Potato u6 gene promoter stu6 8-1 and cloning and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to potato U6 RNA polymerase III type promoters, and particularly to StU6 8-1 gene promoters, and further discloses cloning methods and applications thereof. The application clones potato RNA polymerase III type promoters StU6 8-1 in potatoes, and the promoters have high transcription activity, can drive downstream sgRNA expression, and the activity of the two promoters and the feasibility of the two promoters in potato CRISPR / Cas9 gene editing are verified through Nicotiana benthamiana leaf transient transformation and potato stable transformation systems, and CRISPR / Cas9 guided potato genome editing is realized. In the technical field of transgenic technology, the promoters are not only suitable for potatoes, but also can be applied to tobacco and other solanaceous crops.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically the field of plant transgenic technology, and more specifically to the cloning and application of the potato U6 promoter. Background Technology

[0002] The potato (Solanum tuberosum) is the world's fourth largest food crop, after rice, corn, and wheat. Cultivated potato varieties are primarily tetraploid (2n=4x=48), propagating vegetatively through tubers. While self-pollinating, they exhibit self-depression and self-incompatibility. Potato breeding primarily relies on traditional hybridization breeding, which involves creating hybrid combinations using parents with good combining ability, identifying the traits of the resulting seed offspring, and then selecting new varieties. Therefore, the breeding cycle for new potato varieties is long, the selected traits are highly random, and it is difficult to simultaneously achieve important traits such as yield, quality, and stress resistance. There is an urgent need for efficient technologies for the genetic improvement of potatoes.

[0003] In early 2013, CRISPR / Cas9 technology (Clustered Regularly Interspaced Short Palindromic Repeat-associated protein 9) was developed and successfully applied to gene editing in animal cells (Cong et al., 2013; Ran et al., 2013). Due to its advantages such as high editing efficiency, ease of operation, and low off-target rate, several CRISPR / Cas9 systems for plant gene editing were developed and applied in 2013 (Miao et al., 2013; Jiang et al., 2013; Shan et al., 2013), subsequently leading to the rapid development and application of plant CRISPR / Cas9 systems. Although CRISPR / Cas9 technology has been widely used in crop functional gene and genetic improvement research, most related research has focused on diploid crops. The genomes of some important food crops and economic crops are polyploid, which places higher demands on the efficiency of CRISPR / Cas9 systems. Currently, CRISPR / Cas9 technology has been used for the genetic improvement of traits in polyploid crops such as wheat, switchgrass, soybean, and strawberry (Wang et al., 2014; Cai et al., 2018; Liu et al., 2018; Martín-Pizarro et al., 2019). Therefore, developing efficient CRISPR / Cas9 technology for tetraploid potato cultivars will not only contribute to the study of potato gene function but also provide new tools for future genetic engineering improvements in potatoes.

[0004] In the CRISPR / Cas9 system, the U6 snRNA (Small nuclear RNA) promoter is a type III RNA polymerase promoter found in the cell nucleus, commonly used to drive sgRNA expression within the nucleus. U6 promoters exhibit species specificity; using endogenous U6 promoters from the plant species itself can achieve higher editing efficiency during gene editing. Currently, research on endogenous U6 promoters suitable for potato gene editing is limited, and applicable potato U6 promoters are still lacking, restricting the application of potato gene editing technology. Therefore, screening and studying highly active U6 promoters in potatoes plays a crucial role in advancing the genetic engineering improvement of potatoes.

[0005] Therefore, the purpose of this invention is to provide the potato U6 promoter StU6 8-1, and further disclose its cloning method and application.

[0006] The potato U6 promoter provided by this invention is StU6 8-1; the DNA nucleotide sequence of the StU6 8-1 promoter is shown in SEQ ID No:2. The StU6 8-1 promoter is derived from potato chromosome 8.

[0007] The present invention also provides a cloning method for cloning the above-mentioned potato StU6 8-1 promoter, comprising the following steps: (1) Using the genomic DNA of leaves of potato cultivar 'Qingshu 9' as a template, PCR amplification was performed using specific primers of StU6 8-1. The high-fidelity enzyme PhantaR Max was used for PCR amplification in a 25 μL reaction system. The PCR reaction program was: 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s, 30 cycles, and then 72℃ for 5 min. The obtained PCR product was purified by agarose gel excision. (2) The purified PCR product was cloned into the pEASYR-Blunt cloning vector, transformed into Escherichia coli DH5α, and single clones were picked to extract plasmids for sequencing analysis to obtain a 511 bp StU6 8-1 gene promoter fragment (as shown in SEQ ID No:2).

[0008] The specific primers for StU6 8-1 are as follows: StU6 8-1pF: AATTGACGGGTAGACATCA, StU6 8-1pR: CAGACATATAGGTTAATGTTTTG.

[0009] The present invention also discloses an sgRNA expression cassette vector for constructing potato gene editing vectors, namely containing the potato U6 promoter StU6 8-1.

[0010] Specifically, the potato sgRNA expression cassette vector is the recombinant plasmid StU6 8-1-sgRNA.

[0011] This invention also provides a method for constructing an sgRNA expression cassette vector for potato gene editing vectors, comprising the following steps: (1) Using the StU6 8-1 gene promoter sequence shown in SEQ ID No:2 as a template, the StU6 8-1 gene promoter was amplified by PCR using the following primers containing homologous arms: StU6 8-1gF:GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA; StU6 8-1gR: TGTTATCTTCAGAGGTTCTCCAGACATATAGGTTAATGTTTTG; The PCR product was purified to obtain the StU6 8-1 gene promoter fragment containing the homologous arm; (2) Using pYLsgRNA-AtU6-1 plasmid as a template, PCR was performed with primers sgRNA-F and sgRNA-R to delete the AtU6-1 gene promoter in pYLsgRNA-AtU6-1 plasmid and linearize the plasmid. The primer sequences are as follows: sgRNA-F: AGAGACCTCTGAAGATAACA; sgRNA-R: TCCTTTGCTGCCGATTCCAC; PCR amplification was performed using the high-fidelity enzyme PhantaR Max in a 25 μL reaction system. The PCR reaction program was: 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 3:30 s, 30 cycles, and then 72℃ for 5 min. The obtained PCR product was purified by agarose gel excision to obtain the linearized pYLsgRNA plasmid. (3) The StU6 8-1 gene promoter fragment containing homologous arms described in step (1) was recombined into the linearized pYLsgRNA plasmid described in step (2) using ExnaseRII recombinase to obtain the sgRNA expression cassette vector StU6 8-1-sgRNA used for potato gene editing vector.

[0012] The application of the potato U6 promoter StU6 8-1 in transgenic technology of Solanaceae plants or in the construction of gene editing vectors for Solanaceae plants. Solanaceae plants include tobacco and potato. The potato StU6 4-1 promoter and StU6 8-1 promoter have transcriptional activity, which can drive the expression of downstream sgRNAs, and have enabled the targeted editing of Tobacco Bengal and potato genes driven by the endogenous U6 promoter in potatoes. Furthermore, it can perform single-site or multi-site gene editing on the target genes.

[0013] The above-mentioned sgRNA expression cassette vectors are used in transgenic technology of Solanaceae plants or in the construction of gene editing vectors for Solanaceae plants. Solanaceae plants include tobacco and potato.

[0014] This invention cloned two novel potato U6 promoters and constructed StU64-1-sgRNA and StU68-1-sgRNA expression cassette vectors for potato gene editing. Gene editing vectors for NbPDS (Tobacco Bengal) and StPDS (Potato) were constructed using these two vectors. Transient transformation of NbPDS leaves and stable transformation of embryogenic callus in potato stem segments verified the activity of the two U6 promoters and their feasibility for application in CRISPR / Cas9 technology for tobacco and potatoes. This enabled single-target and multi-target CRISPR / Cas9 gene editing of target genes in potatoes and tobacco, thereby achieving efficient and targeted genetic improvement and germplasm innovation in potatoes or other Solanaceae crops. In gene editing operations, the StU64-1 and StU68-1 promoters can be used to drive the expression of single-target sgRNA (as in Example 3) or multiple-target sgRNA (as in Example 4), thus achieving single-target or multi-gene (multi-target) gene editing.

[0015] Figure 1 The StU6 4-1 promoter and StU6 8-1 promoter were cloned from the potato leaf genome.

[0016] Figure 2 Schematic diagram of the StU6 4-1-sgRNA vector and the StU6 8-1-sgRNA vector constructed by homologous recombination.

[0017] Figure 3 Identification of StU6 4-1-sgRNA and StU6 8-1-sgRNA vectors by BsaI restriction enzyme digestion.

[0018] Figure 4 : Schematic diagram of the vector used for NbPDS gene editing in tobacco Benzodiazepines. The nucleic acid sequence in the diagram represents the gene editing target of NbPDS.

[0019] Figure 5Sequencing peak diagram and sequencing results of NbPDS gene editing mutation in Tobacco Benzoenta spp.; Sequencing results show that transformation with StU6 4-1 / NbPDS-Cas9 and StU6 8-1 / NbPDS-Cas9 vectors can cause base deletion mutations in the NbPDS gene sequence.

[0020] Figure 6 : Schematic diagram of the vector used for potato StPDS gene editing. In the diagram, T1 and T2 represent gene editing target sequences driven by two potato U6 promoters, respectively.

[0021] Figure 7 Sequencing peak diagram and sequencing results of potato StPDS gene editing sequence mutations. The sequencing results show that after the StPDS-Cas9 vector was transferred into embryogenic callus of potato stem segments, the potato StPDS gene sequence was altered, with base deletions or insertions occurring at both gene editing target sites.

[0022] To further understand the present invention, the following description, in conjunction with implementation examples, illustrates the two potato U6 promoters provided by the present invention, their cloning, and their applications. The scope of protection of the present invention is not limited to the following implementation examples.

[0023] The specific steps for obtaining the two U6 gene promoters, StU6 4-1 and StU6 8-1, from potato are as follows: 1. Using the Arabidopsis thaliana AtU6-1 gene sequence, BlastN alignment was performed in the potato genome database (http: / / spuddb.uga.edu / dm_v6_1_download.sht-ml) to identify the typical U6 gene sequence in potato. The typical potato U6 gene sequence differed from the Arabidopsis thaliana AtU6-1 gene sequence by only 3 SNPs, indicating that the U6 gene sequence is relatively conserved between potato and Arabidopsis. Both the potato U6 gene promoter sequence and the Arabidopsis thaliana AtU6-1 gene promoter sequence possess the typical TATA box and USE motif, two typical cis-regulatory elements. Ultimately, the StU6 4-1 and StU6 8-1 promoters were selected for cloning.

[0024] 2. Design primers for sequence cloning based on the StU6 4-1 and StU6 8-1 promoter reference sequences.

[0025] The following primers were designed for cloning the StU6 4-1 promoter: StU6 4-1pF: GGGCTTCACTGTGAATTTAG; StU6 4-1pR:CAAACACATATGTTGTTGTTGA; The following specific primers were designed for the StU6 8-1 promoter: StU6 8-1pF:AATTGACGGGTAGACATCA; StU6 8-1pR: CAGACATATAGGTTAATGTTTTG; 3. Using the primers described above, and with genomic DNA from leaves of the potato cultivar 'Qingshu 9' as a template, PCR amplification was performed using the high-fidelity enzyme PhantaR Max. The PCR reaction volume was 25 μL. The PCR reaction program was 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s, for 30 cycles, followed by 72℃ for 5 min. The obtained PCR product was purified by agarose gel extraction (e.g., ...). Figure 1 (As shown). The purified PCR fragment was ligated into the pEASYR-Blunt cloning vector, transformed into E. coli DH5α, and single colonies were picked. Plasmids were extracted from positive clones for sequencing analysis. The 466 bp StU6 4-1 gene promoter fragment shown in SEQ ID No:1 and the 511 bp StU6 8-1 gene promoter fragment shown in SEQ ID No:2 were obtained.

[0026] The construction of potato StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors is as follows: 1. Using the 466 bp StU6 4-1 gene promoter fragment shown in SEQ ID No:1 and the 511 bp StU6 8-1 gene promoter fragment shown in SEQ ID No:2 as templates, the following primers containing homologous arms were designed to perform PCR amplification of the StU6 4-1 gene promoter and the StU6 8-1 gene promoter, respectively: StU6 4-1gF:GTGGAATCGGCAGCAAAGGAGGGCTTCACTGTGAATTTAG; StU6 4-1gR: TGTTATCTTCAGAGGTCTCTCAAACACATATGTTGTTGTTGA; StU6 8-1gF:GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA; StU6 8-1gR: TGTTATCTTCAGAGGTTCTCCAGACATATAGGTTAATGTTTTG; 2. PCR amplification was performed using the high-fidelity enzyme PhantaR Max. The PCR reaction volume was 25 μL. The PCR reaction program was 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s, for 30 cycles, followed by 72℃ for 5 min. The obtained PCR product was purified by agarose gel excision.

[0027] 3. Using pYLsgRNA-AtU6-1 plasmid as a template, primers sgRNA-F and sgRNA-R were designed for PCR to delete the AtU6-1 gene promoter in the pYLsgRNA-AtU6-1 plasmid and linearize the plasmid. The primer sequences are as follows: sgRNA-F: AGAGACCTCTGAAGATAACA; sgRNA-R: TCCTTTGCTGCCGATTCCAC; PCR amplification was performed using the high-fidelity enzyme PhantaR Max. The PCR reaction volume was 50 μL. The PCR reaction program was 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 3:30 min, for 30 cycles, followed by 72℃ for 5 min. The obtained PCR product was purified by agarose gel excision to obtain the linearized pYLsgRNA plasmid fragment.

[0028] 4. The StU6 4-1 promoter fragment and StU6 8-1 promoter fragment containing homologous arm sequences obtained in step 2 were ligated into the linearized pYLsgRNA plasmid obtained in step 3 via homologous recombination. The homologous recombination reaction was performed using ExnaseRII recombinase, with a reaction volume of 20 μL. The reaction system consisted of 2 μL ExnaseRII recombinase, 4 μL 5×CEbuffer, 2 μL linearized pYLsgRNA plasmid, 1 μL promoter fragment containing homologous arm U6, and 11 μL ddH2O. The homologous recombination reaction was carried out at 37℃ for 40 min, followed by 2 min on ice. Then, 10 μL of the homologous recombination product was transformed into E. coli DH5α, and single colonies were picked. The plasmids in the positive clones were extracted for sequencing analysis. Potato StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors were obtained.

[0029] 5. The StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors constructed through homologous recombination should each contain 3 BsaI restriction sites (e.g., Figure 2(As shown), therefore, the accuracy of the expression cassette vectors was verified by digesting them with BsaI. After BsaI single-enzyme digestion, both the StU6 4-1-sgRNA and StU6 8-1-sgRNA expression cassette vectors were digested into 3 bands, consistent with the theoretical expectation (e.g., Figure 3 As shown in the figure, this further illustrates the accuracy of the construction of the two potato U6 promoter expression cassette vectors.

[0030] The specific steps for constructing the NbPDS gene editing vector in Tobacco Bunsenior and mutating the NbPDS gene sequence are as follows: 1. Design of NbPDS gene editing target sites and preparation of target adapters Based on the NbPDS gene sequence of Nicotiana benthamiana, TACGAGAACTGCAGTCCACG was selected as the target site sequence, and a target adapter primer pair was designed based on this sequence: The following primer pairs were designed for the target site linked to the StU6 4-1 promoter: NbPDS-4-F: TTTGTACGAGAACTGCAGTCCACG; NbPDS-4-R: AAACCGTGGACTGCAGTTCTCGTA; The following primer pairs were designed for the target site linked to the StU6 8-1 promoter: NbPDS-8-F:TCTGTACGAGAACTGCAGTCCACG; NbPDS-8-R: AAACCGTGGACTGCAGTTCTCGTA; Dissolve the above-mentioned adapter primers to prepare a 100 μM stock solution. Take 1 μL of each paired primer and add it to 98 μL of 0.5×TE solution to dilute to 1 μM. Anneal at 90℃ for 30 s, then cool to room temperature to complete the annealing process.

[0031] 2. Take 1 μg each of StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmids, digest them with 10 U Bsa I in 25 μL of the reaction for 20 min, and freeze the digested products at -20℃.

[0032] 3. Construction of NbPDS single-target gene editing vector in Nicotiana benthamiana The target adapters obtained in step 1 and the digested products of the StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmids obtained in step 2 were ligated using T4 DNA ligase to obtain fragments of StU6 4-1 promoter-target-sgRNA and StU6 8-1 promoter-target-sgRNA, respectively. Using a 'die-while-ligating' method (Ma et al., 2015), the fragments of StU64-1 promoter-target-sgRNA and StU6 8-1 promoter-target-sgRNA were ligated into the 35S-Cas9-Kana vector, resulting in two single-target NbPDS gene editing vectors: StU6 4-1 / NbPDS-Cas9 and StU6 8-1 / NbPDS-Cas9.

[0033] 4. Transient transformation of Tobacco Benedict's leaves into NbPDS gene-editing vector The StU6 4-1 / NbPDS-Cas9 and StU6 8-1 / NbPDS-Cas9 gene editing vectors were transformed into Agrobacterium LBA4404 cells using a freeze-thaw method. The LBA4404 bacterial suspensions containing the StU6 4-1 / NbPDS-Cas9 and StU6 8-1 / NbPDS-Cas9 gene editing vectors were then cultured by shaking, and the bacterial concentration was adjusted to OD using bacterial injection buffer. 600 =1.0, an appropriate amount of Agrobacterium tumefaciens bacterial solution was drawn up with a syringe and injected into the interior of the leaf through the lower epidermis of Nicotiana benthamiana. Five days after injection, the NbPDS gene target sequence at the injection site was sequenced and analyzed.

[0034] 5. Sequencing analysis of NbPDS gene target site sequences DNA was extracted from leaves of *Nicotiana benthamiana* using the CTAB method with the following primers: NbPDS-F: GGAAGTGGCTGAACGATAT; NbPDS-R: TACCATGCTAAACTACGC; The NbPDS gene fragment in transiently transformed *Nicotiana benthamiana* leaves was amplified by PCR, and the PCR product was purified. Sanger sequencing was performed on the PCR product using primer NbPDS-F. If the sequencing results showed nested peaks near the target site, gene editing at the NbPDS gene target site was considered to have occurred (e.g., ...). Figure 5(As shown). The gene-edited NbPDS gene fragment was ligated into the pEASYR-Blunt cloning vector, then transformed into *E. coli* DH5α. Single colonies were picked, and plasmids were extracted from positive clones for sequencing analysis. By comparing with the wild-type NbPDS gene sequence, the specific mutation patterns of the NbPDS target sites in leaves transformed with the *StU6 4-1 / NbPDS-Cas9* and *StU6 8-1 / NbPDS-Cas9* gene-editing vectors were analyzed. Figure 5 As shown, transformation with the StU6 4-1 / NbPDS-Cas9 and StU6 8-1 / NbPDS-Cas9 gene editing vectors can lead to gene editing at the NbPDS gene target site, with the gene editing type being base deletion.

[0035] The specific steps for constructing a potato StPDS dual-target gene editing vector and mutating the StPDS sequence are as follows: 1. Cloning of the StPDS gene sequence Genomic DNA was extracted from leaves of potato variety 'Qingshu 9' using the CTAB method. The following primers were designed based on the potato StPDS gene reference sequence: StPDS-F: ATGCCTCAAATTGGACTTGT; StPDS-R:TATGAAACAGACCCTACCCC; Using the primers described above, and employing the high-fidelity enzyme PhantaR Max, PCR amplification was performed in a 25 μL system using potato leaf DNA as a template. The PCR reaction program was: 95℃ for 3 min; 95℃ for 30 s, 54℃ for 30 s, 72℃ for 1:30 min, 30 cycles, followed by 72℃ for 5 min. The PCR products were detected by agarose gel electrophoresis and purified by gel excision. Sanger sequencing of the PCR products was performed using primers StPDS-seqF and StPDS-seqR. The primer sequences are as follows: StPDS-seqF: GGCTTGCAAAATACTGTACT; StPDS-seqR:GCTTCCTTCGAAATAAAGCA; Finally, the StPDS gene sequence information was obtained.

[0036] 2. StPDS gene editing target site design and target adapter preparation Based on the StPDS gene sequence obtained in step 1, two gene editing target sites were selected: sequence T1 located in exon 1: CCATGCCACGACCAGAAGAT, and sequence T2 located in exon 3: AACCGATACTACTGGAGGCA. Target adapter primers were designed based on the T1 and T2 sequences. The following primer pairs were designed for the T1 target site linked to the StU6 4-1 promoter: StPDS-4-F: TTTGCCATGCCACGACCAGAAGAT; StPDS-4-R:AAACATCTTCTGGTCGTGGCATGG; The following primer pairs were designed for the T2 target site linked to the StU6 8-1 promoter: StPDS-8-F:TCTGAACCGATACTACTGGAGGCA; StPDS-8-R: AAACTGCCTCCAGTAGTATCGGTT; Dissolve the above-mentioned adapter primers to prepare a 100 μM stock solution. Take 1 μL of each paired primer and add it to 98 μL of 0.5×TE solution to dilute to 1 μM. Anneal at 90℃ for 30 s, then cool to room temperature to complete the annealing process.

[0037] 3. Take 1 μg each of StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmids, digest them with 10 U Bsa I in 25 μL of the reaction for 20 min, and freeze the digested products at -20℃.

[0038] 4. Construction of potato StPDS dual-target gene editing vector The target adapters obtained in step 2 and the digested products of the StU6 4-1-sgRNA and StU6 8-1-sgRNA plasmids obtained in step 3 were ligated using T4 DNA ligase to obtain fragments of StU6 4-1 promoter-target T1-sgRNA and StU6 8-1 promoter-target T2-sgRNA, respectively. Using a 'die-while-ligating' method (Ma et al., 2015), the fragments of StU6 4-1 promoter-target T1-sgRNA and StU6 8-1 promoter-target T2-sgRNA were sequentially ligated into the 35S-Cas9-Kana vector, ultimately obtaining the StPDS-Cas9 dual-target gene editing vector, in which the T1 target site-sgRNA is driven by the StU6 4-1 promoter, and the T2 target site-sgRNA is driven by the StU6 8-1 promoter (e.g., ...). Figure 6 (As shown).

[0039] 5. Stable transformation of potato stem segment callus The StPDS-Cas9 dual-target gene editing vector was transformed into Agrobacterium LBA4404 via a freeze-thaw method. The LBA4404 bacterial culture containing the StPDS-Cas9 vector was shaken and resuspended in MS liquid medium to an OD concentration. 600 =0.5. Stem segments of potato variety D187 tissue culture seedlings were used as explants for Agrobacterium infection. The stem segment explants were co-cultured for 2 days, then cultured for approximately 30 days on a Kana-containing resistant callus induction medium, followed by approximately 30 days on a Kana-containing shoot induction medium. Finally, embryogenic resistant callus tissue in the differentiation stage was obtained.

[0040] 6. Sequencing analysis of StPDS gene target site sequences Embryogenic resistance callus DNA was extracted from potato stem segments using the CTAB method. PCR amplification was performed using StPDS-F and StPDS-R primers, and the PCR products were purified. Sanger sequencing was performed on the StPDS target sites T1 and T2 using primers StPDS-seqF and StPDS-seqR, respectively. If nested peaks were observed near the target sites in the sequencing results, gene editing at the StPDS gene target sites was considered to have occurred (e.g., ...). Figure 7 (As shown). The gene-edited StPDS gene fragment was ligated into the pEASYR-Blunt cloning vector, then transformed into *E. coli* DH5α. Single colonies were picked, and plasmids were extracted from positive clones for Sanger sequencing analysis. By comparing with the wild-type StPDS gene sequence, the specific mutation patterns of the StPDS target sites in the resistant callus transformed with the StPDS-Cas9 gene-editing vector were analyzed. Figure 7 As shown, transformation with the StPDS-Cas9 gene editing vector can lead to gene editing at the two target sites T1 and T2 of the StPDS gene in potato resistant callus, with the gene editing type being either base deletion or base insertion.

[0041] As can be seen, the potato StU6 4-1 promoter and StU6 8-1 promoter obtained in this invention possess transcriptional activity, can drive downstream sgRNA expression, and achieve targeted editing of Tobacco Bengal and potato genes driven by the potato endogenous U6 promoter. Furthermore, it allows for single-site or multi-site gene editing of the target gene. Sequencing of the target site clones after gene editing revealed mutation types including base insertion and base deletion. Therefore, the two potato endogenous U6 promoters described in this invention can be applied not only to potatoes but also to the CRISPR / Cas9 gene editing system for tobacco, thereby achieving efficient and precise genetic improvement of traits in Solanaceae crops such as tobacco and potatoes.

[0042] The above description is merely a preferred embodiment of the present invention, and while it is quite specific and detailed, it should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various improvements without departing from the principles of the present invention, and these improvements should also be considered within the scope of protection of the present invention.

Claims

1. A potato U6 promoter sequence, characterized in that: The potato U6 promoter is StU6 8-1; the DNA nucleotide sequence of the StU6 8-1 promoter is shown in SEQ ID No:

2.

2. An sgRNA expression cassette vector for constructing potato gene editing vectors, characterized in that: It contains the potato U6 promoter StU6 8-1 as described in claim 1.

3. The cloning method for the potato U6 promoter as described in claim 1, characterized in that: Includes the following steps: (1) Using the genomic DNA of leaves of potato cultivar 'Qingshu 9' as a template, PCR amplification was performed using specific primers of StU6 8-1. The high-fidelity enzyme PhantaR Max was used for PCR amplification in a 25 μL reaction system. The PCR reaction program was: 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s, 30 cycles, and then 72℃ for 5 min. The obtained PCR product was purified by agarose gel excision. (2) The purified PCR product was cloned into the pEASYR-Blunt cloning vector, transformed into Escherichia coli DH5α, and single clones were picked to extract plasmids for sequencing analysis to obtain a 511 bp StU6 8-1 gene promoter fragment.

4. The cloning method as described in claim 3, characterized in that: The specific primers for StU6 8-1 are as follows: StU6 8-1pF:AATTGACGGGTAGACATCA; StU6 8-1pR: CAGACATATAGGTTAATGTTTTG.

5. The sgRNA expression cassette vector as described in claim 2, characterized in that: The sgRNA expression cassette vector is the recombinant plasmid StU6 8-1-sgRNA, and its construction method includes the following steps: (1) Using the StU6 8-1 gene promoter sequence shown in SEQ ID No:2 as a template, the StU6 8-1 gene promoter was amplified by PCR using the following primers containing homologous arms: StU6 8-1gF:GTGGAATCGGCAGCAAAGGAAATTGACGGGTAGACATCA; StU6 8-1gR: TGTTATCTTCAGAGGTTCTCCAGACATATAGGTTAATGTTTTG; The PCR product was purified to obtain the StU6 8-1 gene promoter fragment containing the homologous arm; (2) Using pYLsgRNA-AtU6-1 plasmid as a template, PCR was performed with primers sgRNA-F and sgRNA-R to delete the AtU6-1 gene promoter in pYLsgRNA-AtU6-1 plasmid and linearize the plasmid. The primer sequences are as follows: sgRNA-F: AGAGACCTCTGAAGATAACA; sgRNA-R: TCCTTTGCTGCCGATTCCAC; PCR amplification was performed using the high-fidelity enzyme PhantaR Max in a 25 μL reaction system. The PCR reaction program was: 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 3:30 s, 30 cycles, and then 72℃ for 5 min. The obtained PCR product was purified by agarose gel excision to obtain the linearized pYLsgRNA plasmid. (3) The StU6 8-1 gene promoter fragment containing homologous arms described in step (1) was recombined into the linearized pYLsgRNA plasmid described in step (2) using ExnaseRII recombinase to obtain the sgRNA expression cassette vector StU6 8-1-sgRNA used for potato gene editing vector.

6. The application of the potato U6 promoter StU6 8-1 as described in claim 1 in transgenic technology of Solanaceae plants or in the construction of gene editing vectors for Solanaceae plants, characterized in that, Solanaceae plants include Nicotiana benthamiana and potatoes.

7. The application of the sgRNA expression cassette vector as described in claim 2 or 5 in the transgenic technology of Solanaceae plants or in the construction of gene editing vectors for Solanaceae plants, characterized in that the Solanaceae plants include Nicotiana benthamiana and potato.

Images