Resistance to downy mildew in spinach

Abstract

The present invention relates to an allele designated alpha-WOLF27 which confers resistance to at least one race of Peronospora farinosa, wherein the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; and b) the motif "KWMCLR"; and wherein the LRR domain of said protein has, in order of increasing preference, at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence similarity with SEQ ID NO: 10. When homozygously present in a spinach plant, said allele confers full resistance to at least the races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17 of Peronospora farinosa.

Description

TECHNICAL FIELD

[0001] The present invention relates to a gene that is capable of conferring spinach plants resistance against one or more races of Peronospora effusa. The invention further relates to a spinach plant, propagation material of said spinach plant, a cell of said spinach plant and a seed of said spinach plant carrying the gene. The invention further relates to a method of producing a spinach plant carrying the gene and the use of the gene in breeding to confer resistance against Peronospora effusa. BACKGROUND

[0003] Downy mildew (Peronospora effusa) is a major threat for spinach growers as it directly affects the harvested leaves. In spinach (Spinacia oleracea), downy mildew is caused by the oomycete Peronospora effusa (previously known as Peronospora farinosa f. sp. spinaciae). Infection makes leaves unsuitable for sale and consumption as it manifests itself phenotypically as yellow lesions on older leaves and a grey fungal growth can be observed on the back surface of the leaves. Infection can spread very rapidly and it can occur in both greenhouse and soil cultivation. The optimum temperature for sporulation and germination of P. effusa spores is 9 to 12 °C and is promoted by high relative humidity. When spores are deposited on a wet leaf surface, they can easily germinate and infect the leaf. The optimum temperature for fungal growth is 8 to 20 °C, relative humidity > 80% and hyphal growth can be observed within 6 to 13 days after infection. Oospores of P. effusa can survive in the soil for up to 3 years or exist as mycelium in seeds or living plants.

[0004] To date, 19 races of the causal agent of spinach downy mildew (Pe) have been officially identified and characterized, and many new candidates have been observed in the field. The 17 officially recognized races of P. effusa are named Pe: 1 through Pe: 19 (Pe: 1 through Pe: 17 were formerly named Pfs: 1 through Pfs: 17; Irish et al. Phytopathol. Vol. 98 pg. 894-900, 2008; Plantum NL (Dutch association for breeding, tissue culture, production and trade of seed and young plants) Press Release, “Benoeming van Pfs: 14, een nieuwe fysio van valse meeldauw in spinazie”, September 19, 2012; Report Jim Correl (Univ. Arkansas) and Steven Koike (UC Cooperative Extension, Monterey County), “Race Pfs: 14 - Another new race of the spinach downy mildew pathogen”, September 18, 2012; Plantum NL Press Release, “Denomination of Pfs: 15, a new race of downy mildew in spinach”, September 2, 2014 September 2, 2014; Plantum NL Press Release, “Denomination of Pfs: 16, a new race of downy mildew in spinach, March 15, 2016; Plantum NL Press Release, Denomination of Pfs: 17, a new race of downy mildew in spinach”, April 16, 2018; Plantum NL Press Release, “Denomination of Pe: 18 and 19, two new races of downy mildew in spinach”, April 15, 2021).

[0005] All 19 officially recognized Pe races are publicly available from the Department of Plant Pathology, University of Arkansas, Fayetteville, AR 72701, USA, and NAK Tuinbouw, Sotaweg 22, 2371 GD Roelofarendsveen, the Netherlands.

[0006] In particular, the most recently identified races of Peronospora can break the resistance of many of the currently commercially used spinach varieties worldwide, and thus they pose a serious threat to the productivity of the spinach industry. Therefore, it is of utmost importance to keep up to date with the developments in this field, as Peronospora is continuously developing the ability to break the resistance present in commercially used spinach varieties. New resistance genes against downy mildew are therefore very valuable assets and they form an important research focus in breeding, especially in spinach and lettuce breeding. One of the main goals of spinach breeders is to rapidly develop spinach varieties that are resistant to as many Peronospora races as possible, including the most recently identified races, before these races become widespread and can threaten the industry.

[0007] In commercially used spinach varieties, resistance against downy mildew is usually caused by so-called R genes. R gene-mediated resistance is based on the ability of the plant to recognize the invading pathogen. In many cases, this recognition takes place after the pathogen has established the first phase of interaction and transferred so-called avirulence (or non-virulence) factors into the plant cell. These avirulence factors interact with host components to establish conditions that are favorable for the pathogen to invade the host and thus cause disease. When the plant is able to recognize the events triggered by the avirulence factors, a resistance response can be initiated. In many different plant-pathogen interaction systems, such as the interaction of spinach with different Peronospora strains, the plant only initiates these events after specific recognition of the invading pathogen.

[0008] The co-evolution of plants and pathogens leads to an arms race in which R gene-mediated resistance is sometimes overcome, with the result that the pathogen is able to interact with alternative host targets or modify the same target in different ways, so that the recognition is lost and infection can be established successfully, resulting in disease. In order to re-establish resistance in the plant, a new R gene must be introduced that is able to recognize the mode of action of the alternative avirulence factors.

[0009] Despite the relatively low durability of R genes, R genes are still the main form of resistance against downy mildew in spinach. This is mainly because it is the only form of defense that provides absolute resistance. So far, plant breeders have been very successful in using resistance genes present in wild germplasm of crop species to produce downy mildew resistant spinach varieties. Despite the wide use of R genes in spinach breeding, so far little is known about these R genes.

[0010] It was only recently discovered that the officially recognized R gene in spinach is in fact two tightly linked genes, all different alleles of the alpha-WOLF and beta-WOLF genes. This was also the first time that an R gene, or better an R allele, was characterized at the molecular level, i.e. its nucleotide and amino acid sequence was determined. Although this provides breeders with tools to improve the efficiency of detecting and selecting R alleles, it is still crucial to respond adequately to emerging races of downy mildew for the development of commercially successful spinach varieties. It is therefore an object of the present invention to provide a new resistance allele that confers resistance to emerging isolates of downy mildew and to provide molecular biology tools for identifying this new resistance allele. SUMMARY

[0012] In research directed to the present invention, a new allelic variant of the alpha-WOLF gene described in WO2018059651 was discovered. The alpha-WOLF gene encodes a protein belonging to the CC-NBS-LRR family (Coiled Coil - Nucleotide Binding Site - Leucine Rich Repeat). Depending on the allelic variant (or allelic variants) present in a spinach plant, said plant will produce a variant of the WOLF protein that confers a certain resistance spectrum to pathogenic races of P. dispersa.

[0013] In the context of the present invention, the term "allele" or "allelic variant" is used to designate a version of a gene that is linked to a particular phenotype, i.e. a resistance spectrum. Spinach can be found to carry one or two WOLF genes. Each of these two WOLF genes comprises multiple alleles, each conferring a particular resistance spectrum. In the context of the present invention, an allele or allelic variant is a nucleic acid.

[0014] The beta WOLF gene is located on scaffold 12735 (sequence: GenBank: KQ143339.1), positions 213573-221884. If a spinach plant also carries or only carries the alpha-WOLF gene, the alpha-WOLF gene is located at approximately the same position on scaffold 12735 as the beta-WOLF gene in the Viroflay genome assembly.

[0015] The newly discovered a-WOLF alleles provide resistance to at least the Peronospora farinosa races Pe: 14, Pe: 15, and Pe: 17. DETAILED DESCRIPTION

[0017] The genome assembly of spinach variety Viroflay, which is susceptible to all known pathogenic races of P. farinosa, is publicly available (Spinacia oleracea Cultivar Syn Viroflay, Whole Genome Shotgun Sequencing Project; Bioproject: PRJNA41497; GenBank: AYZV00000000.2; BioSample: SAMN02182572, see also Dohm et al., 2014, Nature 505:546-549). In the genome assembly of Viroflay, the β-WOLF gene is located on scaffold 12735 (sequence: GenBank: KQ143339.1) at position 213573-221884. The spanned sequence includes the entire genomic sequence of the β-WOLF gene of Viroflay, plus 2000 base pairs of sequence upstream of the gene, plus sequence downstream of the gene, up to the locus of the adjacent gene located downstream of the WOLF gene. Spinach variety Viroflay has only a single WOLF gene, the β-WOLF gene, but most other spinach lines carry a single a-type WOLF gene at the same location in the genome. Other spinach lines contain two WOLF genes at roughly the same location in the genome. In this case, the two WOLF genes are adjacent to each other. In most spinach lines that contain two WOLF genes, one of the WOLF genes is of the a-type, while the other WOLF gene is of the β-type. It was observed that this allelic variation in the WOLF locus is the cause of the difference in resistance to pathogenic races of P. farinosa.

[0018] The distinction between alleles of the a-WOLF gene and alleles of the b-WOLF gene lies in the presence of specific conserved amino acid motifs in the encoded protein sequence. As mentioned above, all WOLF proteins have (from N- to C-terminus) the following domains known in the art: a coiled coil domain (RX-CC like, cd14798), a NBS domain (also known as "NB-ARC domain", pfam00931 ; van der Biezen & Jones, 1998, Curr. Biol. 8:R226-R228), and a leucine-rich repeat (LRR) domain containing (IPR032675). In addition, all WOLF proteins comprise the motif "MAEIGYSVC" (SEQ ID NO: 1) at the N-terminus of their amino acid sequence. In addition to this, all a-WOLF proteins comprise the motif "KWMCLR" (SEQ ID NO: 2) in their amino acid sequence, while all b-WOLF proteins comprise the motif "HVGCVVDR" (SEQ ID NO: 3) in their amino acid sequence.

[0019] The present application relates to an allele of an a-WOLF gene conferring new P. dispersa resistance, designated a-WOLF27.

[0020] In particular, the present application relates to an allele conferring P. dispersa resistance designated a-WOLF27, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has, in order of increasing preference, at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 10. Optionally, the a-WOLF27 allele further comprises in its amino acid sequence the additional motif "DQEDEGEDN".

[0021] The present application further relates to an allele conferring resistance to Peronospora farinosa, named a-WOLF27, wherein the protein encoded by said allele is a CC-NBS-LRR protein, the CC-NBS-LRR protein comprising in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has, in order of increasing priority, at least 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 10. Optionally, the a-WOLF27 allele further comprises in its amino acid sequence the additional motif "DQEDEGEDN".

[0022] The present application also relates to the a-WOLF27 allele having a LRR domain having, in order of increasing priority, at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity with SEQ ID NO: 9.

[0023] For the purposes of the present application, the LRR domain of the protein of the a-WOLF27 allele is defined as the amino acid sequence having, in order of increasing priority, at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity with SEQ ID NO: 10.

[0024] For the purposes of the present invention, the LRR domain of the protein of the a-WOLF27 allele is defined as an amino acid sequence having at least 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity with SEQ ID NO: 10, in order of increasing preference.

[0025] The skilled person is familiar with methods for calculating sequence identity and sequence identity. Sequence identity of amino acid sequences is calculated using EMBOSS stretcher 6.6.0 (www.ebi.ac.uk / Tools / psa / emboss_stretcher) using the EBLOSUM62 matrix with the settings gap open penalty: 12 and gap extension penalty: 2. For DNA, the DNA full matrix is used with the settings gap open penalty: 16 and gap extension penalty: 4.

[0026] The LRR domain of the a-WOLF27 allele as defined herein can be determined by amplification and sequencing of the genomic DNA encoding the amino acid sequence of the LRR domain, followed by translation of this DNA sequence into an amino acid sequence, applying common sense to select the correct reading frame. The skilled person is able to do this using freely available online bioinformatics tools (for example can be found here: http: / / web.expasy.org / translate / ).

[0027] The genomic sequence of the LRR domain of the a-WOLF gene, for example a-WOLF27, can be amplified using a primer pair having a forward primer which is a nucleic acid molecule having the sequence of SEQ ID No: 4 and a reverse primer which is a nucleic acid molecule having the sequence of SEQ ID No: 5.

[0028] The present application also relates to a nucleic acid molecule conferring resistance to at least one Peronospora farinosa race, wherein the protein encoded by said nucleic acid molecule is a CC-NBS-LRR protein, the CC-NBS-LRR protein comprising in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has, in order of increasing priority, at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 10. Optionally, the nucleic acid molecule is an isolated nucleic acid molecule.

[0029] The present application also relates to a nucleic acid molecule conferring resistance to at least one Peronospora farinosa race, wherein the protein encoded by said nucleic acid molecule is a CC-NBS-LRR protein, the CC-NBS-LRR protein comprising in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; b) the motif "KWMCLR"; and wherein the LRR domain of the protein has, in order of increasing priority, at least 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 10. Optionally, the nucleic acid molecule is an isolated nucleic acid molecule.

[0030] The PCR conditions for amplifying the LRR domain coding region of the a-WOLF gene using primers having SEQ ID NO: 4 and SEQ ID NO: 5 are, using Platinum Taq enzyme (Thermo Fisher Scientific): 3 minutes at 95°C (initial denaturation step); 40 amplification cycles, each cycle consisting of: denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, elongation at 72°C for 30 seconds; 2 minutes at 72°C (final elongation step).

[0031] The LRR domain of the b-WOLF gene, such as the null allele present in the variety Viroflay, can be amplified using a forward primer which is a nucleic acid molecule having the sequence of SEQ ID NO: 6 and a reverse primer which is a nucleic acid molecule having the sequence of SEQ ID NO: 5.

[0032] The PCR conditions for amplifying the LRR domain coding region of the beta-WOLF gene using primers having SEQ ID NO: 5 and SEQ ID NO: 6 are as follows, using Platinum Taq enzyme (Thermo Fisher Scientific): 3 minutes at 95°C (initial denaturation step); 40 amplification cycles, each cycle consisting of: denaturation at 95°C for 30 seconds, annealing at 58°C for 50 seconds, elongation at 72°C for 50 seconds; 2 minutes at 72°C (final elongation step).

[0033] The present application therefore also relates to a pair of primers for amplifying the LRR domain of the alpha-WOLF gene, more specifically for amplifying the LRR domain of the alpha-WOLF27 allele, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO: 4 and the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO: 5. The primers disclosed herein are specifically designed for the selective amplification of portions of the WOLF gene, and not of any other CC-NBS-LRR protein coding gene.

[0034] The present application relates to the alpha-WOLF27 allele having a coding sequence with at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity to SEQ ID NO: 12, in increasing order of preference.

[0035] In another aspect of the present application, the alpha-WOLF27 allele encodes a protein having an amino acid sequence with at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity to SEQ ID NO: 13, in increasing order of preference.

[0036] In another aspect of the application, the a-WOLF27 allele encodes a protein having an amino acid sequence with at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity to SEQ ID NO: 13, in order of increasing preference.

[0037] When present in a spinach plant, the a-WOLF27 allele confers complete resistance to at least one of the 19 officially recognized P. dispersa races. In other embodiments, when present in a spinach plant, the a-WOLF27 allele confers complete resistance to at least two of the 19 officially recognized P. dispersa races. In other embodiments, when present in a spinach plant, the a-WOLF27 allele confers complete resistance to at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, or seventeen of the 19 officially recognized P. dispersa races, in order of increasing preference.

[0038] When homozygously present in a spinach plant, the a-WOLF27 allele confers complete resistance to at least the officially recognized P. dispersa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17. More particularly, when homozygously present in a spinach plant, the a-WOLF27 allele confers complete resistance to at least the officially recognized P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17 (see Table 1). When homozygously present in a spinach plant, the a-WOLF27 allele also confers complete resistance to at least the officially recognized P. dispersa races Pe:16 and Pe:18. Furthermore, when homozygously present in a spinach plant, the a-WOLF27 allele confers moderate resistance to the P. dispersa race Pfs:10.

[0039] The resistance of a spinach plant to one or more races of P. dispersa can be determined by using a seedling test. In this context, a seedling test is defined as a test in which a spinach plant is planted in a tray containing a growth medium, and is fertilized twice a week after the seedlings have emerged. At the first true leaf stage, the plants are sprayed with a concentration of about 2.5 x 10 5Plants are inoculated with 10,000 spores / ml of a sporangia suspension of the test P. effusa or race of the isolated strain. Thirty plants are tested per race. Inoculated plants are placed in a dew room at 18°C, 100% relative humidity for 24 hours, then moved to a growth room at 18°C, 12 hour photoperiod for 6 days. After 6 days, plants are returned to the dew room for 24 hours to induce sporulation, and then scored for disease response.

[0040] As used herein, a plant has complete resistance to a race of P. effusa when the plant does not exhibit symptoms in the seedling test described herein.

[0041] As used herein, a plant has intermediate resistance to a race of P. effusa when the plant exhibits only chlorosis symptoms or sporulation occurs only at the tips of the cotyledons in the seedling test described herein.

[0042] As used herein, a plant is susceptible to an isolate of P. effusa when the plant exhibits not only chlorosis symptoms in the seedling test described herein, or when sporulation occurs in areas greater than just the tips of the cotyledons.

[0043] Another aspect of the application relates to a spinach plant comprising the alpha- WOLF27 allele of the application, a representative sample of the seeds of which was deposited under accession number NCIMB 43668 at the NCIMB.

[0044] In another embodiment, the plant of the application comprising the alpha- WOLF27 allele is an agronomically elite spinach plant. In the context of the present application, an agronomically elite spinach plant is a plant having a genotype that results in the accumulation of distinguishable and desirable agronomic traits that allow the producer to harvest a product of commercial interest, preferably the agronomically elite spinach plant comprising the alpha- WOLF27 allele is a plant of an inbred line or hybrid.

[0045] As used herein, a plant of an inbred line is a plant of a population of plants resulting from three or more rounds of selfing or backcrossing; or the plant is a double haploid. The inbred line can for example be a maternal line used to produce a commercial hybrid.

[0046] As used herein, a plant of a hybrid is a plant resulting from a cross between two different plants of different genotypes. More particularly, a plant of a hybrid is the result of a cross between two different plants of inbred lines, such a plant of a hybrid can for example be a plant of an Fl hybrid variety.

[0047] Plants carrying the alpha-WOLF27 allele in heterozygous form can further comprise a beta-WOLF0 allele, for example as present in the variety Viroflay, wherein the beta-WOLF0 allele does not confer any resistance to downy mildew. However, plants that are heterozygous for the alpha-WOLF27 allele can also comprise an allele of the alpha / beta-WOLF gene that does provide resistance to downy mildew. Preferably, such allele will complement the alpha-WOLF27 allele such that the spinach plant will have at least moderate resistance to one or more other races for which the alpha-WOLF27 allele does not provide resistance. Most preferably, the other allele of the alpha / beta-WOLF gene complements the alpha-WOLF27 allele such that the plant is resistant to the races of Peronospora farinosa Pe:1 to Pe:19. In one embodiment, such plant is an agronomically elite plant.

[0048] Alternatively, the resistance spectrum of plants carrying the alpha-WOLF27 allele is complemented by resistance conferring alleles of a completely different gene. Examples of such genes are DMR1 as described in US 8,354,570, DMR6 as described in US 9,121,029 and plO as described in US 10,226,016.

[0049] Thus, the present invention relates to a spinach plant carrying the alpha-WOLF27 allele and further comprising a genetic determinant that results in resistance against the races of Peronospora farinosa Pe:1 to Pe:19. The genetic determinant can be a resistance conferring alpha / beta-WOLF allele, or a resistance conferring allele of a completely different gene.

[0050] The present invention further relates to propagation material comprising the alpha-WOLF27 allele. In one embodiment, the propagation material is suitable for sexual reproduction. Such propagation material includes, for example, microspores, pollen, ovaries, ovules, embryo sacs and egg cells. In another embodiment, the propagation material is suitable for vegetative reproduction. Such propagation material includes, for example, cuttings, roots, stems, cells, protoplasts and tissue cultures of regenerable cells. Plant parts suitable for making tissue cultures are in particular leaves, pollen, embryos, cotyledons, hypocotyls, meristems, root tips, anthers, flowers, seeds and stems.

[0051] The present invention also relates to a cell of a spinach plant comprising the alpha-WOLF27 allele. Such cell can be in isolated form, or can be part of a whole plant or part thereof and then still constitutes a cell of the present invention as such cell contains the alpha-WOLF27 allele that confers resistance to downy mildew. Each cell of a plant of the present invention carries the genetic information that confers resistance to downy mildew. Such cell of the present invention can also be a regenerable cell, which can be used to regenerate a new plant comprising the allele of the present invention.

[0052] Another aspect of the application relates to a method of making a hybrid spinach seed, comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first and / or second parent spinach plant comprises an a-WOLF27 allele. In a particular embodiment, the first and / or second parent plant is a plant of an inbred line as defined herein.

[0053] The application further relates to a hybrid spinach plant grown from a seed produced by crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seed, wherein the first and / or second parent spinach plant comprises an a-WOLF27 allele.

[0054] The genomic DNA or coding DNA sequence of at least part of a WOLF gene in a spinach plant genome can be determined using any suitable molecular biology method known in the art, including but not limited to (genomic) PCR amplification followed by Sanger sequencing, whole genome sequencing, transcriptome sequencing, sequence-specific target capture followed by next generation sequencing (e.g. using the Target Capture System of Integrated DNA Technologies), specific amplification of gene sequences comprising LRR domains (e.g. using the RenSeq method as described in US patent application 14 / 627116 and Jupe et al., 2013, Plant J. 76:530-544) followed by sequencing, etc. The genomic DNA or coding DNA sequence of at least part of a WOLF gene in a spinach plant genome can be determined using any suitable molecular biology method known in the art, including but not limited to (genomic) PCR amplification followed by Sanger sequencing, whole genome sequencing, transcriptome sequencing, sequence-specific target capture followed by next generation sequencing (e.g. using the Target Capture System of Integrated DNA Technologies), specific amplification of gene sequences comprising LRR domains (e.g. using the RenSeq method as described in US patent application 14 / 627116 and Jupe et al., 2013, Plant J. 76:530-544) followed by sequencing, etc.

[0055] In one embodiment, the application relates to a method of identifying a plant carrying an a-WOLF27 allele, comprising determining a DNA sequence encoding a LRR domain as defined herein.

[0056] In another embodiment of the method, the LRR domain of the a-WOLF27 allele is determined by amplifying the genomic DNA region of the LRR domain using a primer pair. The forward primer is preferably a nucleic acid molecule having the sequence of SEQ ID NO: 4, and the reverse primer is preferably a nucleic acid molecule having the sequence of SEQ ID NO: 5.

[0057] Another aspect of the application relates to a method of producing a spinach plant comprising resistance to P. dispersa, comprising: (a) crossing a plant comprising an a-WOLF27 allele with another plant; (b) optionally performing one or more rounds of selfing and / or crossing; (c) optionally selecting a plant comprising an a-WOLF27 allele after each round of selfing or crossing.

[0058] A plant comprising the a-WOLF27 allele can be selected by determining the presence of the DNA sequence of the NBS-LRR domain of the allele with 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 100% sequence identity to SEQ ID NO: 9 in increasing order of preference.

[0059] In another embodiment, a plant comprising the a-WOLF27 allele can be selected by determining the presence of the coding sequence of the entire allele.

[0060] Alternatively, the presence of the a-WOLF27 allele can be determined phenotypically by assaying the plant in a disease test, for example a test described herein.

[0061] The present application also relates to a spinach plant comprising the a-WOLF27 allele of the present application.

[0062] The present application also relates to a breeding method for breeding a spinach plant comprising the a-WOLF27 allele of the present application, wherein a germplasm comprising said allele is used. Seeds capable of growing into plants comprising the allele of the present application and representing the germplasm are deposited at the NCIMB under accession number NCIMB 43668.

[0063] In another aspect, the present application relates to a method of producing a spinach plant comprising the a-WOLF27 allele, the method comprising: (a) crossing a plant comprising the allele with another plant; (b) optionally selecting in the Fl a plant comprising said allele; (c) optionally backcrossing the resulting Fl with the preferred parent and selecting in the BC1F1 a plant having said allele; (d) optionally performing one or more further rounds of selfing, crossing and / or backcrossing and subsequently selecting a plant comprising said allele or showing a resistance profile corresponding to said allele. The present application also includes a spinach plant produced by this method.

[0064] The present application also relates to a harvested leaf of a spinach plant of the present application, to a food product comprising a harvested leaf of a spinach plant of the present application, in natural or processed form.

[0065] Spinach leaves are sold in a packaged form, including but not limited to pre-packaged spinach leaves or processed into a salad comprising the leaves. Such packaging is for example prepared as described in US Patent No. 5,523,136, which provides packaging films and packages made from such packaging films, including such packages containing leafy products, and methods of making and using such packaging films and packages, which are suitable for the spinach leaves of the present application. Thus, the present application includes the use and methods of making and using the leaves of the spinach plants of the present application and the leaves derived from the spinach plants of the present application.

[0066] The present application further relates to a container comprising one or more plants of the present application, or one or more spinach plants derived from the plants of the present application, for harvesting leaves from the plants in a domestic environment in a growth substrate. In this way, the consumer can pick very fresh leaves for a salad when the plants are in a state ready for harvesting.

[0067] The present application also relates to the use of a spinach plant in the production of a spinach plant comprising the a-WOLF27 allele, representative seed of which is deposited with the NCIMB under accession number NCIMB 43668.

[0068] In another embodiment, the spinach plant is a hybrid, a doubled haploid or an inbred spinach plant.

[0069] The spinach plant of the present application can comprise the a-WOLF27 allele heterozygously or homozygously.

[0070] Another aspect of the present application is the use of a cell comprising the a-WOLF27 allele in the production of a spinach plant showing resistance to P. nicotianae.

[0071] The present invention relates to an allele named a-WOLF27 which, when homozygously present in a spinach plant, confers full resistance to at least the P. dispersa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17. In particular, the a-WOLF27 allele, when homozygously present in a spinach plant, confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17. More particularly, the a-WOLF27 allele, when homozygously present in a spinach plant, confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to the P. dispersa race Pe:10. In all three cases, the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) the motif "KWMCLR"; and wherein the LRR domain of said protein has in increasing order of preference at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity with SEQ ID NO: 10.

[0072] The present application also relates to an allele designated a-WOLF27 which when homozygously present in a spinach plant confers full resistance to at least the P. dispersa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to race Pe:10; wherein the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) the motif "MAEIGYSVC" at its N-terminus; and b) the motif "KWMCLR"; and wherein the LRR domain of said protein has in order of increasing preference at least 99.5% sequence identity with SEQ ID NO: 10.

[0073] The present application also relates to an allele designated a-WOLF27 which when homozygously present in a spinach plant confers full resistance to at least the P. dispersa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to race Pe:10; wherein the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) the motif "KWMCLR"; and wherein the LRR domain of said protein has in order of increasing preference at least 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity with SEQ ID NO: 10 and wherein the DNA sequence of the LRR domain has in order of increasing preference at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 9.

[0074] The present application also relates to an allele designated a-WOLF27 which when homozygously present in a spinach plant confers full resistance to at least the P. dispersa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to race Pe:10; wherein the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) the motif "KWMCLR"; and wherein the DNA sequence of the LRR domain has in order of increasing preference at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 9.

[0075] The present application also relates to a spinach plant comprising an allele designated a-WOLF 27, which when homozygously present in a spinach plant confers full resistance to at least the P. effusa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17. In particular, the a-WOLF 27 allele when homozygously present in a spinach plant confers full resistance to at least the P. effusa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17. More particularly, the a-WOLF 27 allele when homozygously present in a spinach plant confers full resistance to at least the P. effusa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to the P. effusa race Pe:10. In all three cases the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) the motif "KWMCLR"; and wherein the LRR domain of said protein has in increasing order of preference at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 10. Preferably, such spinach plant is an agronomically elite spinach plant.

[0076] The present application also relates to a spinach plant comprising an allele designated a-WOLF27 which, when homozygously present in a spinach plant, confers full resistance to at least the P. dispersa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to race Pe:10; wherein the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) the motif "KWMCLR"; and wherein the LRR domain of said protein has in order of increasing preference at least 99.8% sequence identity with SEQ ID NO: 10. Preferably, the spinach plant is an agronomically elite spinach plant.

[0077] The present application also relates to a spinach plant comprising an allele designated a-WOLF27 which, when homozygously present in a spinach plant, confers full resistance to at least the P. dispersa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to race Pe:10; wherein the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) the motif "KWMCLR"; and wherein the LRR domain of said protein has in order of increasing preference at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 10 and wherein the DNA sequence of the LRR domain has in order of increasing preference at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 9. Preferably, such spinach plant is an agronomically elite spinach plant.

[0078] The present application also relates to a spinach plant comprising an allele designated a-WOLF 27 which when homozygously present in a spinach plant confers full resistance to at least the P. dispersa races Pe:7, Pe:8, Pe:9, Pe:1 1, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:1 1, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17; or confers full resistance to at least the P. dispersa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:1 1, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17 and Pe:18 and intermediate resistance to race Pe:10, wherein the protein encoded by said allele is a CC-NBS-LRR protein which comprises in its amino acid sequence: a) at its N-terminus the motif "MAEIGYSVC"; and b) the motif "KWMCLR"; and wherein the DNA sequence of the LRR domain has in order of increasing preference at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity with SEQ ID NO: 9. Preferably, such spinach plant is an agronomically elite spinach plant.

[0079] The present application is further described by the following numbered paragraphs:

[0080] 1. An agronomically elite Spinacia oleracea plant comprising an allele that, when present in a Spinacia oleracea plant, confers resistance to at least one race of Peronospora farinosa and encodes a protein having, in order of increasing preference, at least 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to a protein comprising the amino acid sequence of SEQ ID NO: 13; wherein the protein comprises, in order of increasing preference, a) SEQ ID NO: 1, b) SEQ ID NO: 2, and wherein the LRR domain of the protein has, in order of increasing preference, at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to SEQ ID NO: 10.

[0081] 2. The agronomically elite Spinacia oleracea plant of paragraph 1, wherein the allele encodes a protein that confers full resistance to at least Peronospora farinosa races Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17 when present homozygously in a Spinacia oleracea plant.

[0082] 3. The agronomically elite Spinacia oleracea plant of paragraph 1, wherein the allele encodes a protein that confers full resistance to at least Peronospora farinosa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:17 when present homozygously in a Spinacia oleracea plant.

[0083] 4. The agronomically elite Spinacia oleracea plant of paragraph 1, wherein the allele encodes a protein that confers full resistance to at least Peronospora farinosa races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:11, Pe:12, Pe:13, Pe:14, Pe:15, Pe:16, Pe:17, Pe:18 and confers moderate resistance to at least Peronospora farinosa race Pe:10 when present homozygously in a Spinacia oleracea plant.

[0084] 5. An agronomically elite Spinacia oleracea plant comprising an allele that, when present homozygously in a Spinacia oleracea plant, encodes complete resistance to at least Peronospora farinosa f. sp. Pe: 1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe: 11, Pe: 12, Pe: 13, Pe: 14, Pe: 15, Pe: 17, wherein the nucleotide sequence of the allele has, in order of increasing preference, at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to SEQ ID NO: 12.

[0085] 6. The agronomically elite Spinacia oleracea plant of any one of paragraphs 1 to 5, wherein a representative sample of seed capable of growing into a plant comprising said allele is deposited with the NCIMB under accession number NCIMB 43668.

[0086] 7. The agronomically elite Spinacia oleracea plant of any one of paragraphs 1 to 6, wherein the agronomically elite Spinacia oleracea is a plant of a hybrid variety or a plant of an inbred line.

[0087] 8. A propagating material capable of developing into the agronomically elite Spinacia oleracea plant of any one of paragraphs 1 to 7, and wherein the propagating material comprises a microspore, pollen, an ovary, an ovule, an embryo, an embryo sac, an egg cell, a cutting, a root tip, a hypocotyl, a cotyledon, a stem, a leaf, a flower, an anther, a seed, a meristematic cell, a protoplast, a cell, or a tissue culture thereof.

[0088] 9. A cell of the agronomically elite Spinacia oleracea plant of any one of paragraphs 1 to 7.

[0089] 10. A method of producing F1 hybrid Spinacia oleracea seed comprising crossing a first parent Spinacia oleracea plant with a second parent Spinacia oleracea plant and harvesting the resulting hybrid Spinacia oleracea seed, wherein the first parent Spinacia oleracea plant and / or the second parent Spinacia oleracea plant is the agronomically elite Spinacia oleracea plant of any one of paragraphs 1 to 7.

[0090] 11. The method of paragraph 10, wherein the first and / or second parent plant is a plant of an inbred line.

[0091] 12. An Fl hybrid spinach plant grown from seed produced by the method of paragraph 10 or 11, wherein the Fl hybrid plant carries an allele that, when present in a spinach plant, confers resistance to at least one race of Peronospora farinosa and encodes a CC-NBS-LRR protein having, in increasing order of preference, at least 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to a protein comprising the amino acid sequence of SEQ ID NO: 13; wherein the protein comprises, in increasing order of preference, in its amino acid sequence: (a) SEQ ID NO: 1, (b) SEQ ID NO: 2, and wherein the LRR domain of the protein has, in increasing order of preference, at least 95%, 95.3%, 95.5%, 95.8%, 96%, 96.3%, 96.5%, 96.8%, 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to SEQ ID NO: 10.

[0092] 13. A method of producing a spinach plant that exhibits resistance to Peronospora farinosa comprising: (a) crossing an agronomically elite spinach plant of any one of paragraphs 1 to 7 with another spinach plant; (b) optionally performing one or more rounds of selfing and / or crossing; (c) optionally selecting a plant comprising the allele after the cross or one or more rounds of selfing and / or crossing.

[0093] 14. The method of paragraph 13, wherein the method comprises performing an optional selection and the selection of plants comprising the allele expressing the protein comprises determining the presence of the allele according to a method comprising any one or more of: determining the presence of a genomic nucleotide sequence in the plant genome, wherein the sequence has at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity to SEQ ID NO: 11 in increasing order of preference, or determining the presence of a nucleotide sequence in the plant, wherein the sequence has at least 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to SEQ ID NO: 12 in increasing order of preference, or determining the presence of a LRR domain having at least 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to SEQ ID NO: 9 in increasing order of preference.

[0094] 15. The method of paragraph 13 or 14, wherein the method comprises performing one or more optional rounds of selfing and / or crossing and optional selection and the selection of plants comprising the allele expressing the protein comprises determining the presence of the allele according to a method comprising any one or more of: determining the presence of a genomic nucleotide sequence in the plant genome, wherein the sequence has at least 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 100% sequence identity to SEQ ID NO: 11 in increasing order of preference, or determining the presence of a nucleotide sequence in the plant, wherein the sequence has at least 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to SEQ ID NO: 12 in increasing order of preference, or determining the presence of a LRR domain having 97%, 97.3%, 97.5%, 97.8%, 98%, 98.3%, 98.5%, 98.8%, 99%, 99.3%, 99.5%, 99.8%, 100% sequence identity to SEQ ID NO: 9 in increasing order of preference.

[0095] 16. A method for producing F1 hybrid spinach seeds, comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seeds, wherein the first parent spinach plant and / or the second parent spinach plant are agronomically superior spinach plants as described in any of paragraphs 1 to 7.

[0096] Resistance information

[0097] Table 1

[0098] The resistance spectrum conferred by the α-WOLF27 allele when homozygous in spinach plants. "-" indicates complete resistance to a specific downy mildew race; "(-)" indicates moderate resistance to a specific downy mildew race; "+" indicates that the allele does not confer resistance and will result in complete susceptibility to a specific downy mildew race in plants carrying only the α-WOLF27 allele; "nt" indicates that the isolate has not been tested.

[0099]

[0100] Preservation Information

[0101] Seeds of plants containing the α-WOLF27 allele of the present invention in their genome were deposited on October 9, 2020, at NCIMB Ltd (National Centre for Industrial, Food and Marine Microbiology Depository), Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, UK, under accession number NCIMB 43668. This deposit was made in accordance with the terms of the Budapest Treaty. Upon patent grant, all restrictions on the deposit will be lifted, and the deposit is intended to meet the requirements of 37 CFR § 1.801-1.809. Upon patent grant, the deposit will be irrevocably and unrestrictedly or unconditionally published to the public. The deposit will remain with the depository for 30 years, or 5 years after the last request, or the term of the patent, whichever is longer, and will be replaced as necessary during this period.

[0102] Sequence information

[0103] Table 2. Sequence information.

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113] The application will be further clarified by the following examples which are intended to be purely exemplary and not limiting of the application. Example

[0114] Example 1

[0115] Testing spinach plants for resistance to P. effusa

[0116] Resistance to downy mildew infection was determined as described by Irish et al. (2008; Phytopathol. 98: 894-900) using a differential set. Spinach plants of the application were sown in trays containing Scotts Redi-Earth medium together with spinach plants from different other genotypes (see Table 3) and were fertilized with Osmocote Peter's (13-13-13) fertilizer (Scotts) twice a week after the emergence of the seedlings. Plants were inoculated at the first true leaf stage with sporangia suspension (2.5 x 10 5 / ml) of the P. effusa pathotype. In this way, 4 officially recognized pathotypes were tested.

[0117] Inoculated plants were placed in a glasshouse at 18°C, 100% relative humidity for 24 hours and then moved to a growth room at 18°C, 12 hour photoperiod for 6 days. After 6 days, plants were returned to the glasshouse for 24 hours to induce sporulation and disease reactions were scored.

[0118] Plants for this particular test were scored as resistant, moderately resistant, or susceptible based on symptoms of blight and signs of pathogen sporulation on cotyledons and true leaves as described by Irish et al. (2007; Plant Dis. 91 : 1392-1396). Plants showing no signs of blight and sporulation were considered resistant in this particular test. Resistant plants were re-inoculated to assess whether plants initially scored as resistant had escaped infection or whether they were truly resistant. Plants showing only symptoms of blight or sporulation only at the tips of the cotyledons were scored as moderately resistant. Plants showing more than these symptoms of downy mildew infection were scored as susceptible.

[0119] Table 1 shows the resistance of plants carrying the a-WOLF27 allele to each of these pathogenic races. Table 3 shows the differential set of P. farinosa races and the resistance of various spinach varieties (hybrids) to each of these pathogenic races. A susceptible response is noted as "+" (indicating successful infection by the fungus with sporulation occurring on the entire cotyledon) and resistance is noted as "- " (no sporulation on the cotyledon). A moderately resistant response is indicated with "(-)", which in practice means a low level of infection (only symptoms of blight in the differential seedling test, or sporulation only at the tips of the cotyledons).

[0120] Table 3:

[0121]

[0122] Example 2

[0123] Amplification of the LRR domain coding region

[0124] Isolated genomic DNA of a spinach plant comprising the a-WOLF27 allele (a representative sample of its seeds was deposited with the NCIMB under Accession No. NCIMB 43668) was used in a polymerase chain reaction (PCR) using the forward primer ACAAGTGGATGTGTCTTAGG (SEQ ID NO: 4) and the reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 5). The primer pair amplifies the LRR domain coding region of the a-WOLF gene and was designed to selectively amplify part of the WOLF gene, but not other CC-NBS-LRR protein encoding genes.

[0125] The PCR conditions to amplify the LRR domain coding region of the a-WOLF gene using primers with SEQ ID NO: 4 and SEQ ID NO: 5 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0126] - 3 minutes at 95°C (initial denaturation step)

[0127] - 40 amplification cycles, each cycle consisting of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and elongation at 72°C for 30 seconds

[0128] - 2 minutes at 72°C (final elongation step)

[0129] Isolated genomic DNA of the variety Viroflay spinach plant comprising the beta-WOLF 0 allele was used for a polymerase chain reaction (PCR) using the forward primer TCACGTGGGTTGTGTTGT (SEQ ID NO: 6) and the reverse primer TTCGCCCTCATCTTCCTGG (SEQ ID NO: 5). The primer pair amplifies the LRR domain coding region of the beta-WOLF gene and was designed for selective amplification of the WOLF gene, but not parts of other CC-NBS-LRR protein encoding genes.

[0130] The PCR conditions for amplification of the LRR domain coding region of the beta-WOLF gene using primers with SEQ ID NO: 5 and SEQ ID NO: 6 were as follows, using Platinum Taq enzyme (Thermo Fisher Scientific):

[0131] - 3 minutes at 95°C (initial denaturation step)

[0132] - 40 amplification cycles, each cycle consisting of denaturation at 95°C for 30 seconds, annealing at 58°C for 50 seconds, and elongation at 72°C for 50 seconds

[0133] - 2 minutes at 72°C (final elongation step)

[0134] The PCR products were visualized on an agarose gel (not shown) and the DNA was purified from the PCR reaction. Subsequently the sequence of the PCR products was determined using methods well known in the art.

[0135] The DNA sequence of the LRR domain of the alpha-WOLF 27 allele amplified from primers with SEQ ID NO: 4 and SEQ ID NO: 5 is provided in Table 2 as SEQ ID NO: 9.

[0136] The DNA sequence of the LRR domain of the beta-WOLF 0 allele amplified from primers with SEQ ID NO: 5 and SEQ ID NO: 6 is provided in Table 2 as SEQ ID NO: 7.

[0137] Finally, the obtained sequences were translated into the corresponding amino acid sequences of the LRR domain, SEQ ID NO: 10 and SEQ ID NO: 8 for the a-WOLF 27 allele and the b-WOLF 0, respectively (see also Table 2).

[0138] If the PCR products are sequenced using SMRT sequencing (Pacific Biosciences), the PCR primers and PCR conditions are different.

[0139] To the above forward primer the following standard amplification sequence was added: GCAGTCGAACATGTAGCTGACTCAGGTCAC.

[0140] To the reverse primer the following standard amplification sequence was added: TGGATCACTTGTGCAAGCATCACATCGTAG.

[0141] Example 3

[0142] Introduction of the a-WOLF 27 allele in plants not carrying the allele

[0143] Spinacia plants comprising the a-WOLF 27 allele, a representative sample of seeds of which was deposited at the NCIMB under accession number NCIMB 43668, were crossed with plants of the variety Viroflay carrying the b-WOLF 0 allele to obtain the F1 generation. Subsequently, the F1 plants were selfed to obtain the F2 population.

[0144] Plants of the F2 population were tested for resistance to the downy mildews Pe: 14, Pe: 15 and Pe: 17 as described in Example 1.

[0145] Genomic DNA of each plant of the same F2 population was isolated and used for two different polymerase chain reactions (PCR). The first PCR reaction was performed using primers for amplification of the LRR domain of the a-WOLF allele and the second PCR reaction was performed using primers for amplification of the LRR domain of the b-WOLF allele, both as described in Example 2.

[0146] The PCR products were visualized on an agarose gel (not shown), which indicated that approximately 75% of the plants contained the a-WOLF fragment, while the remaining approximately 25% of the plants contained only the b-WOLF fragment. Plants containing only the b-WOLF fragment were completely correlated with plants that were scored as susceptible to Pe: 14, Pe: 15 and Pe: 17.

[0147] DNA from the PCR reactions was purified and the sequence of the PCR products was subsequently determined. The a-WOLF PCR product produced a sequence corresponding to the sequence of SEQ ID NO: 9, the genomic sequence of the LRR domain of the a-WOLF 27 allele. The b-WOLF PCR product produced a sequence corresponding to the sequence of SEQ ID NO: 7, the genomic sequence of the LRR domain of the b-WOLF 0 allele. SEQUENCE LISTING <110> REXON SEED GROUP, INC. <120> Downy mildew resistance in spinach <130> L / P171535PC01 / JED <140> <141> 2021-11-01 <160> 16 <170> BiSSAP 1.3.6 <210> 1 <211> 9 <212> PRT <213> Spinacia oleracea <220> <223> Motif <400> 1 Met Ala Glu lie Gly Tyr Ser Val Cys 1 5 <210> 2 <211> 6 <212> PRT <213> Spinacia oleracea <220> <223> Motif <400> 2 Lys Trp Met Cys Leu Arg 1 5 <210> 3 <211> 8 <212> PRT <213> Spinacia oleracea <220> <223> Motif <400> 3 His Val Gly Cys Val Val Asp Arg 1 5 <210> 4 <211> 20 <212> DNA <213> Spinacia oleracea <220> <223> Forward primer LRR domain (alpha) <400> 4 acaagtggat gtgtcttagg 20 <210> 5 <211> 19 <212> DNA <213> Spinacia oleracea <220> <223> Reverse primer LRR domain (alpha) <400> 5 ttcgccctca tcttcctgg 19 <210> 6 <211> 18 <212> DNA <213> Spinacia oleracea <220> <223> Forward primer LRR domain (beta) <400> 6 tcacgtgggt tgtgttgt 18 <210> 7 <211> 1597 <212> DNA <213> Spinacia oleracea <220> <223> Amplicon of LRR domain of beta-WOLF 0 allele (Viroflay) <400> 7 tcacgtgggt tgtgttgtcg atagagatcc agaaatagtc tttttatgta gcaataagat 60 tcgttcgtat attagcggtc gctgcataaa gaatccggtg gattcacaaa tagacaactg 120 gatgtgcctt agggtgttgg acttgtcaga ttcatgtgtt aaagatttgt ctgattcaat 180 aggtaagctg ctgcacttaa ggtatcttaa cctctcttct aatataaagt tggagataat 240 ccctgatgca attacaagac tgcataactt gcagacacta cttttagaag attgcagaag 300 tttaaaggag ttgccaaaag atttttgcaa attggtcaaa ctgaggcact tggaattaca 360 gggttgtcat gatttgattg gtatgtcatt tggaatggat aagctaacta gtcttagaat 420 actaccaaac attgtggtgg gtaggaagga acaaagtgtt gatgatgagc tgaaagccct 480 aaaaggcctc accgagataa aaggctccat tgatatcaca atctattcaa aatatagaag 540 agttgaaggc atgaatggca caggaggagg agctgggtat ttgaagagca tgaaacatct 600 cacgggggtt aatattacat ttgatgaagg tggatgtgtt aaccctgaag ctgtgtattt 660 gaagagcatg aaacatctca cgagggttat tattatattt gattataaag gtggatgtgt 720 taaccctgaa gctgtgttgg caaccctaga gccaccttca aatatcaaga ggttagagat 780 gtggcattac agtggtacaa caattccagt atggggaaga gcagagatta attgggcaat 840 ctccctctca catcttgtcg acatcacgct tgaagattgt tacaatttgc aggagatgcc 900 agtgctgagt aaactgcctc atttgaaatc actggaactt acagagttgg ataacttaga 960 gtacatggag agtagaagca gcagcagtag cagtgacaca gaagcagcaa caccagaatt 1020 accaacattc ttcccttccc ttgaaaaact tacactttgg cgtctggaca agttgaaggg 1080 ttttgggaac aggagatcga gtagttttcc ccgcctctct aaattggaaa tctggaaatg 1140 tccagatcta acgtcatttc cttcttgtcc aagccttgaa gagttggaat tgaaagaaaa 1200 caatgaagcg ttgcaaataa tagtaaaaat aacaacaaca agaggtaaag aagaaaaaga 1260 agaagacaag aatgctggtg ttggaaattc acaagatgat gacaatgtca aattatggaa 1320 ggtggaaata gacaatctgg gttatctcaa atcactgccc acaaattgtc tgactcacct 1380 cgaccttaca ataagtgatt ccaaggaggg ggagggtgaa tgggaagttg gggatgcatt 1440 tcagaagtgt gtatcttctt tgagaagcct caccataatc ggaaatcacg gaataaataa 1500 agtgaagaga ctgtctggaa gaacagggtt ggagcatttc actctgttgg aatcactcaa 1560 actttcagat atagaagacc aggaagatga gggcgaa 1597 <210> 8 <211> 532 <212> PRT <213> Spinacia <220> <223> Amino acid sequence encoded by the amplicon of the LRR domain of βWolf 0 (Viroflay) <400> 8 His Val Gly Cys Val Val Asp Arg Asp Pro Glu Ile Val Phe Leu Cys 1 5 10 15 Ser Asn Lys Ile Arg Ser Tyr Ile Ser Gly Arg Cys Ile Lys Asn Pro 20 25 30 Val Asp Ser Gln Ile Asp Asn Trp Met Cys Leu Arg Val Leu Asp Leu 35 40 45 Ser Asp Ser Cys Val Lys Asp Leu Ser Asp Ser Ile Gly Lys Leu Leu 50 55 60 His Leu Arg Tyr Leu Asn Leu Ser Ser Asn Ile Lys Leu Glu Ile Ile 65 70 75 80 Pro Asp Ala Ile Thr Arg Leu His Asn Leu Gln Thr Leu Leu Leu Glu 85 90 95 Asp Cys Arg Ser Leu Lys Glu Leu Pro Lys Asp Phe Cys Lys Leu Val 100 105 110 Lys Leu Arg His Leu Glu Leu Gln Gly Cys His Asp Leu Ile Gly Met 115 120 125 Ser Phe Gly Met Asp Lys Leu Thr Ser Leu Arg Ile Leu Pro Asn Ile 130 135 140 Val Val Gly Arg Lys Glu Gin Ser Val Asp Asp Glu Leu Lys Ala Leu 145 150 155 160 Lys Gly Leu Thr Glu lie Lys Gly Ser lie Asp lie Thr lie Tyr Ser 165 170 175 Lys Tyr Arg Arg Val Glu Gly Met Asn Gly Thr Gly Gly Gly Ala Gly 180 185 190 Tyr Leu Lys Ser Met Lys His Leu Thr Gly Val Asn lie Thr Phe Asp 195 200 205 Glu Gly Gly Cys Val Asn Pro Glu Ala Val Tyr Leu Lys Ser Met Lys 210 215 220 His Leu Thr Arg Val lie lie lie Phe Asp Tyr Lys Gly Gly Cys Val 225 230 235 240 Asn Pro Glu Ala Val Leu Ala Thr Leu Glu Pro Pro Ser Asn lie Lys 245 250 255 Arg Leu Glu Met Trp His Tyr Ser Gly Thr Thr lie Pro Val Trp Gly 260 265 270 Arg Ala Glu lie Asn Trp Ala lie Ser Leu Ser His Leu Val Asp lie 275 280 285 Thr Leu Glu Asp Cys Tyr Asn Leu Gln Glu Met Pro Val Leu Ser Lys 290 295 300 Leu Pro His Leu Lys Ser Leu Glu Leu Thr Glu Leu Asp Asn Leu Glu 305 310 315 320 Tyr Met Glu Ser Arg Ser Ser Ser Ser Ser Ser Asp Thr Glu Ala Ala 325 330 335 Thr Pro Glu Leu Pro Thr Phe Phe Pro Ser Leu Glu Lys Leu Thr Leu 340 345 350 Trp Arg Leu Asp Lys Leu Lys Gly Phe Gly Asn Arg Arg Ser Ser Ser 355 360 365 Phe Pro Arg Leu Ser Lys Leu Glu Ile Trp Lys Cys Pro Asp Leu Thr 370 375 380 Ser Phe Pro Ser Cys Pro Ser Leu Glu Glu Leu Glu Leu Lys Glu Asn 385 390 395 400 Asn Glu Ala Leu Gln Ile Ile Val Lys Ile Thr Thr Thr Arg Gly Lys 405 410 415 Glu Glu Lys Glu Glu Asp Lys Asn Ala Gly Val Gly Asn Ser Gln Asp 420 425 430 Asp Asp Asn Val Lys Leu Trp Lys Val Glu Ile Asp Asn Leu Gly Tyr 435 440 445 Leu Lys Ser Leu Pro Thr Asn Cys Leu Thr His Leu Asp Leu Thr Ile 450 455 460 Ser Asp Ser Lys Glu Gly Glu Gly Glu Trp Glu Val Gly Asp Ala Phe 465 470 475 480 Gln Lys Cys Val Ser Ser Leu Arg Ser Leu Thr Ile Ile Gly Asn His 485 490 495 Gly Ile Asn Lys Val Lys Arg Leu Ser Gly Arg Thr Gly Leu Glu His 500 505 510 Phe Thr Leu Leu Glu Ser Leu Lys Leu Ser Asp Ile Glu Asp Gln Glu 515 520 525 Asp Glu Gly Glu 530 <210> 9 <211> 1392 <212> DNA <213> Spinacia oleracea <220> <223> Amplicon of LRR domain of a-WOLF 27 allele <400> 9 tggatgtgtc ttaggatgtt ggacttgtca aggccggatg ttaaaaattt gcctaattca 60 ataggtaaat tgttgcactt gaggtatctt aacctgtctt gtaatgatga tctgttgata 120 ctccctgatg caattacaag actgcataat ttgcagacac tgcttttaaa agattgcgga 180 agtttaaagg agttgccaaa agatttttgc aaattggtca aactgagaca cttggattta 240 aggtattgtt ggcgtttgat tggtatgcca ttgggaatgg atatgctaac tagtcttaga 300 gtactgccat actttgtggt gggtaggaag aaacaaagtg ttgatgatga gctgaaagcc 360 cttaaaggcc tcaccgagat aaaaggctcc attaatatca aaatctgtga aaattataga 420 atagttgaag gcatgaatga cacaggagga gctgggtatt tgaagagcat gaaacatctc 480 acgggggttg atattacatt tgatggtgga tgtgttaacc ctgaagctgt gttggaaacc 540 ctagagccac cttcaaatat caagaggtta tctatagata attacgatgg tacaacaatt 600 ccagtatggg gaagagcaga gattaattgg gcaatctccc tctcacatct tgtcgacatt 660 tggttttgtg gttgtagtaa tttgcaggag atgccagtgc tgagtaaact gcctcatttg 720 aaatcactga atctttttaa gttttgtaag ttagagtaca tggagagtag aagcagcagc 780 agtagcagtg acacagaagc agcaacacca gaattaccaa cattcttccc ttcccttgaa 840 aaacttacac tttggtatct ggaaaagttg aagggtttgg ggaacaggag atcgagtagt 900 tttccccgcc tctctgaatt ggaaatctgg gaatgcccag atctaacgtg gtttcctcct 960 tgtccaagcc ttaaaacgtt gaaattggaa aaaaacaatg aagcgttgca aataatagta 1020 aaaataacaa caacaagagg taaagaagaa aaagaagaag acaagaatgc tggtgttgga 1080 aattcacaag atgatgacaa tgtcaaatta cggaaggcgg aaatagacaa tctgggttat 1140 ctcaaatcac tgcccacaaa ttgtctgact cacctcgaca ttacaataag agattccaag 1200 gagggggagg gtgaatggga agttggggag gcatttcaga agtgtgtatc ttctttgaga 1260 aagctcagca taatcggaaa tcacggaata aataaagtga agagactgtc tggaagaaca 1320 gggttggagc atttcactct gttggactca ctcaaatttt caaagataga agaccaggaa 1380 gatgagggcg aa 1392 <210> 10 <211> 464 <212> PRT <213> Spinacia oleracea <220> <223> Amino acid sequence encoded by the amplicon of the LRR domain of a-WOLF 27 <400> 10 Trp Met Cys Leu Arg Met Leu Asp Leu Ser Arg Pro Asp Val Lys Asn 1 5 10 15 Leu Pro Asn Ser lie Gly Lys Leu Leu His Leu Arg Tyr Leu Asn Leu 20 25 30 Ser Cys Asn Asp Asp Leu Leu lie Leu Pro Asp Ala lie Thr Arg Leu 35 40 45 His Asn Leu Gin Thr Leu Leu Leu Lys Asp Cys Gly Ser Leu Lys Glu 50 55 60 Leu Pro Lys Asp Phe Cys Lys Leu Val Lys Leu Arg His Leu Asp Leu 65 70 75 80 Arg Tyr Cys Trp Arg Leu lie Gly Met Pro Leu Gly Met Asp Met Leu 85 90 95 Thr Ser Leu Arg Val Leu Pro Tyr Phe Val Val Gly Arg Lys Lys Gin 100 105 110 Ser Val Asp Asp Glu Leu Lys Ala Leu Lys Gly Leu Thr Glu lie Lys 115 120 125 Gly Ser lie Asn lie Lys lie Cys Glu Asn Tyr Arg lie Val Glu Gly 130 135 140 Met Asn Asp Thr Gly Gly Ala Gly Tyr Leu Lys Ser Met Lys His Leu 145 150 155 160 Thr Gly Val Asp lie Thr Phe Asp Gly Gly Cys Val Asn Pro Glu Ala 165 170 175 Val Leu Glu Thr Leu Glu Pro Pro Ser Asn lie Lys Arg Leu Ser lie 180 185 190 Asp Asn Tyr Asp Gly Thr Thr lie Pro Val Trp Gly Arg Ala Glu lie 195 200 205 Asn Trp Ala lie Ser Leu Ser His Leu Val Asp lie Trp Phe Cys Gly 210 215 220 Cys Ser Asn Leu Gin Glu Met Pro Val Leu Ser Lys Leu Pro His Leu 225 230 235 240 Lys Ser Leu Asn Leu Phe Lys Phe Cys Lys Leu Glu Tyr Met Glu Ser 245 250 255 Arg Ser Ser Ser Ser Ser Ser Asp Thr Glu Ala Ala Thr Pro Glu Leu 260 265 270 Pro Thr Phe Phe Pro Ser Leu Glu Lys Leu Thr Leu Trp Tyr Leu Glu 275 280 285 Lys Leu Lys Gly Leu Gly Asn Arg Arg Ser Ser Ser Phe Pro Arg Leu 290 295 300 Ser Glu Leu Glu lie Trp Glu Cys Pro Asp Leu Thr Trp Phe Pro Pro 305 310 315 320 Cys Pro Ser Leu Lys Thr Leu Lys Leu Glu Lys Asn Asn Glu Ala Leu 325 330 335 Gln Ile Ile Val Lys Ile Thr Thr Thr Arg Gly Lys Glu Glu Lys Glu 340 345 350 Glu Asp Lys Asn Ala Gly Val Gly Asn Ser Gln Asp Asp Asp Asn Val 355 360 365 Lys Leu Arg Lys Ala Glu Ile Asp Asn Leu Gly Tyr Leu Lys Ser Leu 370 375 380 Pro Thr Asn Cys Leu Thr His Leu Asp Ile Thr Ile Arg Asp Ser Lys 385 390 395 400 Glu Gly Glu Gly Glu Trp Glu Val Gly Glu Ala Phe Gln Lys Cys Val 405 410 415 Ser Ser Leu Arg Lys Leu Ser Ile Ile Gly Asn His Gly Ile Asn Lys 420 425 430 Val Lys Arg Leu Ser Gly Arg Thr Gly Leu Glu His Phe Thr Leu Leu 435 440 445 Asp Ser Leu Lys Phe Ser Lys Ile Glu Asp Gln Glu Asp Glu Gly Glu 450 455 460 <210> 11 <211> 7978 <212> DNA <213> Spinacia oleracea <220> <223> Genomic DNA sequence of the a-WOLF 27 allele <400> 11 gttctgtttt ttatggcaca gatatccctc atttgcagct ctactctac aaacatcttt 60 cattctttcg ttttcctttt gattcatgta acagttgaac cttctttcat gactgatata 120 gatcaggca gctacttcac tactctatg ttgatcttat tttgtaataa actttgatag 180 attgaataaa ggttgtttgc agtgacttct taagatgtga ttagaagtcc ataatcactt 240 maximum attachment tttcttaca maximum maximum tttccgagg ccttctatt gctttgttgg 300 ttactgtcat gatatggt ttttcttgc ttcttatatc atatggtcct cactcaattt 360 tttaataa agttctcat tggttgacta taatacgtta tagcacctta taatatttta 420 tttaatatac aattttatgt attttacctt ttcatattt ttcgtgatc taccttca 480 tatgagctac actaatttgg tagctttta tgcaatctt gtaccaacgg ttggctttt 540 gctcaaattt tttttttt tttcgagct agtcatttta tgatcattga agtttgctct 600 tatattatca tttagtatt tattacctttt tacattttt tcgtgatcta cctgctcata 660 tgagccac taatttgta gctgcttata caatcttgt atcaacggtt ggctacttgt 720 tcaaatattt ttattttttt acgagtaagt cattttatga tcattgaagt tgctctaata 780 ttatcatgga cctattaacg catgaataat taactcggta ggaattagtt tcaaaataaa 840 attcccctca caaaaaaaaa aaaaaaaaaa aaaaaaaaaa tcagaaaacc aaccttctcc 900 agtttactgt tgtctaaagc caaagagcat ggaattttcc agtaatcgca gaccccaaat 960 tctcttctcc aatcgtccct gtcaatttca gcaattgaat caatcgttga ttttaggatt 1020 tgccgccaaa aaaatgaaaa atccatgaat tttagggttc aaatttgatc cgtaattggg 1080 aaaattttca gcaattgatc ttccaaatca ttcatactlg tttccagact gcaaatgaaa 1140 ggtgcgaact ttatactgca ttttgatttt ccattactgt aatttattaa gatgaactgc 1200 aatttgcaat tgttttattc gactactcat ctttaaatca aattgctaaa ttgctagcta 1260 attttcttat catattgcca aaaatttgtt gcttaaatga ttccatttct ctaattattt 1320 ttgttttatt ggtagataaa taattaaata tcagccccat taattgaata ttcaaaggaa 1380 atgtatggtc caaaaatggc gtttaatagt caatgccgtg ttttatgggg tggtggagta 1440 ctatatgact gtgtgtggac ttggagaaga ctagagagta ttgattatca aaatatggac 1500 cctgaaaatg aaaatgaaaa tgatgtttt acactttaaa atcgtcaaga aacaacaatc 1560 ctctttagca atagtattta cacgcgttat ttgcacggac ttcaatgcaa atagtataaa 1620 tttacagtca aagttttcat tctaaagcgt aaataacttt catgaatgga ggacggtagt 1680 ataagtataa cgttatggcc taccattttc ttatcatatt cacataaatt tgttgctaaa 1740 agttgtttta cttggctaaa atacttttgt tcttattggc agataaacat cagtccatta 1800 ttggccaact tgaacatata cctccaaaca ataatcaata atgtcgatta tgaagttttgt 1860 gaatgcaatt tattatcact ttcatttata aaatgactac ttgattaaca catacaatat 1920 taccttctc caaacaccct ttcaattctg cttaatcttg ttttctcatc atctcttcat 1980 ctttctgaaa acacaaccca atggccgaaa tcggatactc ggtttgtgcg aaactcatcg 2040 aagtgattgg cagtgagctg atcaaagaga tttgcgacac atggggttac aaatctcttc 2100 ttgaggacct caacaaaact gtattgacgg tcaggaacgt tctcattcag gccggggtga 2160 tgcgggagct tactagtgaa caacaaggtt tcattgcaga ccttaaagat gttgtttatg 2220 atgctgatga cttgttcgac aagttactca ctcgtgctga gcgaaaacag attgatggaa 2280 acgaaatctc tgaaaaggta cgtcgtttct tttcctctag taacaagatc ggtcaagctt 2340 actacatgtc tcgtaaggtt aaggaaatta agaagcagtt ggatgaaatt gttgataggc 2400 atacaaaatt tgggtttagt gctgagttta tacctgtttg tagggaaagg gggaacgaga 2460 gggaaacacg ttcatatata gatgtcaaga atattcttgg gagggataaa gataagaatg 2520 atatcataga taggttgctt aatcgtaatg ataatgaagc ttgtagtttc ctgaccatag 2580 tgggagcggg aggattggga aaaactgctc ttgcccaact tgtgttcaat gatgaaaggg 2640 tcaaaattga gtttcatgat ttgaggtatt gggtttgtgt ctctgatcaa gatgggggcc 2700 aatttgatgt gaaagaaatc ctttgtaaga ttttagaggt ggttactaag gagaaagttg 2760 ataatagttc cgcattggaa ttggtacaaa gccaatttca agagaagtta agaggaaaga 2820 agtacttcct tgttcttgat gatgtatgga acgaggatcg tgagaagtgg tttaaattgg 2880 aagagttgtt aatgttgggt caagggggaa gcaaggttgt agtgaccgca cgttcagaga 2940 agacagcaaa tgtcataggg aaaagacatt tttatacact ggaatgtttg tcgccagatt 3000 attcatggag cttatttgaa atgtcggctt ttcagaaagg gcatgagcag gaaaaccatg 3060 acgaactagt tgatattggg aaaaagattg ttgaaaaatg ttataacaat ccacttgcta 3120 taacggtggt aggaagtctt ctttatggag aggagataag taagtggcgg tcatttgaaa 3180 tgagtgagtt ggccaaaatt ggcaatgggg ataataagat tttgtcgata ttgaagctca 3240 gttactacaa tcttgcaaac tctttgaaga gttgttttag ttattgtgca gtatttccca 3300 aggatcataa aatagagaag gagatgttga ttgacctttg gatagcacaa ggatatgttg 3360 tgccgttgga tggtggtcaa agtatagaag atgctgccga ggaacatttt gtaattttat 3420 tacggagatg tttctttcaa gatgtagtga aggatgtata cggtgatgtt gattctgtta 3480 aaatccacga cttgatgcac gatgtcgccc aagaagtggg gagggaggaa atatgtgtag 3540 tgaatgctaa tacaaagaac ttgggtgata aaatccgtca tgtacatggt gatgtcaata 3600 gatatgcaca aagagtctct ctgtgtagcc ataagattcg ttcgtatatt ggtggtaatt 3660 gtgaaaaacg ttgggtggat acactaatag acaactggat gtgtcttagg atgttggact 3720 tgtcaaggcc ggatgttaaa aatttgccta attcaatagg taaattgttg cacttgaggt 3780 atcttaacct gtcttgtaat gatgatctgt tgatactccc tgatgcaatt acaagactgc 3840 ataatttgca gacactgctt ttaaaagatt gcggaagttt aaaggagttg ccaaaagatt 3900 tttgcaaatt ggtcaaactg agacacttgg atttaaggta ttgttggcgt ttgattggta 3960 tgccattggg aatggatatg ctaactagtc ttagagtact gccatacttt gtggtgggta 4020 ggaagaaaca aagtgttgat gatgagctga aagcccttaa aggcctcacc gagataaaag 4080 gctccattaa tatcaaaatc tgtgaaaatt atagaatagt tgaaggcatg aatgacacag 4140 gaggagctgg gtatttgaag agcatgaaac atctcacggg ggttgatatt acatttgatg 4200 gtggatgtgt taaccctgaa gctgtgttgg aaaccctaga gccaccttca aatatcaaga 4260 ggttatctat agataattac gatggtacaa caattccagt atggggaaga gcagagatta 4320 attgggcaat ctccctctca catcttgtcg acatttggtt tgtggttgt agtaatttgc 4380 aggagatgcc agtgctgagt aactgccctc atttgaatc actgaatctt tttaagtttt 4440 gtagttaga gtacatgag gtagtag ggaggagtag gtaggacaca ggagtag 4500 caccagaatt accacattc ttccctccc ttgaaaact tacactttgg tatctggaaa 4560 agttgaaggg tttgggaac aggagatcga gtagttttcc ccgccctct gattggaaa 4620 tctgggaatg cccagatcta acgtggtttc ctccttgtcc aagccttaaa acgttgaaat 4680 tggaaaaaaa caatgaagcg ttgcaataaaaaaaca agaggtaag 4740 aagaaaaaga agagacaag aatgctggtg ttggaatttc ahaatgat ghaatgtca 4800 aattacggaa ggcggaata gatactgg gttatctcaa atcactcccc acaaatttgtc 4860 tgactcacct cgacattaca atagagatt ccaaggagggg ggaggtga tgggaagttg 4920 gggaggcatt tcagaagtgt gtatctctt tgagaagct cagcataatc ggaaatcacg 4980 gataataa agtgagaga ctgtctggaa gaacaggtt ggagcatttc actctgttgg 5040 GAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAG 48 TCTGGAAATC CTTTCCTCAA AACCTCCGCA GTTGGAAATT AAAGGCTCTT GCAAAATGA 5160 CAAGTTTGCC CATGGGGATG CAGTACTTAA CCTCCCTCCA AACCCTCCAT CTATCATATT 5220 GTGATGAATT GAATTCCCTT CCAGAATGGA TAAGCAGCTT ATCATCTCTT CAATCCCTGT 5280 TTCATATACA ATTGTCCAGC CTGAAATCAC TACCAGAAGC AATGAAGAAC CTCACCTCCC 5340 TTCAGAGACT TGAGATACAG CATTGTCCAG ACCTAGCTGA AAGATGCAGA AAACCCAACG 5400 GGGAGGACTA TCCCAAATTG CAACACATCC CCAAATTGTA AGTCATTCAG AAAGTAAT 5460 TTATTCAITT ATATTATTAT TTATGCTTAG AATGATATAC GCAGTCGTCT TTGTTTTCCA 5520 ATCTTGAATT TGTTTTTTGT TTTCTTTCTT TGTTTCTTTA TTCAACACCA GTCCATTTAT 5580 GATTGATTCA TTAAGAAAAA GGATGGAGTT TTATGGATTT GAAGAAGACA ACGAATTGAGA 5640 TTCCTGGGGT TTTTTTTTTC GTTGGGGTTG GTTTTCATGT ATATGTTGCT GATTAATACT 5700 CAGACTGATG ATGATGATGT GTTTATGGGT TTAAAATCAG ATTAATATAT GGGAAATGT 5760 aagttaattg gggatgcaca taaggtgttt gatgaaatgt ctatgagaaa tgttgtttct 5820 tggacttaga atgatataca ctgtcgtcct ttggtttcca atcttacatt tggtttgtgt 5880 tttcttagtt tgtttcttta atcaacacca gcccattttt tttaaactac ctgcaactac 5940 taattttcat ttaccctgta tctcaggaaa tatggtagta attctcattt actcaacact 6000 agcttgatcc tgaacgcagc caaccttcag gttagaatcc gccttactca tccttttgtc 6060 atgcattgtt ttaagttgtt ttgcttgctt gtgtaatcat aattcatagt atacgattca 6120 tcattcacta tgtctacagg caagatattg gaattgttca cgattccctg aagtttcttt 6180 gtttttgttg ataccaccat attgcagctt atagtgacta agttaatgaa tgtttccaaa 6240 aaattagtca tataaattct tcttctctct ctattacata aactcttttt ctctttctaa 6300 cttatcatgt tcatgcctaa aacttataca tgctcacatc attgttcgtt tgagctgact 6360 tacttctgta agagagctat ctagttaaca actcttgtaa ctttttattt gctagtcaga 6420 acatggattg gtgcaagcat gggaatttgc taacactcta ccaaatcgat tggagtttgg 6480 acttagtttc accagaagcc atacccggac acttactggg gactgtcaac aaagccgcat 6540 tgtgatgtac ttggatgttt cacgtgcctg aggtgcgagt tacttggaag ggaagcggtt 6600 tatttaattg ttttcctaag tagatttgc ttacaagctt ttactttca cttgaaaggg 6660 tttttcttgt tttaagcttt tcgaattaga gttttcggtt gcattaagag tagtcgtatt 6720 agtcttttac ctaaggaaga ctcttttttg taattttcag actatgcaat tcaagttttc 6780 gagtgttttc ttgcttgtgt gattgtgagt tggtgaattc gtctttcata cattttgaga 6840 ttatcagaag ctttatgctc caccggtagt ctagtacctt ttctgttact gtacgtgcag 6900 ggaagtaatc tggtacctt tatatatatg gaaaaacata cattatacat tatgcaaaat 6960 tcttacaggt tagttacttc ctggaacttc atttacactt tgtttttttt gttccattcc 7020 ctcggaagac tattccctct gagaaatatg taatgaactt ctgtatgttg ctgtttggtt 7080 cctgttttaa tcttcaattt tcttgtatag ttacagctgc atttacaatg aagtttaagc 7140 agacactctc tttatatagt gcttctttct ggagcaccgt tgagctgtct gtggttgatc 7200 accatctgct gccgagagat tcagcaatcg cgtgtttgat caggtaaaag tttttatgtc 7260 aatgtgtttt tttttccgtt tgatcaattt atgtctgtat tcagattctt atcttcttac 7320 agtagcataa cacattgttt ctttcattta tgtaaactgt ttcaagatta cagagatgta 7380 tgcttcagtc gacattgatg ataacttaag atagcattcc tacaacagtt gcaggcgcat 7440 tctaactccg gcaattctag ttaggcaaga ggagcattgc caatacctgc cacctctggg 7500 atttactata ccagggttga agtttatgga agacaccagc tatgcacaag ccttcaaggg 7560 gtcatcctac ataacaagtt gaaccaacca attgcttgtt ggttcagtgg taattggagc 7620 tgaatttggt agggatggcc catgttcgat ccccacaaca acaattggga gggactgga 7680 acctatccac acgaactccg ccctgaatcc ggattagtcc taagggtgaa cggggtgcta 7740 acaccaaaaa aaaaaaacat aacaagttga accaaacata ctttgtttga attgaagatt 7800 tagtgatttc atttgatcga ttgagatgtc ttattataag cgtatatgct cttggatttg 7860 gccacttagg tgttgtttga caattggtca ttaactcgct tttatatttt cttttctctt 7920 aggaaaggtg atcctgataa tttatattgg aacacttttt ttttctctca ctagcttt 7978 <210> 12 <211> 3450 <212> DNA <213> Spinacia oleracea <220> <223> Coding sequence of the a-WOLF 27 allele <400> 12 atggccgaaa tcggatactc ggtttgtgcg aaactcatcg aagtgattgg cagtgagctg 60 atcaaagaga tttgcgacac atggggttac aaatctcttc ttgaggacct caacaaaact 120 gtattgacgg tcaggaacgt tctcattcag gccggggtga tgcgggagct tactagtgaa 180 caacaaggtt tcattgcaga ccttaaagat gttgtttatg atgctgatga cttgttcgac 240 aagttactca ctcgtgctga gcgaaaacag attgatggaa acgaaatctc tgaaaaggta 300 cgtcgtttct tttcctctag taacaagatc ggtcaagctt actacatgtc tcgtaaggtt 360 aaggaaatta agaagcagtt ggatgaaatt gttgataggc atacaaaatt tgggtttagt 420 gctgagttta tacctgtttg tagggaaagg gggaacgaga gggaaacacg ttcatatata 480 gatgtcaaga atattcttgg gagggataaa gataagaatg atatcataga taggttgctt 540 aatcgtaatg ataatgaagc ttgtagtttc ctgaccatag tgggagcggg aggattggga 600 aaaactgctc ttgcccaact tgtgttcaat gatgaaaggg tcaaaattga gtttcatgat 660 ttgaggtatt gggtttgtgt ctctgatcaa gatgggggcc aatttgatgt gaaagaaatc 720 ctttgtaaga ttttagaggt ggttactaag gagaaagttg ataatagttc cgcattggaa 780 ttggtacaaa gccaatttca agagaagtta agaggaaaga agtacttcct tgttcttgat 840 gatgtatgga acgaggatcg tgagaagtgg tttaaattgg aagagttgtt aatgttgggt 900 caagggggaa gcaaggttgt agtgaccgca cgttcagaga agacagcaaa tgtcataggg 960 aaaagacatt tttatacact ggaatgtttg tcgccagatt attcatggag cttatttgaa 1020 atgtcggctt ttcagaaagg gcatgagcag gaaaaccatg acgaactagt tgatattggg 1080 aaaaagattg ttgaaaaatg ttataacaat ccacttgcta taacggtggt aggaagtctt 1140 ctttatggag aggagataag taagtggcgg tcatttgaaa tgagtgagtt ggccaaaatt 1200 ggcaatgggg ataataagat tttgtcgata ttgaagctca gttactacaa tcttgcaaac 1260 tctttgaaga gttgttttag ttattgtgca gtatttccca aggatcataa aatagagaag 1320 gagatgttga ttgacctttg gatagcacaa ggatatgttg tgccgttgga tggtggtcaa 1380 agtatagaag atgctgccga ggaacatttt gtaattttat tacggagatg tttctttcaa 1440 gatgtagtga aggatgtata cggtgatgtt gattctgtta aaatccacga cttgatgcac 1500 gatgtcgccc aagaagtggg gagggaggaa atatgtgtag tgaatgctaa tacaaagaac 1560 ttgggtgata aaatccgtca tgtacatggt gatgtcaata gatatgcaca aagagtctct 1620 ctgtgtagcc ataagattcg ttcgtatatt ggtggtaatt gtgaaaaacg ttgggtggat 1680 acactaatag acaactggat gtgtcttagg atgttggact tgtcaaggcc ggatgttaaa 1740 aatttgccta attcaatagg taaattgttg cacttgaggt atcttaacct gtcttgtaat 1800 gatgatctgt tgatactccc tgatgcaatt acaagactgc ataatttgca gacactgctt 1860 ttaaaagatt gcggaagttt aaaggagttg ccaaaagatt tttgcaaatt ggtcaaactg 1920 agacacttgg atttaaggta ttgttggcgt ttgattggta tgccattggg aatggatatg 1980 ctaactagtc ttagagtact gccatacttt gtggtgggta ggaagaaaca aagtgttgat 2040 gatgagctga aagcccttaa aggcctcacc gagataaaag gctccattaa tatcaaaatc 2100 tgtgaaaatt atagaatagt tgaaggcatg aatgacacag gaggagctgg gtatttgaag 2160 agcatgaaac atctcacggg ggttgatatt acatttgatg gtggatgtgt taaccctgaa 2220 gctgtgttgg aaaccctaga gccaccttca aatatcaaga ggttatctat agataattac 2280 gatggtacaa caattccagt atggggaaga gcagagatta attgggcaat ctccctctca 2340 catcttgtcg acatttggtt ttgtggttgt agtaatttgc aggagatgcc agtgctgagt 2400 aaactgcctc atttgaaatc actgaatctt tttaagtttt gtaagttaga gtacatggag 2460 agtagaagca gcagcagtag cagtgacaca gaagcagcaa caccagaatt accaacattc 2520 ttcccttccc ttgaaaaact tacactttgg tatctggaaa agttgaaggg tttggggaac 2580 aggagatcga gtagttttcc ccgcctctct gaattggaaa tctgggaatg cccagatcta 2640 acgtggtttc ctccttgtcc aagccttaaa acgttgaaat tggaaaaaaa caatgaagcg 2700 ttgcaaataa tagtaaaaat aacaacaaca agaggtaaag aagaaaaaga agaagacaag 2760 aatgctggtg ttggaaattc acaagatgat gacaatgtca aattacggaa ggcggaaata 2820 gacaatctgg gttatctcaa atcactgccc acaaattgtc tgactcacct cgacattaca 2880 ataagagatt ccaaggaggg ggagggtgaa tgggaagttg gggaggcatt tcagaagtgt 2940 gtatcttctt tgagaaagct cagcataatc ggaaatcacg gaataaataa agtgaagaga 3000 ctgtctggaa gaacagggtt ggagcatttc actctgttgg actcactcaa attttcaaag 3060 atagaagacc aggaagatga gggcgaagac aacatcatat tctggaaatc ctttcctcaa 3120 aacctccgca gtttggaaat taaaggctct tgcaaaatga caagtttgcc catggggatg 3180 cagtacttaa cctccctcca aaccctccat ctatcatatt gtgatgaatt gaattccctt 3240 ccagaatgga taagcagctt atcatctctt caatccctgt tcatatacaa ttgtccagcc 3300 ctgaaatcac taccagaagc aatgaagaac ctcacctccc ttcagagact tgagatacag 3360 cattgtccag acctagctga aagatgcaga aaacccaacg gggaggacta tcccaaaatt 3420 caacacatcc ccaaaattga aatatggtag 3450 <210> 13 <211> 1149 <212> PRT <213> Spinacia oleracea <220> <223> Amino acid sequence of the a-WOLF 27 allele <400> 13 Met Ala Glu Ile Gly Tyr Ser Val Cys Ala Lys Leu Ile Glu Val Ile 1 5 10 15 Gly Ser Glu Leu Ile Lys Glu Ile Cys Asp Thr Trp Gly Tyr Lys Ser 20 25 30 Leu Leu Glu Asp Leu Asn Lys Thr Val Leu Thr Val Arg Asn Val Leu 35 40 45 Ile Gln Ala Gly Val Met Arg Glu Leu Thr Ser Glu Cys Gln Gly Phe 50 55 60 Ile Ala Asp Leu Lys Asp Val Val Tyr Asp Ala Asp Asp Leu Phe Asp 65 70 75 80 Lys Leu Leu Thr Arg Ala Glu Arg Lys Cys Asp Gly Asn Glu Ile Ser 85 90 95 Glu Lys Val Arg Arg Phe Phe Ser Ser Ser Asn Lys Ile Gly Gln Ala 100 105 110 Ala Tyr Tyr Met Ser Arg Lys Val Lys Glu Ile Lys Lys Cys Leu Asp 115 120 125 Glu Ile Val Asp Arg His Thr Lys Phe Gly Phe Ser Ala Glu Phe Ile 130 135 140 Pro Val Cys Arg Glu Arg Gly Asn Glu Arg Glu Thr Arg Ser Tyr Ile 145 150 155 160 Asp Val Lys Asn Ile Leu Gly Arg Asp Lys Asp Lys Asn Asp Ile Ile 165 170 175 Asp Arg Leu Leu Asn Arg Asn Asp Asn Glu Ala Cys Ser Phe Leu Thr 180 185 190 Ile Val Gly Ala Gly Gly Leu Gly Lys Thr Ala Leu Ala Gln Leu Val 195 200 205 Phe Asn Asp Glu Arg Val Lys Ile Glu Phe His Asp Leu Arg Tyr Trp 210 215 220 Val Cys Val Ser Asp Gln Asp Gly Gly Gln Phe Asp Val Lys Glu Ile 225 230 235 240 Leu Cys Lys Ile Leu Glu Val Val Thr Lys Glu Lys Val Asp Asn Ser 245 250 255 Ser Ala Leu Glu Leu Val Gln Ser Gln Phe Gln Glu Lys Leu Arg Gly 260 265 270 Lys Lys Tyr Phe Leu Val Leu Asp Asp Val Trp Asn Glu Asp Arg Glu 275 280 285 Lys Trp Phe Lys Leu Glu Glu Leu Leu Met Leu Gly Gin Gly Gly Ser 290 295 300 Lys Val Val Val Thr Ala Arg Ser Glu Lys Thr Ala Asn Val Ile Gly 305 310 315 320 Lys Arg His Phe Tyr Thr Leu Glu Cys Leu Ser Pro Asp Tyr Ser Trp 325 330 335 Ser Leu Phe Glu Met Ser Ala Phe Gin Lys Gly His Glu Gin Glu Asn 340 345 350 His Asp Glu Leu Val Asp Ile Gly Lys Lys Ile Val Glu Lys Cys Tyr 355 360 365 Asn Asn Pro Leu Ala Ile Thr Val Val Gly Ser Leu Leu Tyr Gly Glu 370 375 380 Glu Ile Ser Lys Trp Arg Ser Phe Glu Met Ser Glu Leu Ala Lys Ile 385 390 395 400 Gly Asn Gly Asp Asn Lys Ile Leu Ser Ile Leu Lys Leu Ser Tyr Tyr 405 410 415 Asn Leu Ala Asn Ser Leu Lys Ser Cys Phe Ser Tyr Cys Ala Val Phe 420 425 430 Pro Lys Asp His Lys Ile Glu Lys Glu Met Leu Ile Asp Leu Trp Ile 435 440 445 Ala Gln Gly Tyr Val Val Pro Leu Asp Gly Gly Gln Ser Ile Glu Asp 450 455 460 Ala Ala Glu Glu His Phe Val Ile Leu Leu Arg Arg Cys Phe Phe Gln 465 470 475 480 Asp Val Val Lys Asp Val Tyr Gly Asp Val Asp Ser Val Lys Ile His 485 490 495 Asp Leu Met His Asp Val Ala Gln Glu Val Gly Arg Glu Glu Ile Cys 500 505 510 Val Val Asn Ala Asn Thr Lys Asn Leu Gly Asp Lys Ile Arg His Val 515 520 525 His Gly Asp Val Asn Arg Tyr Ala Gln Arg Val Ser Leu Cys Ser His 530 535 540 Lys Ile Arg Ser Tyr Ile Gly Gly Asn Cys Glu Lys Arg Trp Val Asp 545 550 555 560 Thr Leu Ile Asp Asn Trp Met Cys Leu Arg Met Leu Asp Leu Ser Arg 565 570 575 Pro Asp Val Lys Asn Leu Pro Asn Ser Ile Gly Lys Leu Leu His Leu 580 585 590 Arg Tyr Leu Asn Leu Ser Cys Asn Asp Asp Leu Leu Ile Leu Pro Asp 595 600 605 Ala Ile Thr Arg Leu His Asn Leu Gln Thr Leu Leu Leu Lys Asp Cys 610 615 620 Gly Ser Leu Lys Glu Leu Pro Lys Asp Phe Cys Lys Leu Val Lys Leu 625 630 635 640 Arg His Leu Asp Leu Arg Tyr Cys Trp Arg Leu Ile Gly Met Pro Leu 645 650 655 Gly Met Asp Met Leu Thr Ser Leu Arg Val Leu Pro Tyr Phe Val Val 660 665 670 Gly Arg Lys Lys Gln Ser Val Asp Asp Glu Leu Lys Ala Leu Lys Gly 675 680 685 Leu Thr Glu Ile Lys Gly Ser Ile Asn Ile Lys Ile Cys Glu Asn Tyr 690 695 700 Arg Ile Val Glu Gly Met Asn Asp Thr Gly Gly Ala Gly Tyr Leu Lys 705 710 715 720 Ser Met Lys His Leu Thr Gly Val Asp Ile Thr Phe Asp Gly Gly Cys 725 730 735 Val Asn Pro Glu Ala Val Leu Glu Thr Leu Glu Pro Pro Ser Asn Ile 740 745 750 Lys Arg Leu Ser lie Asp Asn Tyr Asp Gly Thr Thr lie Pro Val Trp 755 760 765 Gly Arg Ala Glu lie Asn Trp Ala lie Ser Leu Ser His Leu Val Asp 770 775 780 lie Trp Phe Cys Gly Cys Ser Asn Leu Gin Glu Met Pro Val Leu Ser 785 790 795 800 Lys Leu Pro His Leu Lys Ser Leu Asn Leu Phe Lys Phe Cys Lys Leu 805 810 815 Glu Tyr Met Glu Ser Arg Ser Ser Ser Ser Ser Ser Asp Thr Glu Ala 820 825 830 Ala Thr Pro Glu Leu Pro Thr Phe Phe Pro Ser Leu Glu Lys Leu Thr 835 840 845 Leu Trp Tyr Leu Glu Lys Leu Lys Gly Leu Gly Asn Arg Arg Ser Ser 850 855 860 Ser Phe Pro Arg Leu Ser Glu Leu Glu lie Trp Glu Cys Pro Asp Leu 865 870 875 880 Thr Trp Phe Pro Pro Cys Pro Ser Leu Lys Thr Leu Lys Leu Glu Lys 885 890 895 Asn Asn Glu Ala Leu Gin lie lie Val Lys lie Thr Thr Thr Arg Gly 900 905 910 Lys Glu Glu Lys Glu Glu Asp Lys Asn Ala Gly Val Gly Asn Ser Gln 915 920 925 Asp Asp Asp Asn Val Lys Leu Arg Lys Ala Glu Ile Asp Asn Leu Gly 930 935 940 Tyr Leu Lys Ser Leu Pro Thr Asn Cys Leu Thr His Leu Asp Ile Thr 945 950 955 960 Ile Arg Asp Ser Lys Glu Gly Glu Gly Glu Trp Glu Val Gly Glu Ala 965 970 975 Phe Gln Lys Cys Val Ser Ser Leu Arg Lys Leu Ser Ile Ile Gly Asn 980 985 990 His Gly Ile Asn Lys Val Lys Arg Leu Ser Gly Arg Thr Gly Leu Glu 995 1000 1005 His Phe Thr Leu Leu Asp Ser Leu Lys Phe Ser Lys Ile Glu Asp Gln 1010 1015 1020 Glu Asp Glu Gly Glu Asp Asn Ile Ile Phe Trp Lys Ser Phe Pro Gln 1025 1030 1035 1040 Asn Leu Arg Ser Leu Glu Ile Lys Gly Ser Cys Lys Met Thr Ser Leu 1045 1050 1055 Pro Met Gly Met Gln Tyr Leu Thr Ser Leu Gln Thr Leu His Leu Ser 1060 1065 1070 Tyr Cys Asp Glu Leu Asn Ser Leu Pro Glu Trp Ile Ser Ser Leu Ser 1075 1080 1085 Ser Leu Gln Ser Leu Phe Ile Tyr Asn Cys Pro Ala Leu Lys Ser Leu 1090 1095 1100 Pro Glu Ala Met Lys Asn Leu Thr Ser Leu Gln Arg Leu Glu Ile Gln 1105 1110 1115 1120 His Cys Pro Asp Leu Ala Glu Arg Cys Arg Lys Pro Asn Gly Glu Asp 1125 1130 1135 Tyr Pro Lys Ile Gln His Ile Pro Lys Ile Glu Ile Trp 1140 1145 <210> 14 <211> 9 <212> PRT <213> Spinacia oleracea <220> <223> Motif <400> 14 Asp Gln Glu Asp Glu Gly Glu Asp Asn 1 5 <210> 15 <211> 30 <212> DNA <213> Spinacia oleracea <220> <223> Standard Amplimer Forward Primer <400> 15 gcagtcgaac atgtagctga ctcaggtcac 30 <210> 16 <211> 30 <212> DNA <213> Spinacia oleracea <220> <223> Standard Amplification Sequence Reverse Primer <400> 16 tggatcactt gtgcaagcat cacatcgtag 30

Claims

1. An allele designated a-WOLF27 which confers resistance to at least one race of Peronospora effusa, wherein the protein encoded by said allele is a CC-NBS-LRR protein comprising the amino acid sequence of SEQ ID NO: 13, wherein said allele confers full resistance to at least the races Pe:1, Pe:2, Pe:3, Pe:4, Pe:5, Pe:6, Pe:7, Pe:8, Pe:9, Pe:1 1, Pe:12, Pe:13, Pe:14, Pe:15 and Pe:17 of Peronospora effusa when homozygously present in a spinach plant.

2. The allele of claim 1, wherein the genomic DNA sequence of the a-WOLF27 allele comprises SEQ ID NO: 1 1.

3. The allele of claim 1 or 2, wherein the coding sequence of the a-WOLF27 allele comprises SEQ ID NO:

12.

4. A method of producing hybrid spinach seeds comprising crossing a first parent spinach plant with a second parent spinach plant and harvesting the resulting hybrid spinach seeds, wherein said first parent spinach plant comprises the allele of any one of claims 1-3.

5. The method of claim 4, wherein the first and / or second parent is a plant of an inbred line.

6. A method for identifying a spinach plant carrying the allele of any one of claims 1-3, comprising determining the presence of the LRR domain of the allele of claim 1 by determining its nucleotide sequence or a portion thereof in the plant, wherein said sequence comprises SEQ ID NO:

9.

7. The method of claim 6, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the forward primer is a nucleic acid molecule having the sequence of SEQ ID NO:

4.

8. The method of claim 6, wherein the LRR domain is determined by amplifying the LRR domain using a primer pair, wherein the reverse primer is a nucleic acid molecule having the sequence of SEQ ID NO:

5.

9. A method of producing a spinach plant showing resistance to Peronospora effusa comprising: (a) crossing a plant comprising the allele of any one of claims 1-3 with another plant; (b) optionally performing one or more rounds of selfing and / or crossing; (c) selecting a plant comprising said allele of any one of claims 1-3 after one or more rounds of selfing and / or crossing.

10. The method of claim 9, wherein selecting a plant comprising said allele comprises determining the presence of said allele according to the method of any one of claims 6 to 8.

Images