some embodiments of the present invention, the sodium salt is sodium chloride and EDTA. The final concentration of sodium chloride in the synthesis reaction reagent is 1 mM to 100 mM. Specifically, it can be 1 mM, 2 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM. Further, the final concentration of sodium chloride is 10 mM to 90 mM, 20 mM to 80 mM, 30 mM to 70 mM, 40 mM to 60 mM, 45 mM to 55 mM. The final concentration of EDTA in the synthesis reaction reagent is 0.1 mM to 10 mM. Specifically, it can be 0.1 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, 2 mM, 5 mM, 10 mM. Further, it can be 0.5 mM to 5 mM, 0.6 mM to 2 mM, 0.8 mM to 1.5 mM, 0.8 mM to 1.2 mM.

[0076] The nucleotide analog in the present invention is a deoxynucleotide analog, specifically a deoxynucleotide modified with a fluorescent group and / or a blocking group, including an analog of at least one of deoxyribonucleotide adenine (dATP), deoxyribonucleotide guanine (dGTP), deoxythymidine monophosphate (dTTP), and deoxycytidine monophosphate (dCTP). Among them, the fluorescent group includes but is not limited to FAM, HEX, TAMRA, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Texas, ROX, JOE, R6G, EDANS, iFluor, Alexa Fluor, FITC, etc. The blocking group includes but is not limited to azide group, amino group, allyl group, phosphate group, 3′-O-(2-cyanoethyl), etc.

[0077] Among them, the nucleotide analog being modified with a fluorescent group and a blocking group means that the fluorescent group and the blocking group are directly and simultaneously modified at at least one position of the base, ribose, etc. of the nucleotide analog, or indirectly modified with a fluorescent group and a blocking group through the binding of other molecules modified with a fluorescent group and / or a blocking group to the nucleotide analog. The fluorescent group and the blocking group can be independently modified onto the nucleotide analog before or after the nucleotide analog is linked to the primer.

[0078] In some embodiments of the present invention, the nucleotide analogs are dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group. The final concentrations of dATP, dCTP, dGTP, and dTTP in the synthesis reaction reagent are 0.1 uM to 10 uM respectively. Specifically, they can be 0.1 uM, 0.2 uM, 0.5 uM, 0.8 uM, 1 uM, 2 uM, 5 uM, 10 uM. Further, they can be 0.5 uM to 5 uM, 0.8 uM to 2 uM, 0.9 uM to 1.5 uM, 1 uM to 1.2 uM.

[0079] The polymerase in the present invention is a DNA polymerase, and the polymerase has strong catalytic ability for nucleotide analogs, such as polymerase 9N, polymerase Slim, etc. The final concentration of the polymerase in the synthesis reaction reagent is 0.001 mg / mL to 0.1 mg / mL. Specifically, it can be 0.001 mg / mL, 0.002 mg / mL, 0.005 mg / mL, 0.01 mg / mL, 0.02 mg / mL, 0.05 mg / mL, 0.08 mg / mL, 0.1 mg / mL. Further, it can be 0.005 mg / mL to 0.05 mg / mL, 0.008 mg / mL to 0.04 mg / mL, 0.01 mg / mL to 0.03 mg / mL, 0.015 mg / mL to 0.025 mg / mL.

[0080] In some embodiments of the present invention, the synthesis reaction reagent is composed of HEPES buffer, NaCl, (NH4)2SO4, MgSO4, EDTA, polymerase Slim, nucleotide analogs, ferulic acid, ethyl gallate, and glycerol;

[0081] The nucleotide analogs are dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group.

[0082] In some embodiments of the present invention, the synthesis reaction reagent is composed of components with the following concentrations: 45 - 55 mM HEPES buffer, 45 mM - 55 mM NaCl, 5 mM - 15 mM (NH4)2SO4, 2 mM - 4 mM MgSO4, 0.8 mM - 1.2 mM EDTA, 0.015 mg / mL - 0.025 mg / mL polymerase Slim, 1 uM - 1.2 uM each of dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group, 0.8 mM - 1.2 mM ferulic acid, 1.8 mM - 2.2 mM ethyl gallate, and 1.8 - 2.2% glycerol.

[0083] In another embodiment of the present invention, the present invention provides a sequencing method, which comprises the following steps:

[0084] Polymerization reaction: reacting the nucleic acid molecule to be measured with the synthesis reaction reagent;

[0085] Signal acquisition: exciting the fluorescent group to generate a fluorescent signal, and identifying the fluorescent signal to obtain the base type and position;

[0086] Cleavage reaction: removing the blocking group and the fluorescent group;

[0087] Repeat the cycle of polymerization reaction - signal acquisition - cleavage reaction.

[0088] In the sequencing method of the present invention, signal acquisition starts immediately after the polymerization reaction starts. By using the above synthesis reaction reagent, signal acquisition and the synthesis reaction can be carried out almost simultaneously. Signal acquisition can be started after a nucleotide analogue is connected to the primer strand of some of the nucleic acid molecules, without waiting for all the nucleic acid molecules to complete the synthesis of at least one nucleotide analogue before starting signal acquisition, thus greatly shortening the sequencing time. At the same time, there is no need to separately add a signal acquisition reagent in the acquisition step.

[0089] In some embodiments of the present invention, signal acquisition starts immediately 0 - 60 s after the polymerization reaction starts. For example, it can start immediately 1 s, 2 s, 3 s, 5 s, 10 s, 15 s, 20 s, 25 s, 30 s, 35 s, 40 s, 45 s, 50 s, 55 s, 60 s after the start of the polymerization reaction step.

[0090] In some embodiments of the present invention, the temperature of the polymerization reaction is 45 - 70 °C. Specifically, it can be 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, 70 °C. Further, the temperature of the polymerization reaction is 50 °C - 60 °C.

[0091] In some embodiments of the present invention, the reaction temperature for signal acquisition is 35 - 70 °C. Specifically, it can be 35 °C, 40 °C, 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, 70 °C. Further, the reaction temperature for signal acquisition is 40 °C - 55 °C, 45 °C - 50 °C.

[0092] In some embodiments of the present invention, the reaction temperature for the cleavage reaction is 45 - 80 °C. Specifically, it can be 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, 70 °C, 75 °C, 80 °C. Further, the reaction temperature for the cleavage reaction is 60 °C - 70 °C.

[0093] The following are specific examples.

[0094] Example 1 Sequencing experiment of the synthesis reaction reagent

[0095] 1. Construction of sequencing library (constructed according to conventional methods in the field)

[0096] The method for constructing a sequencing library described below is universal for sequencing various types of DNA, taking the construction of a human genome library as an example.

[0097] (1) Nucleic acid extraction: A commercial kit (TIANGEN, KG203) was used to extract and purify nucleic acids.

[0098] (2) Library construction: The library was constructed according to the product instructions of the Novozymes VAHTS Universal Plus DNA Library Prep Kit for Illumina (Cat. No. ND617-02).

[0099] (3) Library quality control: quality control of the concentration and fragment length of the previously constructed library.

[0100] After performing the above steps in sequence, a library sample of about 50 nM with a length of about 1-1000 bp was finally obtained.

[0101] 2. Preparation of sequencing chips (prepared according to conventional methods in the field)

[0102] This step is accomplished using a sequencer (Salus pro) and a matching kit, including library denaturation, library hybridization, and amplification on the chip surface. At this point, DNA amplification clusters are distributed in the chip flow channel. Next, the corresponding sequencing primer (ACACTCTTTCCCTACACGACGCTCTTCCGATC (SEQ ID No. 1)) is pumped in for hybridization, and after completion, the next step of sequencing is entered.

[0103] 3. Sequencing

[0104] (1) Preparation of sequencing reagents

[0105] Control group: The formula of synthetic reagent 1 is as follows: 50mM HEPES, 50mM NaCl, 10mM (NH4)2SO4, 0.02mg / ml polymerase Slim (Salus-bio), 3mM MgSO4, 1mM EDTA, 10mM L-sodium ascorbate (VC), 2mM gallic acid (GA), 0.01mM BSA, 1uM each of dATP, dCTP, dGTP and dTTP with blocking groups and fluorescent groups.

[0106] In addition, the reagents required for the sequencing process include:

[0107] Pre-wash buffer: 50 mM Tris-HCl, 0.5 mM NaCl, 10 mM EDTA, 0.05% Tween 20.

[0108] Synthesis reagent 2: 50 mM HEPES, 50 mM NaCl, 10 mM (NH4)2SO4, 0.02 mg / ml polymerase Slim (Salus-bio), 3 mM MgSO4, 1 mM EDTA, 1 μM each of dATP, dCTP, dGTP, and dTTP (second nucleotide analogs) with only blocking groups.

[0109] Excision reagent: 20 mM THPP, 0.5 M NaCl, 50 mM Tris-HCl, pH 9.0, 0.05% Tween 20.

[0110] Among them, the blocking group is an azide group, and the fluorescent groups of dATP, dCTP, dGTP, and dTTP with blocking groups and fluorescent groups are Cy5, ROX, AF-532, and IF-700 respectively.

[0111] Elution buffer: 5×SSC, 0.05% Tween 20.

[0112] Experimental group: Synthesis reagent 1: On the basis of the control group's synthesis reagent 1 formula, replace 10 mM L-ascorbic acid sodium salt (VC), 2 mM gallic acid (Gallic Acid, GA), and 0.01 mM BSA with reducing molecules (including but not limited to pyrogallic acid, methyl gallate, 1 - 10 mM ethyl gallate, propyl gallate, octyl gallate, lauryl gallate, octadecyl gallate, trihydroxybenzamide, sodium ascorbate, hydroquinone, protocatechuic acid, ferulic acid, kaempferol, lysine, astaxanthin, carotene, cysteine, vitamin E, vitamin C, glycerol, reduced L-glutathione, etc.). In the experiment, the above reducing reagents or their combinations were respectively used to replace 10 mM L-ascorbic acid sodium salt (VC), 2 mM gallic acid (Gallic Acid, GA), and 0.01 mM BSA in the control group's synthesis reagent 1 for testing.

[0113] In addition, the reagents required for the sequencing process also include pre-wash buffer (same as the control group), synthesis reagent 2 (same as the control group), excision reagent, and elution buffer (same as the control group).

[0114] (2) Sequencing reaction cycle

[0115] a) Polymerization reaction: After the chip completes amplification, the injection pump pumps 100 μl of pre-washing buffer into the flow cell of the sequencing chip at a rate of 1600 μl / min, sets the temperature on the chip surface to 55 °C, and then the injection pump pumps 90 μl of synthesis reagent 2 into the flow cell of the sequencing chip at a rate of 1600 μl / min for a reaction of 10 s. After that, the injection pump pumps 140 μl of synthesis reagent 1 for both the control group and the experimental group into the flow cell of the sequencing chip at a rate of 1600 μl / min for a reaction of 20 s.

[0116] b) Signal acquisition: After the polymerization reaction proceeds for 20 s, the temperature is set to 47 °C, and synthesis reagent 1 continues to react in the flow cell. At this time, signal acquisition of the entire sequencing chip is performed, and the type of base is analyzed based on the fluorescence signal of the combined base to clarify the specific base at the current position.

[0117] c) Cleavage reaction: After completing signal acquisition, the temperature is set to 65 °C, and the injection pump pumps 200 μl of cleavage reagent at a rate of 1600 μl / min for a reaction of 1 min. After that, 200 μl of elution buffer is added and the washing is repeated once.

[0118] d) Steps a)-c) are sequentially repeated for each sequencing cycle, and a total of 150 sequencing cycles are performed.

[0119] (3) Sequencing results

[0120] According to the above experimental protocol, a large number of tests were carried out, the sequencing results of each time were compared and analyzed, the types and dosages of the added reagents were continuously adjusted, and the relatively preferred added reagents were ethyl gallate, ascorbic acid, glutathione, methyl gallate, propyl gallate, ferulic acid, sodium ascorbate, lauryl gallate; among which the most preferred is the combination of 2 mM ethyl gallate, 1 mM ferulic acid and 2% glycerol, and the sequencing experimental results of this combination are as Figure 1 shown. Some experimental results are shown in Table 1 below.

[0121] Table 1 Signal value decline of SE150 sequencing quality under different additives and their combination conditions

[0122] Additive composition and combination Signal decline ratio 1 None 65％ 2 15 mM Sodium L-ascorbate 60％ 3 5 mM Gallic acid 57％ 4 12 mM Ethyl gallate 55％ 5 5 mM Methyl gallate 60％ 6 5 mM Ferulic acid 50％ 7 5% Glycerol 53％ 8 2 mM Ethyl gallate, 10 mM Sodium L-ascorbate 52％ 9 2 mM Methyl gallate, 10 mM Sodium L-ascorbate 55％ 10 1 mM Ferulic acid, 2 mM Ethyl gallate, 2% Glycerol 42％ 11 1 mM Ferulic acid, 2 mM Ethyl gallate 48％

[0123] Example 2 Storage experiment and shelf life experiment of the formula of the new synthesis reaction reagent

[0124] Experimental protocol: On the basis of "50 mM HEPES, 50 mM NaCl, 10 mM (NH4)2SO4, 0.02 mg / ml polymerase Slim (Salus-bio), 3 mM MgSO4, 1 mM EDTA, 1 μM each of dATP, dCTP, dGTP, and dTTP with blocking groups and fluorescent groups", additives with the following four formula combinations were added respectively to obtain four groups of newly synthesized reagents 1. Four formula combinations: ① 10 mM VC + 2 mM GA + 0.01 mM BSA; ② 10 mM VC + 2 mM ethyl gallate; ③ 2 mM ethyl gallate + 1 mM ferulic acid; ④ 1 mM ferulic acid, 2 mM ethyl gallate + 2% glycerol. Reagents were prepared according to the above formula combinations. 1 L of each group of newly synthesized reagent 1 was prepared, 200 ml was taken out for storage experiments, and the remaining 800 ml was used for shelf-life experiments.

[0125] Storage experiment: The prepared newly synthesized reagent 1 was placed in a -20°C refrigerator. At 0 / 3 / 6 / 9 / 12 months after reagent preparation, a part of the reagents with the four formula combinations was taken out and placed in 15 ml centrifuge tubes and photographed to record whether there was discoloration or precipitation of the reagents. The experimental results are as Figure 2 shown.

[0126] As can be seen from Figure 2 it, the reagents with the four formula combinations just prepared on November 5, 2021 were all colorless and transparent; in the third month, the reagent of combination ① turned yellow, and there were no obvious color changes in the other three combination reagents; in the sixth month, the color of combination ① continued to deepen, and there were no obvious color changes in the other three combination reagents; in the ninth month, the color of combination ① changed from yellow to yellow-brown and was accompanied by the formation of precipitation, the color of combination ② was slightly yellowish, the color of combination ③ changed slightly, and there was no obvious change in combination ④; in the twelfth month, the color of combination ① was still yellow-brown and accompanied by precipitation, the yellow color of combination ② was slightly deepened, the color of combination ③ changed to light yellow, and there was no obvious change in the color of combination ④.

[0127] In summary: For combination ① 10 mM VC + 2 mM GA + 0.01 mM BSA, discoloration occurred after being stored in a -20°C refrigerator for three months; for combination ② 10 mM VC + 2 mM ethyl gallate and combination ③ 2 mM ethyl gallate + 1 mM ferulic acid, discoloration occurred after being stored in a -20°C refrigerator for nine months; for combination ④ 2 mM ethyl gallate + 1 mM ferulic acid + 2% glycerol, no discoloration occurred after being stored in a -20°C refrigerator for twelve months. Therefore, the reagent formula of combination ④ is more stable and easier to store.

[0128] Shelf-life experiment: The shelf-life experiment was carried out on formulation combinations ② 10 mM VC + 2 mM ethyl gallate, ③ 2 mM ethyl gallate + 1 mM ferulic acid, and ④ 2 mM ethyl gallate + 1 mM ferulic acid + 2% glycerol. The shelf-life experiment was carried out synchronously with the storage experiment. Sequencing was performed on the newly synthesized reagent 1 added with different combined formulations at 0 / 3 / 6 / 9 / 12 months to compare whether the sequencing quality changed with the extension of storage time. The experimental results are as Figure 3 , Figure 4 and Figure 5 shown.

[0129] Conclusion: For the synthesized reagent 1 added with formulation combination ② 10 mM VC + 2 mM ethyl gallate, the sequencing quality gradually decreased with the extension of storage time; for the synthesized reagent 1 added with formulation combination ③ 2 mM ethyl gallate + 1 mM ferulic acid, the sequencing quality basically did not change during the storage period of 0 - 6 months and decreased in the ninth month; for the synthesized reagent 1 added with formulation combination ④ 2 mM ethyl gallate + 1 mM ferulic acid + 2% glycerol, the sequencing quality basically did not change during the storage period of 0 - 9 months and decreased in the twelfth month. It shows that the reagent formulation of combination ④ is more stable and easier to store.

[0130] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0131] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several deformations and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the invention patent should be subject to the appended claims.

Claims

1. A synthetic reaction reagent, characterized in that, The synthetic reaction reagent consists of ferulic acid, ethyl gallate, glycerol, buffer, soluble salt, polymerase, and nucleotide analogs; The concentration of ferulic acid in the synthetic reaction reagent is 0.5 mM to 1.5 mM; The concentration of ethyl gallate in the synthetic reaction reagent is 1.5 mM to 2.5 mM; The mass concentration of glycerol in the synthetic reaction reagent is 0.5% to 5%.

2. The synthetic reaction reagent according to claim 1, wherein The mass concentration of glycerol in the synthetic reaction reagent is 1% to 3%.

3. The synthetic reaction reagent according to claim 2, wherein, The mass concentration of glycerol in the synthetic reaction reagent is 1.5% to 2.5%.

4. The synthetic reaction reagent according to claim 1, characterized in that, The concentration of ferulic acid in the synthetic reaction reagent is 0.8 mM to 1.2 mM, the concentration of ethyl gallate in the synthetic reaction reagent is 1.8 mM to 2.2 mM, and the mass concentration of glycerol in the synthetic reaction reagent is 1.8% to 2.2%.

5. The synthetic reaction reagent according to claim 4, characterized in that, The concentration of ferulic acid in the synthetic reaction reagent is 0.9 mM to 1.1 mM; and / or, the concentration of ethyl gallate in the synthetic reaction reagent is 1.9 mM to 2.1 mM.

6. The synthetic reaction reagent according to claim 4, wherein, The mass concentration of glycerol in the synthetic reaction reagent is 1.9% to 2.1%.

7. The synthetic reaction reagent according to any one of claims 1-6, characterized in that, The buffer is selected from at least one of HEPES buffer, SSC buffer, and PBS buffer; and / or, The soluble salt is selected from at least one of ammonium salts, magnesium salts, and sodium salts; and / or, The nucleotide analog is a deoxynucleotide modified with a fluorescent group and / or a blocking group; and / or, The polymerase is polymerase 9N or polymerase Slim.

8. The synthetic reaction reagent according to claim 1, wherein, It consists of HEPES buffer, NaCl, (NH4)2SO4, MgSO4, EDTA, polymerase Slim, nucleotide analogs, ferulic acid, ethyl gallate, and glycerol; the nucleotide analogs are dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group.

9. The synthetic reaction reagent according to claim 8, wherein The synthetic reaction reagent consists of components with the following concentrations: 45 to 55 mM HEPES buffer, 45 mM to 55 mM NaCl, 5 mM to 15 mM (NH4)2SO4, 2 mM to 4 mM MgSO4, 0.8 mM to 1.2 mM EDTA, 0.015 mg / mL to 0.025 mg / mL polymerase Slim, 1 μM to 1.2 μM each of dATP, dCTP, dGTP, and dTTP modified with a fluorescent group and a blocking group, 0.8 mM to 1.2 mM ferulic acid, 1.8 mM to 2.2 mM ethyl gallate, and 1.8% to 2.2% glycerol.

10. A sequencing method, characterized in that, It includes the following steps: Polymerization reaction: The nucleic acid molecule to be detected reacts with the synthetic reaction reagent according to any one of claims 1-9; Signal acquisition: The fluorescent group is excited to generate a fluorescent signal, and the base type and position are identified by recognizing the fluorescent signal; Cleavage reaction: The blocking group and the fluorescent group are removed; Repeat the cycle of polymerization reaction - signal acquisition - cleavage reaction.

Images