A biomarker for predicting the efficacy of oncolytic virus in the treatment of malignant tumors and its application
By detecting the expression of SH3BP2, a biomarker is provided for predicting the efficacy of oncolytic viruses in the treatment of malignant glioma, solving the lack of targeted problems in the prior art and achieving more efficient therapeutic effects.
Patent Information
- Application Number
- CN202311210468.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-19
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2043-09-19
AI Technical Summary
The lack of reliable biomarkers in the prior art is used to predict the efficacy of oncolytic virus therapy on malignant brain glioma, resulting in a lack of targeted treatment.
A biomarker predicting the efficacy of oncolytic viruses in the treatment of malignant tumors, including SH3BP2, is proposed to predict the therapeutic effect by detecting the expression of SH3BP2 in tumor tissues, and provides corresponding kits.
By detecting the expression of SH3BP2, the therapeutic effect of oncolytic virus on malignant brain glioma can be effectively predicted, the targeted treatment can be improved, the survival of patients and the malignancy of the tumor can be reduced.
Smart Images

Figure CN117089620B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of predicting the therapeutic effect of tumors, and particularly to a biomarker for predicting the efficacy of oncolytic virus in treating malignant tumors and its application. Background Art
[0002] Glioblastoma is a common intracranial tumor, accounting for about 70-80% of intracranial tumors, of which malignant glioblastoma accounts for about 40-45%, and the 5-year survival rate is less than 5%. Despite comprehensive treatments such as surgery, radiotherapy and chemotherapy, the survival period of patients is short, and the median survival period is only 12-15 months. At present, there is a lack of effective treatment methods for malignant glioblastoma, bringing a heavy burden to patients' families and the country.
[0003] Oncolytic virus therapy is a new type of immunotherapy strategy for malignant tumors, with advantages such as high targeting, multi-mechanism oncolysis and editable modification, and is gradually becoming a hot spot in tumor immunotherapy. Common types of oncolytic viruses include: adenovirus, vaccinia virus, herpes simplex virus (HSV), parvovirus H1, and poliovirus, etc. Oncolytic herpes simplex virus type I (oHSV-1) is a commonly used virus in glioblastoma virus therapy.
[0004] The research team where the applicant is located has been engaged in basic and clinical research on oncolytic virus in treating glioblastoma for a long time. A new type of oncolytic virus has been constructed based on oHSV-1 (see Patent 201711251406.7), and a clinical study on treating recurrent malignant glioblastoma has been carried out at Beijing Tiantan Hospital, Capital Medical University since 2018 (Registration number of the Chinese Clinical Trial Registry: ChiCTR1900022570).
[0005] Although the new oncolytic virus has achieved amazing efficacy in some patients with refractory malignant gliomas, a large proportion of patients still cannot benefit from it. Therefore, in order to make the treatment more targeted, it is particularly important to find accurate diagnostic biomarkers for distinguishing responsive patients from non-responsive patients.
[0006] At present, there is no reliable biomarker for predicting patients who respond to oncolytic virus therapy. The main reason is that on the one hand, due to the experimental nature of most oncolytic viruses, patients receiving oncolytic virus therapy usually have experienced multiple conventional treatments, their immune systems are damaged, and the tumor has changed fundamentally compared with its initial form. Therefore, predictive and prognostic biomarkers for oncolytic virus therapy need to consider the mechanism of action of oncolytic viruses, and also the role of biomarkers in tumors.
[0007] Previous studies have found that oHSV-1 can generally infect glioma cells (glioma cells generally express the receptors HVEM and Nectins of HSV-1), so there is no phenomenon that the oncolytic effect cannot be exerted because oHSV-1 cannot enter tumor cells.
[0008] In order to make the treatment effect of glioblastoma more ideal, it is particularly important to find markers for predicting the treatment effect or to discover which protein expression levels play a decisive role in the treatment effect.
[0009] In view of this, the present invention is specifically proposed. Summary of the Invention
[0010] Aiming at the defects of the prior art, the purpose of the present invention is to provide a biomarker for predicting the efficacy of oncolytic virus in treating malignant tumors and its application.
[0011] In order to achieve the above purpose, the present invention provides the following technical solutions:
[0012] The first aspect of the present invention provides a biomarker for predicting the efficacy of oncolytic virus in treating malignant tumors. The biomarker includes SH3BP2. The oncolytic virus is oncolytic herpes simplex virus, and the malignant tumor is glioblastoma.
[0013] In the above biomarker, as an optional embodiment, the biomarker further includes Sp1 and / or pSTAT3.
[0014] SH3BP2 and Sp1 as markers can be SH3BP2 and Sp1 proteins, or genomic DNA or mRNA encoding SH3BP2 and Sp1 proteins.
[0015] In the above biomarker, as an optional embodiment, the oncolytic herpes simplex virus is oHSV-1.
[0016] In the above biomarker, as an optional embodiment, the treatment of malignant tumors with oncolytic virus includes administering oncolytic herpes simplex virus to tumor cells or tissues of glioblastoma individuals, in vitro glioblastoma tissues, or in vitro glioblastoma cells.
[0017] The second aspect of the present invention provides a kit for predicting the efficacy of oncolytic virus in treating malignant tumors. The kit includes reagents for detecting the expression levels of the above biomarkers in malignant tumor cells or tissues. The oncolytic virus is oncolytic herpes simplex virus, and the malignant tumor is glioblastoma.
[0018] In the above kit, as an optional embodiment, the oncolytic herpes simplex virus is oHSV-1.
[0019] In the above-mentioned kit, as an alternative embodiment, the oncolytic virus for treating malignant tumors includes administering oncolytic herpes simplex virus to tumor cells or tumor tissues of glioma individuals, in vitro glioma tissues, or in vitro glioma cells; more preferably, the tumor cells are glioma cells U251 or LN229.
[0020] In the above-mentioned kit, as an alternative embodiment, the reagent for detecting the expression level of biomarker SH3BP2 is a reagent for detecting the amount of mRNA generated after transcription of the SH3BP2 gene or a reagent for detecting the amount of SH3BP2 protein;
[0021] Preferably, the reagent for detecting the amount of mRNA generated after transcription of the SH3BP2 gene includes: a reagent for detecting the mRNA expression level of SH3BP2 using quantitative RT-PCR method, a reagent for detecting the mRNA expression level of SH3BP2 using gene chip method, or a reagent for detecting the mRNA expression level of SH3BP2 using high-throughput sequencing method; preferably, the reagent for detecting the mRNA expression level of SH3BP2 using quantitative RT-PCR method includes a quantitative RT-PCR primer pair for detecting the mRNA of SH3BP2; further preferably, the sequences of the quantitative RT-PCR primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively;
[0022] The reagent for detecting the amount of SH3BP2 protein includes: a reagent for detecting the expression level of the biomarker SH3BP2 protein using Western blot method, a reagent for detecting the expression level of the biomarker SH3BP2 protein using ELISA method, or a reagent for detecting the expression level of the biomarker SH3BP2 protein using mass spectrometry method; preferably, the reagent for detecting the expression level of the biomarker SH3BP2 protein using Western blot method or the reagent for detecting the expression level of the biomarker SH3BP2 protein using ELISA method includes an antibody for detecting SH3BP2; the antibody is more preferably a monoclonal antibody.
[0023] In the above-mentioned kit, as an alternative embodiment, the reagent for detecting the expression level of biomarker Sp1 is a reagent for detecting the amount of mRNA generated after transcription of the Sp1 gene or a reagent for detecting the amount of Sp1 protein;
[0024] Preferably, the reagents for detecting the amount of mRNA transcribed from the Sp1 gene include: reagents for detecting the mRNA expression level of Sp1 using quantitative RT-PCR method, reagents for detecting the mRNA expression level of Sp1 using gene chip method, or reagents for detecting the mRNA expression level of Sp1 using high-throughput sequencing method; preferably, the reagents for detecting the mRNA expression level of Sp1 using quantitative RT-PCR method include quantitative RT-PCR primer pairs for detecting the mRNA of Sp1; more preferably, the sequences of the quantitative RT-PCR primer pairs for detecting the mRNA of Sp1 are respectively shown as SEQ ID NO.3 and SEQ ID NO.4;
[0025] The reagents for detecting the amount of protein of mRNA of Sp1 include: reagents for detecting the protein expression level of mRNA of Sp1 by detecting markers using Western blot method, reagents for detecting the protein expression level of mRNA of Sp1 by detecting markers using ELISA method, or reagents for detecting the protein expression level of mRNA of Sp1 by detecting markers using mass spectrometry method; preferably, the reagents for detecting the protein expression level of mRNA of Sp1 by detecting markers using Western blot method or the reagents for detecting the protein expression level of mRNA of Sp1 by detecting markers using ELISA method include antibodies for detecting the mRNA of Sp1.
[0026] In the above kit, as an alternative embodiment, the reagent for detecting the expression level of the biomarker pSTAT3 is a reagent for detecting the amount of pSTAT3 protein; preferably, the reagent for detecting the amount of pSTAT3 protein is a reagent for detecting the amount of phosphorylated STAT3 protein in glioma pathological tissues by immunohistochemistry.
[0027] In the above kit, as an alternative embodiment, the kit further includes reagents for detecting the expression levels of internal reference genes or internal reference proteins in malignant tumor cells or tissues; more specifically, the reagents for detecting the amount of mRNA transcribed from the SH3BP2 gene further include reagents for detecting the expression levels of internal reference genes GAPDH or β-Actin in malignant tumor cells or tissues; preferably, the reagents for detecting the expression levels of internal reference genes GAPDH or β-Actin in malignant tumor cells or tissues include quantitative RT-PCR primer pairs for detecting the internal reference genes GAPDH or β-Actin. In some embodiments, the specific sequences of the quantitative RT-PCR primer pairs for detecting the internal reference gene β-Actin are shown as SEQ ID NO.5 and SEQ ID NO.6.
[0028] The reagent for detecting the amount of SH3BP2 protein or the reagent for detecting the expression level of pSTAT3 protein as a biomarker further includes a reagent for detecting the expression level of internal reference GAPDH or β-Actin protein in malignant tumor cells or tissues. In some embodiments, the reagent for detecting the expression level of internal reference GAPDH protein in malignant tumor cells or tissues includes an antibody for detecting GAPDH protein, and the antibody is more preferably a monoclonal antibody. The reagent for detecting the expression level of internal reference β-Actin protein in malignant tumor cells or tissues includes an antibody for detecting β-Actin protein, and the antibody is more preferably a monoclonal antibody.
[0029] The third aspect of the present invention provides an application of a biomarker in the preparation of a reagent for predicting the efficacy of oncolytic virus in treating malignant tumors or for detecting the malignancy degree of tumors, wherein the biomarker includes SH3BP2, the oncolytic virus is oncolytic herpes simplex virus, and the malignant tumor is glioma.
[0030] In the application of the above-mentioned third aspect, as an alternative embodiment, the biomarker further includes Sp1 and / or pSTAT3.
[0031] In the application of the above-mentioned third aspect, as an alternative embodiment, the oncolytic virus is oHSV-1.
[0032] The fourth aspect of the present invention provides an application of an oncolytic virus in the preparation of a reagent for reducing the expression level of SH3BP2 gene in malignant tumor cells or tissues, wherein the oncolytic virus is oncolytic herpes simplex virus, and the malignant tumor is glioma.
[0033] In the application of the above-mentioned fourth aspect, as an alternative embodiment, the oncolytic virus is oHSV-1.
[0034] The fifth aspect of the present invention provides a use of a reagent for reducing the expression level of SH3BP2 gene in malignant tumor cells or tissues in the preparation of a drug for treating malignant tumors, wherein the malignant tumor is glioma.
[0035] The technical solution of the present invention has at least the following technical effects:
[0036] The present invention screens out the biomarker SH3BP2 for predicting the efficacy of oncolytic virus in the treatment of malignant glioma according to the following two principles: a) The biomarker plays an important role in the malignant progression of tumors and its expression in tumors is regulated. b) After the oncolytic virus enters tumor cells, the proteins expressed by itself act on the expression of the biomarker and play a regulatory role. In the invasion of tumor cells, Sp1 can bind to the promoter of SH3BP2 and promote its expression. The high expression of SH3BP2 will promote the phosphorylation of STAT3. The inventors found that as an oncogene, the increase in the expression level of SH3BP2 in glioma effectively promotes the phosphorylation and activation of STAT3, thereby promoting the malignant process of glioma patients. Therefore, before treating malignant glioma with oncolytic virus, the expression level of SH3BP2 in tumor tissues before oncolytic virus treatment is detected to predict the treatment effect of oncolytic virus on malignant glioma. When the expression level of SH3BP2 in the tumor tissue of the patient to be detected before oncolytic virus treatment is higher than the expression level of SH3BP2 in the standard product, it indicates that the oncolytic virus can act through the ICP4-Sp1-SH3BP2-STAT3 pathway, thereby inhibiting the phosphorylation level of STAT3, and then judging that the oncolytic virus will respond to the treatment of malignant glioma, achieving a good treatment effect, increasing the survival period of the patient, and reducing the malignancy of the tumor; when the expression level of SH3BP2 in the tumor tissue of the patient to be detected before oncolytic virus treatment has no obvious change or is lower than the expression level of SH3BP2 in the standard product, it indicates that the oncolytic virus cannot act through the ICP4-Sp1-SH3BP2-STAT3 pathway, and then judging that the oncolytic virus has no response to the treatment of malignant glioma and cannot play a therapeutic role, predicting a poor prognosis for glioma patients. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. Among them:
[0038] Figure 1 It is a result diagram for cloning the SH3BP2 promoter sequence into the dual-luciferase reporter gene vector pGL3-basic and then co-transfecting glioma cells U251 and LN229 with the pFlag-Sp1 plasmid to detect the fluorescence activity in the successfully transfected cells;
[0039] Figure 2 It is a result diagram for overexpressing or knocking out Sp1 to affect the expression of SH3BP2 in glioma cells;
[0040] Figure 3To investigate the effects of knocking out SH3BP2 in glioma cells on cell migration, colony formation and invasion. A, SH3BP2 was knocked out in glioma cells U251 and LN229 using Crisper-cas9, and the expression was identified by western blot; B, scratch assay; C, colony formation; D, Transwell assay was used to detect the invasion ability;
[0041] Figure 4 To investigate the effects of overexpressing SH3BP2 in glioma cells on cell migration, colony formation and invasion. A, SH3BP2 was overexpressed in glioma cells U251 and LN229 using lentivirus, and the expression was identified by western blot; B, scratch assay; C, colony formation; D, Transwell assay was used to detect the invasion ability;
[0042] Figure 5 To investigate the interaction between SH3BP2 and STAT3; among them, glioma cells U251 (A) and LN229 (B);
[0043] Figure 6 To investigate the results of SH3BP2 affecting STAT3 phosphorylation induced by EGF;
[0044] Figure 7 To investigate the effects of oHSV-1 on Sp1, SH3BP2, STAT3 and pSTAT3 in glioma cells;
[0045] Figure 8 To investigate the western blot detection results of the expression of SH3BP2 in tumor tissues of subjects recruited in the clinical trial of the novel oncolytic virus before oncolytic virus treatment; according to the clinical efficacy, it was divided into the respond group (responsive group) and the norespond group (non-responsive group), A is the grayscale image of western blot, and B is the column analysis chart. Detailed implementation manners
[0046] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Those skilled in the art should understand that the embodiments are only for helping to understand the present invention and should not be regarded as specific limitations to the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention. The process parameters without specific conditions noted in the following embodiments are usually in accordance with conventional conditions.
[0047] The present invention employs many conventional techniques in the fields of molecular biology, microbiology, and DNA recombination. These techniques are well-known and are explained in the following documents, for example, Current Protocols in Molecular Biology, volumes I, II, and III, 1997 (edited by F.M. Ausubel); Molecular Cloning: A Laboratory Manual, second edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989) by Sambrook et al.; DNA Cloning: A Practical Approach, volumes I and II, edited by D.N. Glover (1985); Oligonucleotide Synthesis, edited by M.L. Gait (1984); Hames & Higgins, Nucleic Acid Hybridization, (1985); Transcription and Translation, edited by Hames & Higgins (1984); Animal Cell Culture, edited by R.I. Freshney (1986).
[0048] The materials used in the present invention are described below.
[0049] 1. The glioma cell line U251 used in the following examples or comparative examples is sourced from the Peking Union Medical College Cell Bank, the LN229 cell line is sourced from the ATCC Cell Bank, and the primary glioma cells GBM1 are primary glioma cells extracted from glioma tissues of clinical patients used in this experimental group. They have the ability to stably pass generations, and the cells have been identified and confirmed to be glioma cells (see patent CN201811535397.9, i.e., BT-127 in this patent).
[0050] 2. pGL3-basic was purchased from the promega company, and pFlag-CMV2 was purchased from the sigma company.
[0051] 3. Oncolytic virus oHSV-1
[0052] In the present invention, there is no particular limitation on the type of the oncolytic herpes simplex virus, and any known oncolytic herpes simplex virus in the art can be used. Preferably, the herpes simplex virus of the present invention is herpes simplex virus type I. There is also no particular limitation on the source of the herpes simplex virus of the present invention, and it can be obtained through conventional commercial purchase or isolated in the laboratory by itself. Preferably, it is a human-derived herpes simplex virus. The oncolytic herpes simplex virus type 1 (oHSV-1) used in the present invention can be a wild-type oncolytic herpes simplex virus type 1 or a recombinant oncolytic herpes simplex virus type 1 when not particularly limited. The recombinant oncolytic herpes simplex virus type 1 is obtained by modifying the wild-type oncolytic herpes simplex virus type 1 (HSV-1). For example, a recombinant oHSV-1 virus is obtained by inserting a functional gene or / and deleting some genes at a specific position on the basis of the wild-type oncolytic herpes simplex virus type 1 through genetic engineering. Whether it is a wild-type oncolytic herpes simplex virus type 1 or a recombinant oncolytic herpes simplex virus type 1, the ICP4 gene is contained in the virus. The oHSV-1 virus used in the following examples is oHSV-1-CD described in Patent 202010784288.1, and the specific construction method is as follows:
[0053] According to the method described in the patent application with the application number 2004100064921, the ICP34.5 gene and the ICP47 gene of the wild-type HSV-1 virus (the GenBank number of its gene sequence: NC_001806, the same below) are knocked out to generate an oncolytic HSV-1 vector (oHSV-1), and then an exogenous nucleic acid sequence containing the Escherichia coli CD gene is inserted at the position where the ICP34.5 gene is knocked out. γ1 34.5 is replaced. In order to make the inserted exogenous CD gene express smoothly, the inserted exogenous nucleic acid sequence also includes the promoter CMV and poly(A). The methods of gene knockout and gene insertion in the present invention are all conventional methods in the art, such as homologous recombination, which will not be elaborated here. The recombinant virus constructed by deleting the γ1 34.5 gene and the ICP47 gene is called oHSV-1-CD. Briefly, all viruses are grown and titrated in Vero cells, collected by sonication and centrifuged at 1200×g for 20 minutes. The virus is stored at -80°C to avoid freeze-thaw cycles. The recombinant oncolytic herpes simplex virus is a recombinant oncolytic herpes simplex virus type 1 with a deletion of γ1 34.5, a deletion of ICP47, the presence of the specific short 11 glycoprotein US11, and the coding gene of cytosine deaminase inserted at the γ1 34.5 position.
[0054] 4. When detecting the expression level of SH3BP2 in tumor tissues or cells by quantitative RT-PCR method, the primer pair used can be designed according to the cDNA sequence of the SH3BP2 gene by conventional methods in the art. Preferably, the primer pair shown in Table 1 below is used in the examples of the present invention:
[0055] Table 1
[0056] Name Primer Sequence (5’-3’) Forward Primer CATTGGCCTGTCCCTATGAAG (SEQ ID NO.1) Reverse Primer GCAGCGTTTGTGGATGATGA (SEQ ID NO.2)
[0057] 5. When detecting the expression level of Sp1 in tumor tissues or cells by quantitative RT-PCR method, the primer pairs used can be designed according to the cDNA sequence of the Sp1 gene by conventional methods in the art. Preferably, the primer pairs shown in Table 2 below are used in the examples of the present invention:
[0058] Table 2
[0059] Name Primer Sequence (5’-3’) Forward Primer 5’-AATTTGCCTGCCCTGAGTGC-3’ (SEQ ID NO.3) Reverse Primer 5’-TTGGACCCATGCTACCTTGC-3’ (SEQ ID NO.4)
[0060] 6. When detecting the expression level of the internal reference gene β-Actin in tumor tissues or cells by quantitative RT-PCR method, the primer pairs used can be designed according to the cDNA sequence of the internal reference gene β-Actin by conventional methods in the art. Preferably, the primer pairs shown in Table 3 below are used in the examples of the present invention:
[0061] Table 3
[0062] Name Primer Sequence (5’-3’) Forward Primer 5’-CTCCATCCTGGCCTCGCTGT-3’ (SEQ ID NO.5) Reverse Primer 5’-GCTGTCACCTTCACCGTTCC-3’ (SEQ ID NO.6)
[0063] 7. The cDNA sequence of the SH3BP2 gene in the present invention is SEQ ID NO.7 in the sequence listing, and the protein sequence encoded by it is SEQ ID NO.8 in the sequence listing.
[0064] 8. The cDNA sequence of the Sp1 gene in the present invention is SEQ ID NO.9 in the sequence listing, and the protein sequence encoded by it is SEQ ID NO.10 in the sequence listing.
[0065] The present invention will be further described in detail below with reference to specific examples.
[0066] Example 1 Regulation of Sp1 binding to the SH3BP2 promoter
[0067] (1) Sp1 is a transcription factor that regulates gene expression by binding to the promoter sequence of the gene SH3BP2.
[0068] (1-1) The promoter sequence of SH3BP2 was cloned between the Kpn I and Hind III restriction sites of the dual-luciferase reporter gene vector pGL3-basic as the promoter of the luciferase reporter gene, and the pGL3-pSH3BP2 plasmid was obtained after sequencing confirmation. The Sp1 gene was inserted between the HindIII and Xba I restriction sites in pFlag-CMV2, and the pFlag-Sp1 plasmid was obtained after sequencing confirmation. The promoter sequence of SH3BP2 is as follows (the underlined part is the Sp1 binding site): CGGGACCCGCC GGGGAGGGG CGGGGCCGGG GCGGGGCCAG (SEQ ID NO.11).
[0069] (1-2) After digesting U251 cells and LN229 cells, they were transferred to 24-well plates and transfected in the two types of cells respectively. Among them, the Control group was transfected with pGL3-pSH3BP2 and pFLag-CMV2 plasmids, and the Sp1 group was transfected with pGL3-pSH3BP2 and pFlag-Sp1 simultaneously.
[0070] (1-3) The fluorescence activity was detected according to the kit instructions.
[0071] The results are shown in Figure 1 . It can be seen from the figure that in the Sp1 group, Sp1 bound to the promoter sequence of SH3BP2, and the overexpressed Sp1 in the cells promoted the expression of the luciferase reporter gene; while in the Control group, due to the lack of overexpression of Sp1, the expression level of the luciferase reporter gene in the cells was very low, and the relative luciferase activity was low.
[0072] (2) To verify the gene function and expression regulation relationship of Sp1, we knocked out or overexpressed the Sp1 gene in glioma cells, and then detected the effect on SH3BP2.
[0073] (2-1) The overexpression plasmid pFlag-Sp1 was transfected into glioma cell U251, and the transfected Sp1 and the expression of SH3BP2 in the cells were detected by Western blot 24 h later.
[0074] Specifically, glioma cell line U251 was seeded in a six-well plate at a reasonable cell number to allow cell attachment and reach a cell density of 60 - 80%. The medium was changed to DMEM + 10% FBS, and an appropriate amount of plasmid pFlag-Sp1 (1 μg plasmid per well) was added to the medium. At the same time, a control was set up, in which pFlag-CMV2 plasmid was transfected, and 1 μg plasmid was added to each well. Lipo3000 and P3000 were used to promote transfection. After 6 hours, the medium was changed, and the cells were further cultured until 24 h. Cell proteins were extracted, and the expression level of SH3BP2 in the transfected cells was detected by western blotting. The results are shown in Figure 2 A.
[0075] (2 - 2) After knocking out Sp1 in the cells using Crisper-cas9, the expressions of Sp1 and SH3BP2 in the cells were detected by Western blot.
[0076] Specifically, it includes the following steps:
[0077] ① Construction of knockout vectors: The knockout vectors were constructed by inserting the target sequences at the BsmBI site of lentiCRISPRv2. The target sequences inserted in the two constructed knockout vectors were ko-1 and ko-2 respectively. At the same time, a control vector was set up, which was constructed by inserting a random sequence at the BsmBI site of lentiCRISPRv2, where:
[0078] The base sequence of ko-1 is TGGGAAACGCTTCACACGTT (such as SEQ ID NO.12 in the sequence listing);
[0079] The base sequence of ko-2 is GCGTTTCCCACAGTATGAC (such as SEQ ID NO.13 in the sequence listing);
[0080] The random sequence is ATCGTGGCCGGCATTACATG (such as SEQ ID NO.14 in the sequence listing).
[0081] ② Packaging of lentivirus: The constructed vectors lentiCRISPRv2-ko1, lentiCRISPRv2-ko2, and the control vector were co-transfected with the helper plasmids PsPAX2 and PMD2.G into 293T cells to package lentivirus, and two packaged lentivirus solutions and a control were collected;
[0082] ③ Infect glioma cells U251: Transfect the two packaged lentiviruses and the control into glioma cells U251 that have been adherently cultured and reached a cell density of 60 - 80% respectively, specifically including: Discard the original culture medium in the culture dish of glioma cells U251, and add a mixture of fresh medium (DMEM + 10% FBS) and filtered medium containing virus solution (DMEM + 10% FBS) in equal proportion for infection, and add polybrene to the medium at a final concentration of 1 μg / ml. After 6 - 8 hours of infection, change the cell medium and culture the cells normally. After 24 hours, when the number of cells grows to a certain amount, screen them with puromycin. After a period of culture and amplification, construct stable Sp1 knockout cell lines (KO1 and KO2), and detect the expression of SH3BP2 in the cells by WB. The results are shown in Figure 2 B.
[0083] It was found from Figure 2 A that overexpression of Sp1 significantly promoted the expression of SH3BP2 in cells; while it can be seen from Figure 2 B that the expression of SH3BP2 decreased in the cells (KO1 and KO2) after knocking out Sp1. This experiment further proved that Sp1 regulates its expression after binding to the SH3BP2 promoter.
[0084] Example 2 Functional analysis of SH3BP2 in glioma cells
[0085] (1) Use Crisper-cas9 to knock out SH3BP2 in glioma cells U251 and LN229, and then identify the expression of SH3BP2 by western blot.
[0086] Specifically, through the Crisper-cas9 system, transfect the cell line with a lentivirus carrying a plasmid with a target sequence (AGACTATGAGCACGACGATG, such as SEQ ID NO.15 in the sequence listing) for knocking out the target gene to construct a SH3BP2 knockout glioma cell line (i.e., ko SH3BP2), which can be stably passaged. After screening with puromycin, culture it under the conditions of 37°C and 5% CO2, and amplify it. The specific construction method can refer to the part (2 - 2) in Example 1, and identify the expression of SH3BP2 by WB.
[0087] koNC is the control group of the SH3BP2 knockout cell line, that is, transfect the cells with a lentivirus carrying a blank plasmid and a resistance gene (relative to the construction of the SH3BP2 knockout glioma cell line, the plasmid used in the control group is to insert a random sequence SEQ ID NO.14 into lentiCRISPRv2). The purpose of this control is to detect the influence of the virus itself on the glioma cell line and exclude the interference of other factors except genes on the constructed cell line.
[0088] Figure 3 Among them, A, in glioma cells U251 and LN229, SH3BP2 in the cells was knocked out using Crisper-cas9, and the expression was identified by western blotting; B, scratch assay; C, colony formation; D, Transwel assay to detect invasion ability.
[0089] It was found from Figure 3 that after knocking out (ko) SH3BP2 in glioma cells ( Figure 3 , A), cell migration ( Figure 3 , B), colony formation ( Figure 3 , C) and invasion ability ( Figure 3 , D) all decreased significantly.
[0090] (2) Lentivirus was used to overexpress SH3BP2 in glioma cells U251 and LN229, and the expression was identified by western blotting.
[0091] Construction of overexpression cell line (oe SH3BP2): Cells were seeded into 24-well plates. When they adhered and reached a cell density of 60 - 80%, lentivirus carrying the plasmid overexpressing the SH3BP2 gene was added to infect the cells, and Polybrene was used to enhance the transfection efficiency. Among them, the plasmid overexpressing the SH3BP2 gene was inserted with the SH3BP2 gene at the multiple cloning sites PacI and AscI of pWPI. After 6 hours of transfection, the cells were changed to fresh medium and cultured normally. When the number of cells grew to a certain amount, puromycin screening was performed. After a period of culture and amplification, the overexpression efficiency of SH3BP2 in the cell line was detected by WB assay. The specific construction method can refer to part (2 - 2) of Example 1.
[0092] Meanwhile, a control oeNC was set up, which is the control group of the overexpressing SH3BP2 cell line, and the cell line was constructed by transfecting with lentivirus carrying the blank plasmid pWPI.
[0093] Figure 4 Among them, A, in glioma cells U251 and LN229, SH3BP2 was overexpressed using lentivirus, and the expression was identified by western blotting; B, scratch assay; C, colony formation; D, Transwel assay to detect invasion ability.
[0094] It was found from Figure 4 that after overexpressing (oe) SH3BP2 in glioma cells ( Figure 4 , A), cell migration ( Figure 4 , B), colony formation ( Figure 4 , C) and invasion ability ( Figure 4 , D) all increased significantly.
[0095] Example 3 Discovery that the interaction between SH3BP2 and STAT3 affects STAT3 phosphorylation
[0096] (1) Immunoprecipitation (Co-IP) was performed using an antibody against SH3BP2 as follows:
[0097] (1-1) Total protein extraction:
[0098] ① Preparation of cell samples: Cells were collected by centrifugation at 3000 rpm for 5 min, rinsed with PBS, and appropriate modified RIPA Buffer (containing protease inhibitors) was added. The cells were lysed on ice for 30 min and then centrifuged at 4°C and 12000 rpm for 20 min to obtain the supernatant;
[0099] ② Preparation of tissue samples: Appropriate tissue was taken, rinsed with PBS, and 5 volumes of pre-cooled modified RIPA Buffer were added. The tissue was homogenized on ice for about 5 min and then centrifuged at 4°C and 12000 rpm for 20 min to obtain the supernatant;
[0100] (1-2) A small amount of the supernatant was taken for Western Blot analysis, and the remaining supernatant was added with 1 μg of the corresponding antibody, which was Anti-SH3BP2 (rabbit anti-human), and incubated with slow shaking at 4°C overnight;
[0101] (1-3) Pre-washing of protein A beads: 10 μL of protein A beads were taken and washed 3 times with appropriate modified RIPA Buffer, centrifuged at 3000 rpm for 3 min each time, and then adjusted to a 50% suspension with modified RIPA Buffer;
[0102] (1-4) The pre-washed 10 μL of protein A beads were added to the modified RIPA Buffer in which the antibody was incubated overnight in (1-2), and incubated with slow shaking at 4°C for 2-4 h to allow the antibody to be fully conjugated to the protein A beads;
[0103] (1-5) Centrifuged at 4°C and 3000 rpm for 3 min, the supernatant was discarded, and the beads were washed 3-4 times with 1 mL of modified RIPA Buffer; 15 μL of 2×SDS loading buffer was added and boiled for 5 minutes;
[0104] (1-6) Western Blotting analysis was performed to determine the binding protein.
[0105] It was found that STAT3 was present in the precipitate complex, indicating the interaction between SH3BP2 and STAT3. SeeFigure 5 In glioma cells U251 (A) and LN229 (B), SH3BP2 can bind to STAT3. Figure 5 In, Input was to detect the expression of STAT3 and SH3BP2 in the cell lysate (i.e., the supernatant in ① or ②). Based on the expression, an immunoprecipitation experiment was carried out.
[0106] IgG was used as a negative control, which was the negative control of the antibody. There were IgG heavy and light chains in the antibody. In order to prevent the target protein of the interaction from binding to the IgG heavy and light chains instead of the anti-protein part in the antibody, this negative control was set, which ensured that the interaction was with the anti-SH3BP2 part.
[0107] (2) STAT3 phosphorylation is mainly caused by the binding of corresponding ligands, including IL-6, IL-10, EGF, FGF, etc. In this study, EGF was mainly selected as a tool to promote STAT3 phosphorylation to amplify the effect of SH3BP2 knockout or overexpression on STAT3 phosphorylation (Note: EGF will not affect the expression of SH3BP2). EGF factor (20 nmol / ml) was added in vitro to treat glioma cells U251 ( Figure 6 , A) and LN229 ( Figure 6 , B) overexpressing or knocking out SH3BP2 for 15 minutes, and then the phosphorylation level of STAT3 was detected by WB. Among them, glioma cells U251 and LN229 overexpressing SH3BP2 were designated as oeSH3BP2, and their control was designated as oeNC; glioma cells U251 and LN229 with SH3BP2 knocked out were designated as koSH3BP2, and their control was designated as koNC; the construction of the corresponding cell lines is shown in Example 2.
[0108] The results are shown in Figure 6 , after knocking out SH3BP2, the phosphorylation process of STAT3 in the cells was affected, with a slow phosphorylation process or a low phosphorylation degree. After overexpressing SH3BP2, the phosphorylation degree of STAT3 in the cells was high.
[0109] It has been reported in the literature that STAT3 is involved in the processes of tumor cell transformation, invasion, metastasis and malignant transformation, especially playing an important role in tumor blood vessels. In gliomas with a higher degree of malignancy, STAT3 is often widely overphosphorylated, so it is also a target for the treatment of malignant tumors.
[0110] It can be determined therefrom that reducing the expression level of SH3BP2 in glioma cells or tissues can have a certain therapeutic effect on gliomas.
[0111] Effect of ICP4 gene expressed by oncolytic virus oHSV-1 on Sp1, SH3BP2 and STAT3
[0112] Study on the treatment of glioma with oncolytic virus oHSV-1
[0113] Experimental procedure: Glioma cells U251, LN229 and primary cultured glioma cells GBM1 were added with oHSV-1 (MOI = 0.1), and the cells were collected after 48 h. Western blotting was used to identify the expression of ICP4 gene, Sp1, SH3BP2 and STAT3 genes in the cells. At the same time, a negative control without adding oHSV-1 virus was set up.
[0114] The results are shown in Figure 7 , and it was found that the ICP4 gene expressed by oHSV-1 could ultimately inhibit the phosphorylation of STAT3 in glioma cells through Sp1, SH3BP2 and STAT3.
[0115] Through the above research, it was found that oncolytic virus oHSV-1 acts on a new pathway in glioma cells, that is, after oHSV-1 infects glioma cells, early proteins such as ICP4 are expressed in tumor cells and replicate rapidly in tumor cells. ICP4 expressed during the replication process acts on the transcription factor Sp1 of tumor cells. The invasion of tumor cells depends on the expression of Sp1, because Sp1 can bind to the promoter of SH3BP2 and promote its expression. The high expression of SH3BP2 will promote the phosphorylation of STAT3. Therefore, when the expression of Sp1 and SH3BP2 is inhibited, the phosphorylation level of STAT3 will also be inhibited, thereby reducing the malignancy of the tumor.
[0116] Through the analysis of Examples 1-4, it can be seen that SH3BP2 can be regarded as an oncogene, and its high expression indicates that it plays a role in the progression of glioblastoma. Oncolytic virus oHSV-1 can inhibit the expression of SH3BP2, that is, effectively control or treat glioblastoma by inhibiting the high expression of SH3BP2. If SH3BP2 is not expressed or the expression level is very low in the tumor tissue before oncolytic virus treatment, it indicates that the progression of glioblastoma in this patient is not caused by the action of this gene. In this case, oncolytic virus oHSV-1 cannot play a role by inhibiting SH3BP2 in the ICP4-Sp1-SH3BP2-STAT3 pathway. Therefore, when SH3BP2 is not expressed or the expression level is very low in the tumor tissue before treatment, it is not recommended to use oncolytic virus for treatment.
[0117] Example 5 Method for predicting the therapeutic effect of oncolytic virus on glioma using SH3BP2
[0118] Method 1:
[0119] 1) Before treating a glioma patient to be tested with oncolytic virus oHSV-1, detect the mRNA expression level of SH3BP2 in tumor pathological tissues or tumor cells in the glioma pathological biopsy of the patient by RT-PCR method or detect the protein expression level of SH3BP2 in tumor pathological tissues or tumor cells in the glioma pathological biopsy of the patient by Western blot. The methods of extracting RNA, reverse transcribing cDNA, extracting proteins, RT-PCR method and Western blot method are all common molecular biology methods in the art and will not be elaborated here. Among them, the primer pair used for PCR amplification of SH3BP2 cDNA in the RT-PCR method is shown in Table 1, and the annealing temperature during PCR amplification is 60°C. The primer pair for amplifying the internal reference β-Actin, which is the same, is shown in Table 3, and the annealing temperature during PCR amplification is 60°C.
[0120] While detecting the mRNA expression level of SH3BP2 or the protein expression level of SH3BP2 in tumor pathological tissues or tumor cells in the glioma pathological biopsy of the patient, detect the mRNA expression level of SH3BP2 or the protein expression level of SH3BP2 in the standard product and the expression level of the internal reference. Among them, the standard product is a mixture of glioma pathological biopsy tissues of multiple patients (preferably more than 10 patients) who have no obvious effect after treatment with oncolytic virus oHSV-1 (such as a survival period of less than 12 months) before oncolytic virus treatment.
[0121] 2) Compare the test results of the glioma patient to be tested with the test results of the standard product. If the relative expression level of SH3BP2 in the tumor tissue of the glioma patient to be tested is lower than or equal to the relative expression level of SH3BP2 in the standard product, it indicates that the oncolytic virus cannot achieve a therapeutic effect by reducing the expression level of SH3BP2 in the patient's tumor. If the relative expression level of SH3BP2 in the tumor tissue of the glioma patient to be tested is higher than the relative expression level of SH3BP2 in the standard product, it indicates that the oncolytic virus can achieve a therapeutic effect by reducing the expression level of SH3BP2 in the patient's tumor. The more the relative expression level of SH3BP2 in the patient is higher than that in the standard product, the more suitable the patient is for intervention treatment with oncolytic virus oHSV-1.
[0122] Of course, in order to simplify the operation and not have to detect the standard product every time, the following Method 2 can be used:
[0123] RT-PCR detection method: A suitable CT value can be determined for the standard product through RNA extraction, reverse transcription into cDNA, and fluorescence quantitative PCR. For example, using the primers in Table 1 and Table 3 above, the CT value of the standard product can be determined to be 30 (i.e., 30 cycles when reaching the set fluorescence threshold). When detecting the mRNA expression level of SH3BP2 in the glioma pathological tissue of the patient to be tested, set the number of cycles to 30 during fluorescence quantitative PCR. If, when reaching 30 cycles, the fluorescence value of the product does not reach the set threshold or just reaches the set threshold, it indicates that the mRNA expression level of SH3BP2 in the glioma pathological tissue of the patient to be tested is lower than or equal to that of the standard product, which is recorded as negative (-), indicating that the oncolytic virus cannot achieve a therapeutic effect by reducing the expression level of SH3BP2 in the patient's tumor. If, when reaching 30 cycles, the fluorescence value of the product is higher than the set threshold, it indicates that the mRNA expression level of SH3BP2 in the glioma pathological tissue of the patient to be tested is higher than that of the standard product, which is recorded as positive (+), indicating that the oncolytic virus can achieve a therapeutic effect by reducing the expression level of SH3BP2 in the patient's tumor, and it is recommended to use the oncolytic virus for treatment.
[0124] Western blot method: The relative expression level of SH3BP2 protein can be obtained for the standard product through protein extraction and WB testing. In the experiment, the inventor used a mixture of tumor tissues before oncolytic virus treatment from 10 patients who did not show obvious effects after treatment with oncolytic virus oHSV-1 as the standard product. After WB detection, the relative expression level of SH3BP2 protein was 0.25. In this case, the detection results of the standard product can be directly used for prediction. For example, when using WB to detect the relative expression level of SH3BP2 protein in the glioma pathological tissue of the patient to be tested, when the relative expression level of SH3BP2 protein in the glioma pathological tissue of the patient to be tested is lower than or equal to the relative expression level of SH3BP2 protein in the standard product, which is 0.25, it is recorded as negative (-), indicating that the oncolytic virus cannot achieve a therapeutic effect by reducing the expression level of SH3BP2 in the patient's tumor. When the relative expression level of SH3BP2 protein in the glioma pathological tissue of the patient to be tested is higher than the relative expression level of SH3BP2 protein in the standard product, which is 0.25, it is recorded as positive (+), indicating that the oncolytic virus can achieve a therapeutic effect by reducing the expression level of SH3BP2 in the patient's tumor, and it is recommended to use the oncolytic virus for treatment.
[0125] Method 3:
[0126] To further improve the accuracy of the prediction results, on the basis of Method 1 or 2, the mRNA expression level of Sp1 in the tumor pathological tissue or tumor cells before treatment (RT-PCR method, primer pairs are shown in Sequences 3 and 4) or the protein expression level of Sp1 (Western blot method) can also be detected. Using the mode of Method 1 or 2 above, it is compared with the standard product to predict the therapeutic effect of the oncolytic virus. The specific judgment method is as follows:
[0127] When the relative mRNA expression level or protein relative expression level of Sp1 in the glioma pathological tissue of the patient to be tested is lower than or equal to the relative mRNA expression level or protein relative expression level of Sp1 in the standard product, it is recorded as negative (-), indicating that the oncolytic virus cannot play a therapeutic effect on the patient through the ICP4-Sp1-SH3BP2-STAT3 pathway. When the relative mRNA expression level or protein relative expression level of Sp1 in the glioma pathological tissue of the patient to be tested is higher than the relative mRNA expression level or protein relative expression level of Sp1 in the standard product, it is recorded as positive (+), indicating that the oncolytic virus can play a therapeutic effect on the patient through the ICP4-Sp1-SH3BP2-STAT3 pathway, and it is recommended to use the oncolytic virus for treatment.
[0128] Method 4:
[0129] To further improve the accuracy of the prediction results, on the basis of Method 1 or 2 or 3, the protein expression level of pSTAT3 in the tumor pathological tissue or tumor cells before treatment (Western blot method) or immunohistochemistry can also be detected. Using the mode of Method 1 or 2 above, it is compared with the standard product to predict the therapeutic effect of the oncolytic virus. The specific judgment method is as follows:
[0130] When the protein expression level of pSTAT3 in the glioma pathological tissue of the patient to be tested is lower than or equal to the protein expression level of pSTAT3 in the standard product, it is recorded as negative (-), indicating that the oncolytic virus cannot play a therapeutic effect on the patient through the ICP4-Sp1-SH3BP2-STAT3 pathway. When the protein expression level of pSTAT3 in the glioma pathological tissue of the patient to be tested is higher than the protein expression level of pSTAT3 in the standard product, it is recorded as positive (+), indicating that the oncolytic virus can play a therapeutic effect on the patient through the ICP4-Sp1-SH3BP2-STAT3 pathway, and it is recommended to use the oncolytic virus for treatment.
[0131] The more biomarkers are detected, and when the prediction conclusions given by the detection results of each biomarker tend to be consistent, the more accurate the final prediction conclusion is.
[0132] Example 6 Verifying the accuracy of the prediction results using Method 2 in Example 5
[0133] The primary tumors of 20 glioma subjects were all glioblastoma (grade 4). The primary tumors were resected surgically. After reexamination, recurrence was detected by imaging examination, and stereotactic pathological biopsy was performed (1 specimen was sent to the pathology department and 1 specimen was retained in the laboratory); the pathological report identified it as high-grade glioma, and then oncolytic virus oHSV-1 was injected (the total injection volume was 108 pfu, 1 ml, injected once). After injection, the survival period of the subjects was observed, and the survival period is shown in Table 4 below. Usually, after the recurrence of high-grade glioma, the survival period does not exceed 12 months with comprehensive treatments such as surgery, radiotherapy and chemotherapy after surgery.
[0134] The pathological biopsy tissues of 20 glioma subjects before oncolytic virus treatment were detected, analyzed and judged by using Method 2 in Example 5. The detection results are shown in Table 4 below. The WB detection results of the pathological biopsy tissues of the subjects numbered 1-6 before oncolytic virus treatment are shown in Figure 8 , the expression of SH3BP2 in the pathological tissues of patients No. 1-3 with poor oncolytic virus treatment effect (no respond) was lower than that of the standard product, while the expression of SH3BP2 in the pathological tissues of patients No. 4-6 with good treatment effect (respond) was higher, far higher than that of the standard product.
[0135] Table 4
[0136]
[0137]
[0138] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. Use of a biomarker in the preparation of a reagent for predicting the efficacy of oncolytic virus in treating malignant tumors or for detecting the malignancy degree of tumors, wherein the biomarker includes SH3BP2, the oncolytic virus is oncolytic herpes simplex virus, the malignant tumor is glioma, the oncolytic herpes simplex virus is oHSV-1, and the reagent is for detecting the expression level of the biomarker in malignant tumor cells or tissues.
2. The use according to claim 1, characterized in that The biomarker also includes Sp1.
3. The use according to claim 1 or 2, characterized in that The treatment of malignant tumors with oncolytic virus includes administering oncolytic herpes simplex virus to tumor cells or tumor tissues of an individual with glioma, in vitro glioma tissues, or in vitro glioma cells.
4. The use according to claim 3, characterized in that The tumor cells are glioma cells U251 or LN229.
5. The use according to claim 1, characterized in that The reagent for detecting the expression level of biomarker SH3BP2 is a reagent for detecting the amount of mRNA generated after transcription of the SH3BP2 gene or a reagent for detecting the amount of SH3BP2 protein.
6. The use according to claim 5, characterized in that The reagents for detecting the amount of mRNA generated after transcription of the SH3BP2 gene include: reagents for detecting the mRNA expression level of SH3BP2 using quantitative RT-PCR method, reagents for detecting the mRNA expression level of SH3BP2 using gene chip method, or reagents for detecting the mRNA expression level of SH3BP2 using high-throughput sequencing method; The reagents for detecting the amount of SH3BP2 protein include: reagents for detecting the protein expression level of biomarker SH3BP2 using Western blot method, reagents for detecting the protein expression level of marker SH3BP2 using ELISA method, or reagents for detecting the protein expression level of biomarker SH3BP2 using mass spectrometry method.
7. The use according to claim 6, characterized in that The reagent for detecting the mRNA expression level of SH3BP2 using quantitative RT-PCR method includes a quantitative RT-PCR primer pair for detecting the mRNA of SH3BP2; the sequences of the quantitative RT-PCR primer pair for detecting the mRNA of SH3BP2 are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively; The reagent for detecting the protein expression level of marker SH3BP2 using Western blot method or the reagent for detecting the protein expression level of marker SH3BP2 using ELISA method includes an antibody for detecting SH3BP2.
8. The use according to claim 2, characterized in that The reagent for detecting the expression level of biomarker Sp1 is a reagent for detecting the amount of mRNA generated after transcription of the Sp1 gene or a reagent for detecting the amount of Sp1 protein.
9. The use according to claim 8, characterized in that The reagents for detecting the amount of mRNA generated after transcription of the Sp1 gene include: reagents for detecting the mRNA expression level of Sp1 using quantitative RT-PCR method, reagents for detecting the mRNA expression level of Sp1 using gene chip method, or reagents for detecting the mRNA expression level of Sp1 using high-throughput sequencing method; The reagents for detecting the amount of Sp1 protein include: reagents for detecting the protein expression level of Sp1 using Western blot method, reagents for detecting the protein expression level of Sp1 using ELISA method, or reagents for detecting the protein expression level of Sp1 using mass spectrometry method.
10. The use according to claim 9, characterized in that The reagent for detecting the mRNA expression level of Sp1 using quantitative RT-PCR method includes a quantitative RT-PCR primer pair for detecting the mRNA of Sp1; the sequences of the quantitative RT-PCR primer pair for detecting the mRNA of Sp1 are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively; The reagent for detecting the protein expression level of Sp1 using Western blot method or the reagent for detecting the protein expression level of Sp1 using ELISA method includes an antibody for detecting Sp1 protein.
11. Use of an oncolytic virus in the preparation of a reagent for reducing the expression level of the SH3BP2 gene in malignant tumor cells or tissues, wherein the oncolytic virus is oncolytic herpes simplex virus, the oncolytic herpes simplex virus is oHSV-1, and the malignant tumor is glioma.
Citation Information
Patent Citations
Application of TSPO (Translocator Protein) in treatment of brain glioma and recombinant herpes simplex virus as well as preparation method and application of recombinant herpes simplex virus
CN108004216A
Human glioma cell line and establishment method and applications thereof
CN109609460A
Application of oncolytic viruses in the treatment of uveal melanoma, markers of treatment efficacy and their detection reagents
CN111850126B
Cited By
Biomarker for predicting oncolytic activity of oncolytic virus and application of biomarker
CN121802042A