Mycoplasma fluorescence quantitative PCR positive control product capable of distinguishing positive control pollution, detection method and application thereof

A real-time quantitative PCR method using fluorescent primers and probes with irrelevant sequences inserted into the conserved region of mycoplasma 16S has solved the problems of rapid, sensitive, and accurate detection of mycoplasma contamination in cell culture, achieving efficient differentiation of positive control contamination and exclusion of false negatives.

CN116656843BActive Publication Date: 2026-04-17THE UNITED BIO-TECH (HENGQIN) CO LTD +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210151566.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-02-18
Publication Date
2026-04-17
Estimated Expiration
2042-02-18

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid, sensitive, and accurate detection of mycoplasma contamination during cell culture, especially in avoiding interference from positive control contamination, leading to frequent false negative or false positive results.

Method used

A quantitative real-time PCR detection method for mycoplasma that can distinguish positive control contamination was designed. An irrelevant sequence was inserted inside the conserved region of mycoplasma 16S as a positive control, and quantitative real-time PCR detection was performed using specific primers and probes. An internal reference plasmid was used to eliminate errors in extraction and reaction.

Benefits of technology

It achieves high sensitivity and broad spectrum detection of mycoplasma contamination, can accurately distinguish positive control contamination, reduce false negative results, and is suitable for mycoplasma monitoring in cell culture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116656843B_ABST
    Figure CN116656843B_ABST
Patent Text Reader

Abstract

This invention discloses a positive control for mycoplasma detected by quantitative real-time PCR (qPCR) that can distinguish between positive control contamination and positive control contamination, along with its applications. The invention provides a positive control obtained by inserting an irrelevant sequence into a highly conserved region of mycoplasma. Using this positive control, an internal probe is designed to distinguish between positive samples and the positive control, avoiding potential cross-contamination and establishing a method for detecting mycoplasma that can distinguish between positive control contamination and positive control contamination. This method can determine the accuracy of qPCR results, eliminate interference from positive control contamination of the test sample, and is highly sensitive with a wide detection range. It can be used for detecting mycoplasma contamination in scientific research and the biopharmaceutical industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to a positive control for mycoplasma fluorescence quantitative PCR that can distinguish positive control contamination, a detection method, and its application. Background Technology

[0002] Mycoplasma contamination is one of the most common contaminants in cell culture. Since Robinson LB et al. first discovered mycoplasma contamination in cell culture in 1956, the problem has become ubiquitous. Existing reports show that the proportion of mycoplasma contamination in cell lines worldwide is as high as 30-60%. Mycoplasma contamination has a serious impact on the physiological growth of the host, causing huge losses to scientific research and the biopharmaceutical industry.

[0003] Mycoplasma, the smallest cell-wall-less prokaryotic cells discovered to date, is between the size of bacteria and viruses, with a diameter of approximately 0.2-0.3 μm. It can pass through commonly used sterile filters (0.22-0.45 μm), making mycoplasma contamination during cell culture difficult to avoid. Furthermore, most cells show almost no obvious morphological changes in the early stages of mycoplasma infection, making it difficult to detect with the naked eye or under a regular microscope. Therefore, mycoplasma contamination is easily overlooked, often only being discovered when the contamination is very severe. Most mycoplasmas are not sensitive to common antibiotics, making their elimination difficult. Mycoplasma contamination in cell cultures has become a challenging global problem. Therefore, finding a rapid, sensitive, and broad-spectrum method for routine detection of mycoplasma in cells is of paramount importance.

[0004] Currently, there are various methods for detecting mycoplasma contamination during cell culture, including cell culture, DNA fluorescence staining, PCR, and ELISA. Cell culture is time-consuming, typically requiring 28 days to determine mycoplasma contamination, resulting in a large workload and the risk of further mycoplasma transmission. DNA fluorescence staining is simple to operate and fast, but its sensitivity is relatively low. PCR is simple to operate, inexpensive, and has high sensitivity, but it can also produce false negatives or false positives due to experimental design, operation, and reagents. Real-time quantitative PCR offers advantages over PCR, such as faster detection, real-time monitoring, and higher sensitivity; however, it still faces the challenge of cross-contamination with positive controls in practice. Therefore, a highly sensitive, rapid mycoplasma detection method capable of distinguishing between positive control contamination and other methods is urgently needed. Summary of the Invention

[0005] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a fluorescent quantitative PCR positive control that can distinguish positive control contamination.

[0006] Another objective of this invention is to provide a method for detecting mycoplasma using real-time fluorescence PCR that can distinguish between positive control contamination and other pollutants.

[0007] Another object of the present invention is to provide the application of the above-mentioned method for detecting mycoplasma using real-time PCR that can distinguish between positive control contamination.

[0008] The objective of this invention is achieved through the following technical solution: a fluorescent quantitative PCR positive control that can distinguish positive control contamination is a sequence obtained by inserting an irrelevant sequence into the conserved sequence of mycoplasma.

[0009] The mycoplasma conserved sequence is preferably the 16S conserved region; more preferably, it is the sequence shown in SEQ ID NO.1.

[0010] The sequence of the positive control is preferably an irrelevant sequence inserted inside the sequence shown in SEQ ID NO.1; more preferably, it is the sequence shown in SEQ ID NO.2.

[0011] A method for detecting mycoplasma using real-time fluorescence PCR that can distinguish positive control contamination includes the following steps: performing real-time fluorescence PCR on the sample to be tested using the following mycoplasma primer pairs and mycoplasma probes; setting up a positive control group using the above-mentioned real-time fluorescence PCR positive control as a template;

[0012] Myco-Forward Primer: 5'-ACGCTTTACGCCCAATAATTCCG-3';

[0013] Myco-Reversed Primer: 5'-AAGCTTGATGGAGCGACACA-3';

[0014] Myco-Probe: 5'-FAM-TCGCTTTCTAATAAGGTACCGTCA-BHQ1-3';

[0015] The irrelevant sequence probe NS-Probe is designed specifically for irrelevant sequences.

[0016] The sample to be tested is the DNA of a sample that needs to be tested for mycoplasma contamination.

[0017] When extracting DNA from samples requiring mycoplasma contamination testing, the preferred method is to add an internal control plasmid to the sample before DNA extraction. This procedure eliminates false negative results caused by improper nucleic acid extraction, PCR reaction inhibition, or operational errors.

[0018] The aforementioned method for detecting mycoplasma using real-time fluorescence PCR that can distinguish between positive control contamination also includes primer pairs for detecting the internal control plasmid and probes for detecting the internal control plasmid; preferred primers and probes are as follows:

[0019] IC-Forward Primer: 5'-CCAAAGAGATGCCTTTCCAG-3';

[0020] IC-Reversed Primer: 5'-GATGCACAGAAGCTCCCT-3';

[0021] IC-Probe: 5'-VIC-CAGCAAGACAGTCCTCTGGCCAGA-BHQ1-3'.

[0022] The mycoplasma conserved sequence is preferably the 16S conserved region; more preferably, it is the sequence shown in SEQ ID NO.1.

[0023] The sequence of the positive control is preferably an irrelevant sequence inserted inside the sequence shown in SEQ ID NO.1; more preferably, it is the sequence shown in SEQ ID NO.2.

[0024] The NS-Probe with the irrelevant sequence is preferably designed for the following sequence: GAAGTAATAACTTGGACTCCATTCACTCCAGAAGCCTTTAAAATAGTGAT.

[0025] The more preferred method for the irrelevant sequence probe NS-Probe is as follows:

[0026] 5'-CY5-ACTTGGACTCCATTCACTCCAGAAGCC-BHQ3-3'.

[0027] The preferred system for the quantitative real-time PCR is as follows: 10 μL Luna Universal qPCR Master Mix, 0.5 μL each of the upstream and downstream primers of a 10 μM mycoplasma primer pair, 0.5 μL each of the upstream and downstream primers of a 10 μM primer pair for detecting the internal control plasmid, 0.25 μL of a 10 μM mycoplasma probe, 0.25 μL of a 10 μM probe for detecting the internal control plasmid, 0.25 μL of a 10 μM NS-Probe probe, 2 μL template, and nuclease-free water to a final volume of 20 μL.

[0028] The preferred reaction conditions for the quantitative real-time PCR are as follows: 95℃ pre-denaturation for 1 min; 95℃ for 15 sec, 55℃ for 30 sec, for 45 cycles.

[0029] The above-mentioned quantitative real-time PCR detection method for mycoplasma, which can distinguish positive control contamination, is mainly used in scientific research and the biopharmaceutical industry to detect mycoplasma contamination during cell culture.

[0030] The present invention has the following advantages and effects compared with the prior art:

[0031] 1. This invention can determine the accuracy of qPCR detection results and eliminate interference from positive control contamination of the test sample:

[0032] This invention inserts an irrelevant sequence as a positive control within the conserved 16S region of mycoplasma, and designs an internal probe to distinguish between positive samples and positive controls. This helps to determine the accuracy of the detection results and avoids the shortcomings of existing detection methods, including various detection kits, which are easily contaminated by positive controls. It is particularly suitable for the routine monitoring of mycoplasma contamination during cell culture.

[0033] 2. This invention has a wide detection range and is a broad-spectrum mycoplasma detection method:

[0034] The Taqman real-time PCR method for detecting mycoplasma developed in this invention performed BLAST comparisons on the 16S rRNA of 166 mycoplasma species, selected species-specific regions, and designed mycoplasma-specific primers. Theoretically, these primers can detect up to 166 mycoplasma species, including the eight most common mycoplasma species that contaminate cells: M. Hyorhinis, M. Fermentans, M. Arginini, M. hominis, M. orale, M. salivarium, M. pirum, and Acholeplasma Laidlawii.

[0035] 3. This invention has high sensitivity, avoiding false negative results caused by poor sensitivity during the detection process:

[0036] This invention utilizes the Shenke Mycoplasma Nucleic Acid Extraction Kit to extract nucleic acid from the supernatant of test cells, increasing the extraction yield and detection rate. The addition of an internal control plasmid during extraction eliminates false negatives caused by improper nucleic acid extraction, PCR reaction inhibition, or operational errors. Furthermore, the sensitivity and repeatability of the method were tested: Real-time PCR using the primer and probe sequence detected a minimum of 10 copies of the positive control plasmid, achieving a sensitivity of 2 × 10⁻⁶ for mycoplasma detection. 0 With a copy number / μL, amplification efficiency ≥99.0%, and correlation >0.990, it has the advantages of high sensitivity, simple operation, short time consumption, and good result stability and reproducibility. Attached Figure Description

[0037] Figure 1 This is a graph showing the mycoplasma probe specificity detection results of primer-probe combination 1 in Example 1.

[0038] Figure 2 This is a graph showing the mycoplasma probe specificity detection results of primer-probe combination 2 in Example 1.

[0039] Figure 3 This is a graph showing the mycoplasma probe specificity detection results of primer-probe combination 3 in Example 1.

[0040] Figure 4 This is a graph showing the mycoplasma probe specificity detection results of primer-probe combination 4 in Example 1.

[0041] Figure 5 This is a graph showing the sensitivity results of fluorescence quantitative PCR amplification of the mycoplasma positive control plasmid in Example 2.

[0042] Figure 6 This is the standard curve of the mycoplasma positive control plasmid amplified by real-time PCR in Example 2.

[0043] Figure 7 This is a graph showing the test results of positive and negative samples in Example 3 that were not contaminated by the positive control; where PS is the positive sample, NS is the negative sample, and PC is the positive control.

[0044] Figure 8 This is a graph showing the detection results in Example 3 where both the positive and negative samples were contaminated by the positive control; PS represents the positive sample, NS represents the negative sample, and PC represents the positive control.

[0045] Figure 9 This is a graph showing the test results in Example 3 where the positive sample was contaminated by the positive control and the negative sample was not contaminated; PS represents the positive sample, NS represents the negative sample, and PC represents the positive control.

[0046] Figure 10 This is a graph showing the test results in Example 3 where the negative sample was contaminated by the positive control and the positive sample was not contaminated; PS represents the positive sample, NS represents the negative sample, and PC represents the positive control.

[0047] Figure 11 This is a graph showing the detection results of mycoplasma DNA extracts from 10 CHO engineered cell lines in Example 4 under the internal reference plasmid probe.

[0048] Figure 12 This is a graph showing the detection results of mycoplasma DNA extracts from 10 CHO engineered cell lines in Example 4 under the mycoplasma detection probe.

[0049] Figure 13This is a graph showing the detection results of mycoplasma DNA extracts from 10 CHO engineered cell lines in Example 4 under the positive control internal probe. Detailed Implementation

[0050] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0051] This invention provides a highly sensitive, broad-spectrum, safe, reliable, and distinguishable method for detecting mycoplasma contamination using real-time quantitative PCR. The main research process is as follows:

[0052] This invention searches for Mycoplasma 16S RNA sequences in the NCBI Genome Database, identifying 166 species. Using software such as CloneManager, these 166 16S RNA sequences were compared to identify a conserved region (250 bp, the sequence shown in SEQ ID NO.1), which was used as a positive standard template. An irrelevant sequence (305 bp, the sequence shown in SEQ ID NO.2) was inserted as a positive control template. Initially, primers and probes as shown in SEQ ID NO.3–5 were designed based on quantitative real-time PCR, but non-specific amplification occurred during actual detection. Therefore, the primers and probes were optimized, and new primers and probes as shown in SEQ ID NO.6–7 were added. These were then combined with the primers and probes shown in SEQ ID NO.3–5 for optimization. Through experimental analysis, highly specific primer combinations were selected. These primer-probe combinations exhibit extremely high sensitivity in Mycoplasma detection. Finally, the distinguishability of positive control contamination during Mycoplasma detection was verified.

[0053] In this invention, the primers and probes for real-time quantitative PCR detection of mycoplasma, as well as the internal control plasmid primers and probes, were synthesized by Thermofisher. The experimental samples were the supernatant of the cell line to be tested and a small amount of mycoplasma DNA extract obtained using a mycoplasma DNA extraction and purification kit (magnetic bead method), which increased the extraction yield and detection rate. Simultaneously, an internal control plasmid pLPCX-hIL-4Ra (synthesized by Genscript Biotech, as shown in SEQ ID NO. 11, and cloned onto pLPCX) was added during the mycoplasma extraction process or to the real-time quantitative PCR reaction system to eliminate false negative results caused by improper nucleic acid extraction, PCR reaction inhibition, or operational errors. The real-time quantitative PCR instrument was a 7500 Real-Time PCR System (Applied Biosystems), purchased from Thermofisher. Unless otherwise specified in the following examples, all reagents and materials are commercially available products.

[0054] SEQ ID NO.1:

[0055] ACGCTTTACGCCCAATAATTCCGGATAACGCTTGCGACCTATGTATTACCGCGGCTGCTGGCACATAGTTTGCCGTCGCTTTCTAATAAGGTACCGTCAAGATTAAATCATTTCCTATTTAATTTTTTCTTTCCTTATAACAGCACTTTACATCCCTAAAGACTTCATCGTGCACGCTGTGTCGCTCCATCAAGCTTTCGCTCATTGTGGAAAATTCCTTACTGCTGCCTCCCGTAGGAGTCTGGGCCGTATCTC。

[0056] SEQ ID NO.2:

[0057] ACGCTTTACGCCCAATAATTCCGGATAACGCTTGCGACCTATGTATTACCGCGGCTGCTGGCACATAGTTTGCCGT GAAGTAATAACTTGGACTCCATTCACTCCAGAAGCCTTTAAAATAGTGAT CGCTTTCTAATAAGGTACCGTCAAGATTAAATCATTTCCTATTTAATTTTTTCTTTCCTTATAACAGCACTTTACATCCCTAAAGACTTCATCGTGCACGCTGTGTCGCTCCATCAAGCTTTCGCTCATTGTGGAAAATTCCTTACTGCTGCCTCCCGTAGGAGTCTGGGCCGTATCTC(The underlined sequence is an irrelevant sequence).

[0058] SEQ ID NO.3:5’-ACGCTTTACGCCCAATAATTCCG-3’;

[0059] SEQ ID NO.4:5’-GAGATACGGCCCAGACTCCTAC-3’;

[0060] SEQ ID NO.5:5’-FAM-CCTATGTATTACCGCGGCTGCTGGCAC-BHQ1-3’;

[0061] SEQ ID NO.6:5’-AAGCTTGATGGAGCGACACA-3’;

[0062] SEQ ID NO.7:5’-FAM-TCGCTTTCTAATAAGGTACCGTCA-BHQ1-3’;

[0063] SEQ ID NO.8:5’-CCAAAGAGATGCCTTTCCAG-3’;

[0064] SEQ ID NO.9:5’-GATGCACAGAAGCTCCCT-3’;

[0065] SEQ ID NO.10:5’-VIC-CAGCAAGACAGTCCTCTGGCCAGA-BHQ1-3’;

[0066] SEQ ID NO.11(hIL-4Ra):

[0067]

[0068] Example 1 Specificity Verification

[0069] (1) Primer design

[0070] Based on the primer and probe design principles of quantitative real-time PCR, we designed the following primers and probes targeting the conserved 16S RNA sequence region of Mycoplasma, and performed various combinations, as detailed below:

[0071] Primer-probe combination 1:

[0072] Myco-Forward Primer: 5'-ACGCTTTACGCCCAATAATTCCG-3' (SEQ ID NO.3);

[0073] Myco-Reversed Primer: 5'-GAGATACGGCCCAGACTCCTAC-3' (SEQ ID NO.4);

[0074] Myco-Probe: 5'-FAM-CCTATGTATTACCGCGGCTGCTGGCAC-BHQ1-3' (SEQ ID NO.5);

[0075] Primer-probe combination 2:

[0076] Myco-Forward Primer: 5'-ACGCTTTACGCCCAATAATTCCG-3' (SEQ ID NO.3);

[0077] Myco-Reversed Primer-3: 5'-AAGCTTGATGGAGCGACACA-3' (SEQ ID NO. 6);

[0078] Myco-Probe: 5'-FAM-CCTATGTATTACCGCGGCTGCTGGCAC-BHQ1-3' (SEQ ID NO.5);

[0079] Primer-probe combination 3:

[0080] Myco-Forward Primer: 5'-ACGCTTTACGCCCAATAATTCCG-3' (SEQ ID NO.3);

[0081] Myco-Reversed Primer: 5'-GAGATACGGCCCAGACTCCTAC-3' (SEQ ID NO.4);

[0082] Myco-Probe-2: 5'-FAM-TCGCTTTCTAATAAGGTACCGTCA-BHQ1-3' (SEQ ID NO.7);

[0083] Primer-probe combination 4:

[0084] Myco-Forward Primer: 5'-ACGCTTTACGCCCAATAATTCCG-3' (SEQ ID NO.3);

[0085] Myco-Reversed Primer-3: 5'-AAGCTTGATGGAGCGACACA-3' (SEQ ID NO. 6);

[0086] Myco-Probe-2: 5'-FAM-TCGCTTTCTAATAAGGTACCGTCA-BHQ1-3' (SEQ ID NO.7);

[0087] The specific primer and probe sequences for the internal control plasmid are as follows:

[0088] IC-Forward Primer: 5'-CCAAAGAGATGCCTTTCCAG-3' (SEQ ID NO.8);

[0089] IC-Reversed Primer: 5'-GATGCACAGAAGCTCCCT-3' (SEQ ID NO.9);

[0090] IC-Probe: 5'-VIC-CAGCAAGACAGTCCTCTGGCCAGA-BHQ1-3' (SEQ ID NO. 10).

[0091] (2) Real-time PCR reaction

[0092] The reaction system is set up as follows:

[0093] 10 μL of Luna Universal qPCR Master Mix, 0.5 μL each of 10 μM mycoplasma upstream and downstream primers, 0.5 μL each of 10 μM internal control plasmid upstream and downstream primers, 0.25 μL of 10 μM mycoplasma detection probe, 0.25 μL of 10 μM internal control plasmid probe, 2 μL of template (cell supernatant extracted using Shenke Mycoplasma Nucleic Acid Extraction Kit), and nuclease-free water to a final volume of 20 μL.

[0094] The reaction conditions were set as follows: 95℃ pre-denaturation for 1 min; 95℃ for 15 sec, 55℃ for 30 sec, for 45 cycles.

[0095] Mycoplasma probe specificity detection results as follows Figures 1-4 As shown, this indicates that:

[0096] Under the above reaction system and reaction conditions, primer-probe combination 1 exhibits multiple amplification curves, thus indicating non-specific amplification.

[0097] Under the above reaction system and reaction conditions, primer-probe combination 2 only has one amplification curve, therefore there is a small amount of non-specific amplification.

[0098] Under the above reaction system and reaction conditions, primer-probe combination 3 showed no amplification curve and no non-specific amplification.

[0099] Under the above reaction system and reaction conditions, primer-probe combination 4 showed no amplification curve and no non-specific amplification.

[0100] In the subsequent experimental design, we selected primer-probe combination 4 to carry out subsequent experimental verification.

[0101] Example 2 Sensitivity Verification

[0102] In this embodiment, a micro-spectrophotometer was used to detect the concentration of the positive control plasmid (pUC19-Myco305, which was obtained by cloning the sequence shown in SEQ ID NO.2 synthesized by Genscript Biotech and cloned into pUC19), and the concentration was determined using the formula (copy number / mL = 6.02 × 10⁻⁶). 23 ×concentration (μg / mL) × 10 -6 The corresponding copy number was calculated using / MW, and then the concentration was diluted to 2×10⁻⁶ using a 10-fold serial dilution. 7 ~2×10 -1 Copy number / μL.

[0103] The reaction system for real-time PCR was as follows: 10 μL Luna Universal qPCR Master Mix, 0.5 μL each of 10 μM mycoplasma upstream and downstream primers, 0.5 μL each of 10 μM internal control plasmid upstream and downstream primers, 0.25 μL of 10 μM mycoplasma detection probe, 2 μL internal control plasmid, 0.25 μL of 10 μM internal control plasmid probe, and template (gradually diluted to 2 × 10⁻⁶ concentrations). 7 ~2×10 -1 5 μL of positive control plasmid (copy number / μL or nuclease-free water) was added, and the amount of nuclease-free water was brought up to 20 μL. The mycoplasma detection primers and probes used were the primer-probe combination 4 in Example 1.

[0104] The conditions for the real-time PCR reaction were: 95℃ pre-denaturation for 1 min; 95℃ for 15 sec, 55℃ for 30 sec, for 45 cycles.

[0105] Sensitivity determination and corresponding amplification curves ( Figure 5 The pUC19-Myco305 plasmid was observed at a concentration of 2×10⁻⁶. 7 ~2×10 0 At a copy number / μL, clear amplification curves were produced, while at 2×10⁻⁶, clear amplification curves were produced. -1 No amplification curve was observed when using the positive control plasmid (copy number / μL) and nuclease-free water as templates, indicating that mycoplasma recombinant plasmids containing 10 copies per well could be detected. This demonstrates that the sensitivity of this quantitative real-time PCR for mycoplasma detection can reach 2 × 10⁻⁶. 0 Copy number / μL.

[0106] Analysis of the standard curve using analytical software showed a good linear relationship between the Ct value and the logarithm of the standard concentration, with a linear correlation coefficient Rt. 2 The value was 0.993, and the amplification efficiency was 105.593%, as shown in the results. Figure 6 As shown.

[0107] Example 3: Differentiation of Positive Control Verification

[0108] In this embodiment, a micro spectrophotometer was used to detect the concentrations of the positive standard plasmid (pUC57-Myco255, which was synthesized by Genscript Biotech and cloned into pUC57) and the positive control plasmid (pUC19-Myco305), and the concentrations were determined using the formula (copy number / mL = 6.02 × 10⁻⁶). 23 ×concentration (μg / mL) × 10 -6 The corresponding copy number was calculated using / MW, and then the concentration was diluted to 2×10⁻⁶ using a 10-fold serial dilution. 3 Copy number / μL is reserved. In this embodiment, we used pUC57-Myco255 as the positive sample, nuclease-free water as the negative sample, and pUC19Myco305 as the positive control, and designed an experiment to simulate possible situations during the detection of the test samples.

[0109] The reaction system for real-time PCR was as follows: 10 μL Luna Universal qPCR Master Mix, 0.5 μL each of 10 μM mycoplasma upstream and downstream primers, 0.5 μL each of 10 μM internal control plasmid upstream and downstream primers, 0.25 μL of 10 μM mycoplasma detection probe, 2 μL internal control plasmid, 0.25 μL of 10 μM internal control plasmid probe, 0.25 μL of 10 μM positive control internal probe (5'-CY5-ACTTGGACTCCATTCACTCCAGAAGCC-BHQ3-3'), and template (concentration 2 × 10⁻⁶). 3 Positive standard plasmid with copy number / μL and a concentration of 2×10 3 5 μL of positive control plasmid (copy number / μL), nuclease-free water or a combination of the above samples, and nuclease-free water to bring the total to 20 μL; the mycoplasma detection primers and probes used are the primer-probe combination 4 in Example 1.

[0110] The conditions for the real-time PCR reaction were: 95℃ pre-denaturation for 1 min; 95℃ for 15 sec, 55℃ for 30 sec, for 45 cycles.

[0111] Positive and negative samples were tested according to the conditions provided above. The positive control was prepared according to the method provided in this invention. The test results are as follows: Figures 7-10 Four scenarios: From Figure 7 It is evident that neither the positive nor negative samples were contaminated by the positive control; from Figure 8 It is evident that both the positive and negative samples were contaminated by the positive control; from Figure 9 It is evident that the positive sample was contaminated by the positive control, while the negative sample was not contaminated; from Figure 10 It is evident that the negative sample was contaminated by the positive control, while the positive sample was not contaminated.

[0112] Example 4

[0113] In this embodiment, mycoplasma DNA was extracted from the culture supernatant of 10 CHO engineered cell lines and a small number of cells (less than 1M). The extracted samples were detected by real-time quantitative PCR using primer-probe combination 4 from Example 1. The reaction system and conditions were the same as those in Example 3. Nuclease-free water was used as a negative control, and the pUC19-Myco305 recombinant plasmid (concentration 1×10⁻⁶) was also used. 5 The copy number (μL) was used as a positive control. Results are as follows: Figures 11-13 As shown, Figure 11 The image shows the amplification curves of the internal control plasmid probe. All samples have amplification curves, indicating that the mycoplasma extraction steps were correct. Figure 12 This is an amplification diagram of the mycoplasma detection probe. Only the positive control showed amplification, indicating that all the samples tested were negative. Figure 13 This is an amplification map of the internal probe of the positive control. Only the positive control shows amplification, indicating that the test samples were not contaminated by the positive control. Therefore, the above test results are accurate and reliable. None of the test samples were contaminated with mycoplasma.

[0114] In the PCR reaction, the supernatant of CHO engineered cell line culture and mycoplasma DNA extract of a small amount of cells were used as templates. Primer probe combination 4 from Example 1 was added, and the fluorescence quantitative PCR reaction was carried out according to the reaction system and reaction conditions in Example 3. If there is specific amplification, when analyzing the detection results, the threshold line of the reaction was first adjusted to be consistent with the standard curve prepared in Example 2. Then, the Ct value of the sample detection was substituted into the standard curve to obtain the mycoplasma DNA copy number in the sample.

[0115] In the PCR reaction, pUC19-Myco305 was used as a positive control. When the primer and probe combination 4 of Example 1 was added to perform the real-time PCR reaction, if there was no specific amplification, the detection result of the sample to be tested was invalid.

[0116] When using the sample to be tested as a template, and adding the internal reference plasmid and its specific primers and probes for real-time PCR, if there is no specific amplification, the detection results obtained by the sample to be tested through primer and probe combination 4 in Example 1 are invalid.

[0117] The specific application of this embodiment is as follows: a mycoplasma detection kit that can distinguish positive control contamination is used to perform real-time quantitative PCR detection on CHO cells to detect whether there is mycoplasma contamination in the CHO engineered cell line, so that corresponding measures can be taken in a timely manner to remove the contamination and improve the yield and safety of recombinant protein.

[0118] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention. <110> Federal Biotechnology (Zhuhai Hengqin) Co., Ltd. Zhuhai Federal Biomedical Co., Ltd. Zhuhai Federal Pharmaceutical Co., Ltd. <120> A positive control for mycoplasma in quantitative real-time PCR that can distinguish positive control contamination, a detection method and its application <160> 13 <170> SIPOSequenceListing 1.0 <210> 1 <211> 255 <212> DNA <213> Mycoplasma <220> <223> conservative area <400> 1 acgctttacg cccaataatt ccggataacg cttgcgacct atgtattacc gcggctgctg 60 gcacatagtt tgccgtcgct ttctaataag gtaccgtcaa gattaaatca tttcctattt 120 aattttttct ttccttataa cagcacttta catccctaaa gacttcatcg tgcacgctgt 180 gtcgctccat caagctttcg ctcattgtgg aaaattcctt actgctgcct cccgtaggag 240 tctgggccgt atctc 255 <210> 2 <211> 305 <212> DNA <213> Artificial Sequence <220> <223> Positive control <400> 2 acgctttacg cccaataatt ccggataacg cttgcgacct atgtattacc gcggctgctg 60 gcacatagtt tgccgtgaag taataacttg gactccattc actccagaag cctttaaaat 120 agtgatcgct ttctaataag gtaccgtcaa gattaaatca tttcctattt aattttttct 180 ttccttataa cagcacttta catccctaaa gacttcatcg tgcacgctgt gtcgctccat 240 caagctttcg ctcattgtgg aaaattcctt actgctgcct cccgtaggag tctgggccgt 300 atctc 305 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Myco-Forward Primer <400> 3 acgctttacg cccaataatt ccg 23 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Myco-Reversed Primer <400> 4 gagatacggc ccagactcct ac 22 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Myco-Probe <220> <222> (1)..(1) <223> FAM modification <220> <222> (27)..(27) <223> BHQ1 Modification <400> 5 cctatgtatt accgcggctg ctggcac 27 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Myco-Reversed Primer-3 <400> 6 aagcttgatg gagcgacaca 20 <210> 7 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Myco-Probe-2 <220> <222> (1)..(1) <223> FAM modification <220> <222> (24)..(24) <223> BHQ1 Modification <400> 7 tcgctttcta ataaggtacc gtca 24 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IC - Forward Primer <400> 8 ccaaagagat gcctttccag 20 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IC - Reversed Primer <400> 9 gatgcacaga agctccct 18 <210> 10 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> IC‑Probe <220> <222> (1)..(1) <223> VIC Modification <220> <222> (24)..(24) <223> BHQ1 Modification <400> 10 cagcaagaca gtcctctggc caga 24 <210> 11 <211> 2749 <212> DNA <213> Artificial Sequence <220> <223> pLPCX‑hIL‑4Ra <400> 11 gctagcgcta ccggactcag atctgctgac tagcgtttaa acttaagctt agcgcagagg 60 cttggggcag ccgagcggca gccaggcccc ggcccgggcc tcggttccag aagggagagg 120 agcccgccaa ggcgcgcaag agagcgggct gcctcgcagt ccgagccgga gagggagcgc 180 gagccgcgcc ggccccggac ggcctccgaa accatggggt ggctttgctc tgggctcctg 240 ttccctgtga gctgcctggt cctgctgcag gtggcaagct ctgggaacat gaaggtcttg 300 caggagccca cctgcgtctc cgactacatg agcatctcta cttgcgagtg gaagatgaat 360 ggtcccacca attgcagcac cgagctccgc ctgttgtacc agctggtttt tctgctctcc 420 gaagcccaca cgtgtatccc tgagaacaac ggaggcgcgg ggtgcgtgtg ccacctgctc 480 atggatgacg tggtcagtgc ggataactat acactggacc tgtgggctgg gcagcagctg 540 ctgtggaagg gctccttcaa gcccagcgag catgtgaaac ccagggcccc aggaaacctg 600 acagttcaca ccaatgtctc cgacactctg ctgctgacct ggagcaaccc gtatccccct 660 gacaattacc tgtataatca tctcacctat gcagtcaaca tttggagtga aaacgacccg 720 gcagatttca gaatctataa cgtgacctac ctagaaccct ccctccgcat cgcagccagc 780 accctgaagt ctgggatttc ctacagggca cgggtgaggg cctgggctca gtgctataac 840 accacctgga gtgagtggag ccccagcacc aagtggcaca actcctacag ggagcccttc 900 gagcagcacc tcctgctggg cgtcagcgtt tcctgcattg tcatcctggc cgtctgcctg 960 ttgtgctatg tcagcatcac caagattaag aaagaatggt gggatcagat tcccaaccca 1020 gcccgcagcc gcctcgtggc tataataatc caggatgctc aggggtcaca gtgggagaag 1080 cggtcccgag gccaggacc agccaagtgc ccacactgga agaattgtct taccaagctc 1140 ttgccctgtt ttctggagca siacatgaaa agggatgaag atcctcacaa ggctgccaaa 1200 gagatgcctt tccaggctc tggaaatca gcatggtgcc cagtggagat cagcaagaca 1260 gtcctctggc cagagagcat cagcgtggtg cgatgtgtgg agttgttga ggccccggtg 1320 gagtgtgagg aggagga ggtagaggaa gaaaaaggga gcttctgtgc atcgcctgag 1380 agcagcaggg atgacttcca ggagggagg gaggcattg tggcccggct aacagagagc 1440 ctgttcctgg acctgctcgg agaggagaat gggggctttt gccagcagga catgggggag 1500 tcatgccttc ttccaccttc gggaagtacg agtgctcaca tgccctggga tgagttccca 1560 agtgcaggggc ccaaggaggc accccctgg ggcaggagc agcctctcca cctggagcca 1620 agtcctcctg ccagcccgac ccagagtcca ccaacctga ctgcacaga gacgccccctc 1680 gtcatcgcag gcaccctgc ttaccgcagc ttcagcact ccctgagcca gtcaccgtgt 1740 cccagagagc tgggtccaga cccactgctg gccagacacc tggaggagt agaacccgag 1800 atgccctgtg tcccccagct ctctgagcca accactgtgc cccaacctga gccagaaacc 1860 tgggagcaga tcctccgccg aaatgtcctc cagcatgggg cagctgcagc ccccgtctcg 1920 gcccccacca gtggctatca ggagtttgta catgcggtgg agcagggtgg cacccaggcc 1980 agtgcggtgg tgggcttggg tcccccagga gaggctggtt acaaggcctt ctcaagcctg 2040 cttgccagca gtgctgtgtc cccagagaaa tgtgggtttg gggctagcag tggggaagag 2100 gggtataagc ctttccaaga cctcattcct ggctgccctg gggaccctgc cccagtccct 2160 gtccccttgt tcacctttgg actggacagg gagccacctc gcagtccgca gagctcacat 2220 ctcccaagca gctccccaga gcacctgggt ctggagccgg gggaaaaggt agaggacatg 2280 ccaaagcccc cacttcccca ggagcaggcc acagaccccc ttgtggacag cctgggcagt 2340 ggcattgtct actcagccct tacctgccac ctgtgcggcc acctgaaaca gtgtcatggc 2400 caggaggatg gtggccagac ccctgtcatg gccagtcctt gctgtggctg ctgctgtgga 2460 gacaggtcct cgccccctac aacccccctg agggccccag acccctctcc aggtggggtt 2520 ccactggagg ccagtctgtg tccggcctcc ctggcaccct cgggcatctc agagaagagt 2580 aaatcctcat catccttcca tcctgcccct ggcaatgctc agagctcaag ccagaccccc 2640 aaaatcgtga actttgtctc cgtgggaccc acatacatga gggtctctta gcggccgctc 2700 gagatcgata aaataaaaga ttttatatttag tctccagaaa aagggggga 2749 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> NS-Probe <220> <222> (1)..(1) <223> CY5 modification <220> <222> (27)..(27) <223> BHQ3 Modification <400> 12 acttggactc cattcactcc agaagcc 27 <210> 13 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> Irrelevant sequences <400> 13 gaagtaataa cttggactcc attcactcca gaagccttta aaatagtgat 50

Claims

1. A method for detecting Mycoplasma contamination by a distinguishable positive control for non-diagnostic and therapeutic purposes, characterized in that The process includes the following steps: adding an internal reference plasmid to the sample to be tested for mycoplasma contamination, followed by DNA extraction; performing quantitative real-time PCR on the sample to be tested using the following mycoplasma primer pairs, mycoplasma probes, primer pairs for detecting the internal reference plasmid, and probes for detecting the internal reference plasmid; and setting up a positive control group using a quantitative real-time PCR positive control as a template. Myco-Forward Primer: 5'-ACGCTTTACGCCCAATAATTCCG-3'; Myco-Reversed Primer: 5'-AAGCTTGATGGAGCGACACA-3'; Myco-Probe: 5'-FAM-TCGCTTTCTAATAAGGTACCGTCA-BHQ1-3'; IC- Forward Primer: 5'-CCAAAGAGATGCCTTTCCAG-3'; IC- Reversed Primer: 5'-GATGCACAGAAGCTCCCT-3'; IC- Probe: 5'- VIC-CAGCAAGACAGTCCTCTGGCCAGA- BHQ1-3'; The irrelevant sequence probe NS-Probe is designed specifically for irrelevant sequences; The positive control for quantitative real-time PCR is a sequence obtained by inserting an irrelevant sequence into a conserved sequence of mycoplasma, as shown in SEQ ID NO.2; The irrelevant sequence probe NS-Probe is as follows: 5'- CY5-ACTTGGACTCCATTCACTCCAGAAGCC- BHQ3-3'; The sequence of the internal reference gene in the internal reference plasmid is shown in SEQ ID NO.

11.

2. The method for detecting mycoplasma using real-time quantitative PCR that can distinguish positive control contamination for non-diagnostic and non-therapeutic purposes according to claim 1, characterized in that: The sample to be tested is the DNA of a sample that needs to be tested for mycoplasma contamination.

3. The application of the quantitative real-time PCR detection method for mycoplasma that can distinguish positive control contamination for non-diagnostic and therapeutic purposes as described in claim 1 or 2 in the biopharmaceutical industry.

4. Use of the method for the non-diagnostic and therapeutic purpose of differentiating positive control contamination of the Mycoplasma fluorescent quantitative PCR detection method according to claim 3 in the biological product industry, characterized in that: The aforementioned quantitative real-time PCR detection method for mycoplasma that can distinguish between positive control contamination is used to detect mycoplasma contamination during cell culture.

Citation Information

Patent Citations

  • Dual fluorescent quantitative PCR mycoplasma detection kit

    CN110643727A

  • Composition for determining false positives using a unique artificial nucleotide sequence and method for determining false positives using the same

    US20220025434A1