A separation-free method for detecting tumor-derived extracellular vesicles in plasma
By using a separation-free probe and dynamic immunoassay method, individual EVs can be directly detected in plasma, solving the problem of separating tumor-derived extracellular vesicles in plasma, achieving highly sensitive and specific detection, and reducing false positive signals.
Patent Information
- Application Number
- CN202310947391.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-28
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2043-07-28
AI Technical Summary
In existing technologies, tumor-derived extracellular vesicles in plasma are difficult to separate, have low detection specificity, and traditional methods are prone to producing false positive signals.
Separation-free detection is performed using CD63 probes, HER2 probes, GPC1 probes, or EpCAM probes, combined with dynamic immunoassay methods, to directly detect individual EVs in plasma, avoiding the separation process and fluorescent labeling, and utilizing the modified chip surface for specific binding and dissociation analysis.
It achieves specific detection without separation process, improves detection sensitivity, reduces false positive signals, and can identify tumor-derived EVs in complex backgrounds.
Smart Images

Figure CN116819080B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, and particularly relates to a method for detecting tumor-derived extracellular vesicles in plasma without separation. BACKGROUND
[0002] Extracellular vesicles (EVs) are a kind of double-layer phospholipid membrane-coated nanometer-sized vesicles actively secreted by cells. Most cells in the human body can secrete EVs. EVs contain a variety of functional molecular substances from the secreting cells, such as proteins, nucleic acids (DNA, RNA, miRNA), and other metabolic small molecules of amino acids. These small molecules represent the molecular characteristics of the secreting cells. Compared with extracellular free DNA and circulating tumor cells, EVs have obvious advantages in quantity and stability in plasma. Therefore, tumor-derived EVs as a new type of tumor marker have gradually attracted attention in liquid biopsy. The expression amount and expression type of the membrane proteins of the EVs secreted by tumor cells (tumor-derived EVs, tEVs) can be used to distinguish the tumor source of the EVs and judge the type of the tumor.
[0003] In fact, accurate detection of tEVs in plasma still faces many challenges at present for the following reasons: first, in the early stage of tumor, only a small part of cells may be cancerous, and the number of tEVs secreted by the cells is small. At the same time, a large number of EVs secreted by other normal cells in the human body also circulate in the peripheral blood. Therefore, although the total number of EVs in the peripheral blood is large, the EVs containing tumor marker information are very few. Secondly, the EVs secreted by tumor cells are also heterogeneous, and not every tEV carries a tumor marker. Finally, the composition of plasma is very complex, and there are a large number of protein aggregates such as lipoproteins with similar size and density to EVs, and non-specific adsorption sites for detection antibodies, which produce non-negligible false positive signals in detection.
[0004] 1. Research progress at home and abroad and similar implementation schemes
[0005] At present, the separation methods of EVs are based on centrifugal separation, polymer precipitation separation, membrane filtration separation, microfluidic separation, and immunological affinity separation. The detection methods of EVs include nanoparticle tracking technology (NTA), protein printing (WB), ELISA, nanoflow cytometry, and total internal reflection microscopic imaging technology.
[0006] Differential ultracentrifugation is the most traditional and widely used method for EVs isolation. The principle is to separate EVs from other particles by applying a series of low to high centrifugal force, taking advantage of the difference in particle size and density. The process is divided into the following steps: (1) low speed at 300-400g to remove cells and large cell debris; (2) medium speed at 2000g to remove cell debris and larger vesicles; (3) high speed at 10000g to sediment biological polymer aggregates, apoptotic bodies and other high-density components; (4) ultra-high speed at 100000g to separate smaller EVs, then resuspended in PBS and repeated ultracentrifugation to improve purity. This method is simple and easy to operate, but the disadvantages are time-consuming, low purity, low yield and the need for large equipment.
[0007] Polymer precipitation is a relatively convenient and fast separation method. This method uses PEG and other polymer molecules to remove water molecules around EVs, and EV particles that are insoluble in water form aggregates, which can be separated by low-speed centrifugation. Currently, some commercially available EV purification kits are based on the principle of polymer precipitation, such as SBI's Exosome kit and Thermo Fisher's Total Exosome Isolation kit. The advantages of this method are simple and fast, and do not require large equipment; the disadvantage is that the yield of EVs is very low, about 10 times lower than that of ultracentrifugation.
[0008] There are several ways to detect the particle size of EVs, such as nanoparticle tracking analysis (NTA) and dynamic light scattering (DLS). Among them, NTA is currently recognized as the standard technique for characterizing particle size in the field of EVs research. NTA uses laser irradiation of the sample pool, and the laser is scattered by the particles. At this time, the camera records the path of the Brownian motion of each particle, and the diffusion equation is used to determine the average velocity and diffusion rate of the particles, and the radius of the particles is calculated. Then according to statistical calculation, the concentration and particle size distribution of the sample are obtained. Similar to NTA, DLS also uses light scattering by particles to collect the particle size distribution of the sample, but unlike NTA, DLS does not track individual particles, so it cannot calculate the concentration of particles, and its application in the field of EVs is also limited.
[0009] Traditional EVs protein analysis methods include Western blot (WB), Enzyme Linked Immunosorbent Assay (ELISA), Flow Cytometry (FCM), etc. According to the MISEV2018, transmembrane proteins such as CD63, CD81, cytoplasmic proteins such as TSG101, etc. are selected as protein indicators for verifying the purity of EVs extraction. Although WB is the gold standard for protein verification, due to its large sample consumption, time-consuming and laborious experimental process, etc., it is currently only used for reliability verification of EVs samples.
[0010] ELISA adopts a double-antibody sandwich method strategy, using general marker antibodies such as CD63 / CD9 / CD81 to capture EVs, and adding antibodies of disease markers such as EpCAM / HER2 as detection antibodies to detect EVs from diseases [5]. ELISA has higher detection sensitivity and less sample consumption than WB, so it is generally used as a comparison of concentration test range between classic and new methods. However, the analysis performance of ELISA depends largely on the selection of antibodies, and the cross-talk between antibodies reduces the sensitivity of detection. In addition, due to the non-specific adsorption of many proteins and other biological molecules present in the sample, direct detection of EVs from biological samples faces the problem of non-specific adsorption of these impurities on the substrate, so there are many problems in practical application.
[0011] FCM simultaneously performs multi-parameter, rapid quantitative analysis and sorting on cells or biological particles in a fast straight-line flow state, and is the most commonly used device in the field of single-cell sorting. FCM uses sheath fluid to concentrate single-cell or single-particle suspension, and these single particles pass through the laser beam one by one, and the detector detects forward and side scatter light, as well as fluorescent light emitted by staining. FCM can also be used to characterize EVs. However, due to the small size of EVs, ordinary FCM cannot detect individual EVs, but uses antibody-modified microspheres to first enrich EVs on the surface of the microspheres, then immunofluorescently stains the EVs on the surface of the microspheres, and finally uses FCM to detect the microspheres. Therefore, the detection sensitivity of traditional FCM does not meet the requirements.
[0012] In addition to WB, ELISA, FCM, electrochemistry, surface enhanced Raman scattering (SERS), surface plasmon resonance (SPR) and other platforms, a variety of new detection methods have been developed. Electrochemistry is a simple and feasible detection platform. The specific capture antibody or aptamer of EVs is modified on the working electrode, and then the detection antibody is used to recognize EVs. The secondary antibody labeled with horseradish peroxidase is combined with the detection antibody, and the catalytic substrate is added to generate redox current, so that the sample can be detected. Another advantage of electrochemistry is that it can be combined with nucleic acid signal amplification system to analyze low content samples and improve sensitivity. However, the electrochemistry-based detection method also has some disadvantages, such as the repeatability of electrode modification and non-specificity.
[0013] The main problems existing in the prior art are: 1. It is difficult to separate tumor-derived EVs in plasma; 2. The detection specificity of tumor-derived EVs is low; 3. When the current single EV imaging analysis technology is mainly based on fluorescence detection, a fluorescently labeled secondary antibody is often added to stain the EVs on the chip. In this process, the detection chip interface will also non-specifically adsorb the fluorescent antibody, causing false positive signals.
[0014] Therefore, the skilled in the art is committed to developing a separation-free, specific, and label-free reagent for EVs detection. SUMMARY
[0015] In view of the above defects of the prior art, the technical problem to be solved by the present application is how to develop a separation-free, specific, and label-free reagent for EVs detection.
[0016] To achieve the above-mentioned purpose, the present application provides a separation-free extracellular vesicle detection method probe, which comprises a CD63 probe, a HER2 probe, a GPC1 probe or / and an EpCAM probe; wherein the CD63 probe sequence is shown as SEQ ID NO. 1, the HER2 probe sequence is shown as SEQ ID NO. 2, the GPC1 probe sequence is shown as SEQ ID NO. 3, and the EpCAM probe sequence is shown as SEQ ID NO. 4.
[0017] Further, the CD63 probe sequence is shown as SEQ ID NO. 1, and specifically is: AAACAAGACGACGAATTTTTCACCCCACCTCGCTCCCGTGACACTAATGCTA.
[0018] The HER2 probe sequence is shown as SEQ ID NO. 2, specifically: AAACAAGACGACGAATTTTTGGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC;
[0019] The GPC1 probe sequence is shown as SEQ ID NO. 3, specifically: AAACAAGACGACGAATTTTTAACGGAGTGTGGCTAACTCGA;
[0020] The EpCAM probe sequence is shown as SEQ ID NO. 4, specifically: AAACAAGACGACGAATTTTTCACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG.
[0021] The application also provides a use of a non-isolated cell extracellular vesicle detection method probe in a non-isolated plasma cell extracellular vesicle detection reagent, comprising the following steps:
[0022] Step 1, single EV imaging analysis, detecting single EV after directly diluting plasma;
[0023] Step 2, collecting the image of the single EV obtained in step 1 by a microscope, performing dynamic immune detection, and counting the number of specific binding EVs.
[0024] Further, step 1 further comprises the following steps:
[0025] Step 1.1, incubating a certain concentration of EV sample with the probe to obtain a sample incubation solution;
[0026] Step 1.2, adding the sample incubation solution obtained in step 1 to the chip surface, and testing after standing at room temperature;
[0027] Step 1.3, collecting the image to obtain a single EV binding dissociation event.
[0028] Further, step 1.1 further comprises that the EV sample comprises a liver cancer cell line derived EV sample, a pancreatic cell line derived EV sample, and / or a pancreatic cancer cell line derived EV sample.
[0029] Further, the CD63 probe is used for incubating the liver cancer cell line derived EV sample; the CD63 probe, the HER2 probe, the GPC1 probe, and the EpCAM probe are used for incubating the pancreatic cell line derived EV sample and / or the pancreatic cancer cell line derived EV sample.
[0030] Further, the incubation in step 1.1 is specifically: 37 DEG C or room temperature for 3 hours; and the standing time in step 2 is half an hour.
[0031] Further, the chip is modified before use in step 1.2, and the modification step is:
[0032] Step 1) The chip is composed of a Cr and Au metal film plated on a BK-7 chip.
[0033] Step 2) The chip obtained in step 1) is washed with deionized water and anhydrous ethanol alternately for 3 times, then dried with nitrogen and burned on the surface with a hydrogen flame; then directly immersed in a first modification solution for modification overnight; then removed and washed with PBS to remove the excess first modification solution, and a second modification solution is added for secondary modification.
[0034] Further, the metal film is plated with 3nm Cr and 47nm Au; the components of the first modification solution are mPEG:PEG-biotien, and the ratio is 10:1; the second modification solution is a SA solution with a concentration of 0.1mg / mL; and the secondary modification time is 3h.
[0035] Further, the image is collected by an Olympus SPRM microscope in step 1.3.
[0036] Further, the dynamic immune detection in step 2 uses SPRM non-labeled detection.
[0037] In a preferred embodiment 1 of the present application, the verification process of the dynamic immune detection principle in the EVs sample from a human normal hepatoma cell line is described in detail;
[0038] In another preferred embodiment 2 of the present application, the process of detecting EVs from a human pancreatic cell line by a non-isolated extracellular vesicle detection probe is described in detail.
[0039] In another preferred embodiment 3 of the present application, the specificity test process of the dynamic detection method for a plasma sample is described in detail.
[0040] The present application has the following beneficial technical effects:
[0041] The present application provides a non-isolated extracellular vesicle detection method probe, and develops a non-isolated, specific and non-labeled dynamic immune detection method for EVs. The non-isolated extracellular vesicle detection probe is applied to the immune detection reagent, avoiding the separation process of plasma EVs, directly diluting the plasma for detection; and without using fluorescence detection, the single EV binding kinetics can be characterized, whether the EV is a specific binding EV can be determined from the single EV level, 1 target EV can be detected from 350 background particles, thereby avoiding the non-specific adsorption of the prior art, causing false positive signal interference.
[0042] The concept, specific structure and generated technical effects of the present application will be further described below in combination with the drawings, so as to fully understand the purposes, features and effects of the present application. BRIEF DESCRIPTION OF DRAWINGS
[0043] Figure 1 is a single EV binding and dissociation process diagram on the surface of a preferred embodiment 1 of the present application;
[0044] Figure 2 is a human healthy liver cell-derived EVs sample test result diagram of a preferred embodiment 1 of the present application;
[0045] Figure 3 is a dynamic immunoassay and ELISA test result diagram of EVs derived from HPNE and PaNC1 respectively of a preferred embodiment 2 of the present application;
[0046] Figure 4 is a specific test result diagram in plasma of a preferred embodiment 3 of the present application. DETAILED DESCRIPTION
[0047] The following reference drawings of the specification introduce a plurality of preferred embodiments of the present application, so that the technical content thereof is more clear and convenient to understand. The present application can be embodied in many different forms of embodiments, and the protection scope of the present application is not limited to the embodiments mentioned herein.
[0048] Example 1: Verification of dynamic immunoassay principle in human normal liver cancer cell line-derived EVs sample.
[0049] The verification steps are as follows:
[0050] 1. Collect the EVs sample of human normal liver cells by ultracentrifugation method.
[0051] 2. Take a certain concentration of EVs sample and incubate with appropriate probe (CD63 probe), incubate at 37°C or room temperature for 3 hours.
[0052] 3. Drop the sample on the chip surface, and test after standing at room temperature for half an hour.
[0053] 4. Modification of the chip: The chip was made of BK-7 chip coated with 3nm Cr and 47nm Au. The chip was first cleaned with deionized water and anhydrous ethanol alternately for 3 times, then dried with nitrogen and burned with hydrogen flame. Then it was directly immersed in the modification solution of mPEG: PEG-biotien (10:1) overnight. Then it was taken out and washed with PBS to remove the excess modification solution, and 0.1mg / mL SA solution was added for 3h. The receptors were first combined with the base strands, and the base strands were modified with biotin at the 5' end. Then the solution was added to the chip and combined with SA, so that the receptors were modified on the surface of the chip.
[0054] 5. The images were collected by Olympus SPRM microscope. The binding and dissociation process of single EV on the surface is shown in Figure 1 , and the binding and dissociation events of single EV after removing the background can be obtained.
[0055] 6. The binding time of EVs with unmodified probes and EVs with modified probes on the chip surface was counted respectively. The test results of EVs sample from human healthy liver cells are shown in Figure 2 , where (a)-(c) show that the average residence time of EVs in the sample with unmodified probes is 2s, and the average residence time of EVs with modified probes is 20s, which has a statistical difference.
[0056] 7. The comparison results with ELISA experiment are shown in Figure 2 (d)(e), which shows that the sensitivity of the application is high.
[0057] 8. The application can detect 1 labeled probe EV among 350 unlabelled probe EVs, as shown in Figure 2 (f).
[0058] Example 2: Verification of EVs from human pancreatic cell lines
[0059] The verification steps are as follows:
[0060] 1. HPNE (human healthy pancreatic cell line) and PaNC1 (human pancreatic cancer cell line) were cultured respectively. EVs samples were extracted by high-speed centrifugation.
[0061] 2. The CD63 probe, HER2 probe, GPC1 probe and EpCAM probe in Table 1 were used to incubate EVs samples from HPNE and PaNC1 at room temperature or 37℃ for 3 hours.
[0062] Table 1 Probe sequence
[0063]
[0064] 3. The above sample was added to the chip surface, and the test was performed after standing at room temperature for half an hour.
[0065] 4. Modification process of the chip: The chip was composed of a BK-7 chip plated with 3 nm Cr and 47 nm Au metal film. The chip was first cleaned with deionized water and anhydrous ethanol alternately for 3 times, and then dried with nitrogen and burned on the surface with hydrogen flame. Then it was directly soaked in the modification solution of mPEG: PEG-biotien (10: 1) overnight for modification. Then the excess modification solution was washed away with PBS, and 0.1 mg / mL SA solution was added for modification for 3 hours. The receptors were first combined with the base strands in a complementary manner, the base strands were modified with biotin at the 5' end, and then the solution was added to the chip to combine with the SA, so that the receptors were modified on the surface of the chip.
[0066] 5. The images were collected by using an Olympus SPRM microscope. The results of the dynamic immune detection and ELISA for EVs from HPNE and PaNC1 are shown in Figure 3 , which shows that the present application can test the high and low expression of EV membrane proteins.
[0067] Example 3: Specificity test of the dynamic detection method for plasma samples.
[0068] The test steps and result analysis are as follows:
[0069] 1. EVs produced by PNAC1 were added to the plasma of a normal person, so that the concentration of EVs reached 1010 EVs / mL.
[0070] 2. 30 μL of the above sample was taken and incubated with CD63 probe, HER2 probe, GPC1 probe and EpCAM probe respectively, and incubated at room temperature or 37°C for 3 hours.
[0071] 3. The above sample was added to the chip surface, and the test was performed after standing at room temperature for half an hour.
[0072] 4. The images were collected by using an Olympus SPRM microscope, and the number of specific binding EVs was counted. The specificity test results in the plasma are shown in Figure 4 .
[0073] 5. Compared with the normal human plasma sample without adding tumor EVs, the number of EVs specifically expressing four markers in the plasma sample with added tumor EVs increased significantly;
[0074] 6. The HER2 marker was determined by adding different concentrations of tumor EVs to the plasma sample, and it was found that the detection limit in the plasma sample was similar to that in the PBS sample.
[0075] The preferred embodiments of the application have been described above in detail. It should be understood that modifications and variations to the preferred embodiments could be made by those skilled in the art without departing from the spirit and scope of the application. Accordingly, it is intended that there be included within the scope of the application, all such modifications and variations as would be apparent to those skilled in the art upon reading this disclosure. It is intended to obtain for the inventors such patent rights as are available in any country on the world.
Claims
1. A probe for detecting extracellular vesicles without separation, characterized in that, The device includes a CD63 probe, a HER2 probe, a GPC1 probe, and / or an EpCAM probe; wherein the CD63 probe sequence is shown in SEQ ID NO. 1, the HER2 probe sequence is shown in SEQ ID NO. 2, the GPC1 probe sequence is shown in SEQ ID NO. 3, and the EpCAM probe sequence is shown in SEQ ID NO. 4; the probe also includes a base sequence and a receptor sequence binding; the base sequence is 5'-biotin CCT CCC AGC CCA TCC TAA CC; the receptor sequence is receptor sequence 12, 8, or 5, the receptor sequence 12 nucleotide sequence is: GTC GTC TTG TTT GG TTA GGA TGG GCT GGG AGG, the receptor sequence 8 nucleotide sequence is: TC TTG TTT GG TTA GGA TGG GCT GGG AGG, and the receptor sequence 5 nucleotide sequence is: TG TTTGG TTA GGA TGG GCT GGG AGG.
2. The application of the probe as described in claim 1 in a reagent for detecting extracellular vesicles in plasma without separation, characterized in that, The application includes the following steps: Step 1: Single EV imaging analysis, detecting individual EVs after directly diluting the plasma; Step 2: Use a microscope to acquire images of the individual EVs obtained in Step 1, perform dynamic immunoassay, and count the number of EVs that specifically bind.
3. The application as described in claim 2, characterized in that, Step 1 also includes the following steps: Step 1.1: Take a sample of EVs at a certain concentration and incubate it with the probe to obtain a sample incubation solution; Step 1.2: The sample obtained in Step 1 is incubated and dropped onto the chip surface, and then tested after standing at room temperature; Step 1.3: Acquire the image to obtain the single EV binding dissociation event.
4. The application as described in claim 3, characterized in that, Step 1.1 further includes the EVs samples comprising EVs samples derived from hepatocellular carcinoma cell lines, EVs samples derived from pancreatic cell lines, and / or EVs samples derived from pancreatic cancer cell lines.
5. The application as described in claim 4, characterized in that, EVs samples derived from the hepatocellular carcinoma cell line were incubated with the CD63 probe; EVs samples derived from the pancreatic cell line and / or EVs samples derived from the pancreatic cancer cell line were incubated with the CD63 probe, HER2 probe, GPC1 probe, and EpCAM probe.
6. The application as described in claim 3, characterized in that, The incubation in step 1.1 specifically refers to incubation at 37°C or room temperature for 3 hours; the settling time in step 2 is half an hour.
7. The application as described in claim 3, characterized in that, The chip described in step 1.2 is modified before use. The modification steps are as follows: Step 1) The chip is constructed by depositing Cr and Au metal films onto a BK-7 chip; Step 2) The chip obtained in Step 1) is washed three times alternately with deionized water and anhydrous ethanol, then dried with nitrogen and ignited with a hydrogen flame; then directly immersed in the first modification solution overnight for modification; then removed and washed with PBS to remove excess first modification solution, and added second modification solution for second modification, the metal film is deposited with 3nm Cr and 47nm Au; the composition of the first modification solution is methoxy polyethylene glycol: biotinylated polyethylene glycol, the ratio is 10:1; the second modification solution is SA solution, the concentration is 0.1mg / mL; the second modification time is 3h.
8. The application as described in claim 3, characterized in that, In step 1.3, the images were acquired using an Olympus surface plasmon resonance microscope.
9. The application as described in claim 4, characterized in that, The dynamic immunoassay in step 2 uses label-free detection via surface plasmon resonance microscopy.
Citation Information
Patent Citations
Method for detecting extracellular vesicles in a sample
CN110869764A
Method for the isolation of intact extracellular vesicles
US20210102191A1