Perovskite silica composite nanoparticles, methods of making and nucleic acid detection methods
By growing perovskite crystals inside mesoporous silica nanoparticles and forming a PbBr(OH) protective coating, the photostability problem of perovskite nanocrystals in polar solvents and harsh environments was solved, and perovskite-silica composite nanoparticles with high photostability and high fluorescence intensity were prepared, which are suitable for nucleic acid detection.
Patent Information
- Application Number
- CN202410057736.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-16
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2044-01-16
AI Technical Summary
Traditional perovskite nanocrystals exhibit poor photostability in polar solvents and harsh environments (such as thermal cycling, ultrasound, and ultraviolet irradiation), affecting the accuracy and stability of detection results.
By growing perovskite crystals inside mesoporous silica nanoparticles and forming a PbBr(OH) protective coating on their surface, perovskite-silica composite nanoparticles with ultra-high photostability were prepared by utilizing the high specific surface area of mesoporous silica and the effect of reactive additives.
It improves the photostability of perovskite nanocrystals in polar solvents and harsh environments, enhances fluorescence intensity and dispersibility, and is suitable for digital single-particle counting analysis and nucleic acid detection.
Smart Images

Figure CN117866629B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biotechnology, and mainly to a perovskite silica composite nanoparticle, its preparation method, and a nucleic acid detection method. Background Technology
[0002] In recent years, analytical methods based on digital single-particle counting have been widely used in the field of biochemical detection. Reactions between nano- or micron-sized particles in liquid-phase reaction systems also exhibit high reaction efficiency. Furthermore, since information from a single particle represents a corresponding detection signal, complex signal amplification processes are avoided. Therefore, in digital quantitative analysis using single nanoparticles or microspheres as reporter molecules, physical separation of the reaction system (micropores or droplets) is often unnecessary, offering advantages such as ease of operation, low cost, and high sensitivity. Analysis based on particle size or fluorescence signals is a common detection method for single-particle counting. This type of detection method typically requires sufficiently large particle sizes (usually micron-sized) or high and stable fluorescence intensity. Although particle size-based counting analysis is convenient and low-cost, its reaction rate in solution is significantly limited compared to smaller particles. Additionally, single-size analysis has poor specificity and is easily affected by impurities. Fluorescence-based analysis, on the other hand, has stronger specificity, and through the additive effect of fluorescence, the particle size can be reduced to the nanometer level, thereby effectively improving reaction efficiency.
[0003] Traditional organic dyes suffer from poor photostability, low quantum yield, and are prone to quenching, especially under strong excitation light irradiation. Fluorescence quenching can lead to deviations in particle counting analysis based on fluorescence signals, thus affecting the accuracy and stability of detection results. In contrast, quantum dots, due to their high quantum yield, broad excitation-narrow emission spectrum, large Stokes shift, and resistance to photobleaching, are increasingly being used in biomedical detection. As a novel quantum dot material, lead halide perovskite nanocrystals possess easily tunable radiation spectra, narrower emission spectra, and higher color purity. However, due to the inherent properties of ionic crystals, lead halide perovskite nanocrystals are highly sensitive to water, and are easily degraded by conditions such as ultrasound, high temperature, and light irradiation. These factors limit their application, especially in the field of biochemical detection, as biochemical detection processes are typically carried out in aqueous solutions and are frequently exposed to environments with ultrasound, temperature changes, and ultraviolet irradiation.
[0004] Although researchers have proposed various methods to improve the photostability of lead halide perovskite nanocrystals in recent years, including polymer coating, inorganic substrate loading, and inorganic-organic hybrid loading, these methods cannot completely address the environmental factors that affect the poor photostability of lead halide perovskite nanocrystals. Therefore, the problems of traditional perovskite nanocrystals' sensitivity to polar solvents and poor photostability under harsh environments (thermal cycling, ultrasound, ultraviolet irradiation, etc.) remain unresolved.
[0005] Therefore, existing technologies still need to be improved and developed. Summary of the Invention
[0006] In view of the shortcomings of the prior art, the purpose of this application is to provide a perovskite silica composite nanoparticle, its preparation method and nucleic acid detection method, aiming to solve the problem of poor photostability of existing traditional perovskite nanocrystals under harsh environments (thermal cycling, ultrasound, ultraviolet irradiation, etc.).
[0007] The technical solution of this application is as follows:
[0008] A method for preparing perovskite-silica composite nanoparticles, comprising the following steps:
[0009] Prepare the precursor solution;
[0010] Prepare a solution of mesoporous silica nanoparticles;
[0011] The precursor solution and the mesoporous silica nanoparticle solution were mixed, and a reaction additive was added to obtain mesoporous silica nanoparticles loaded with the precursor.
[0012] Cleaning is performed to remove excess precursor from the surface of the mesoporous silica nanoparticles loaded with the precursor.
[0013] The first drying, the first grinding, and sintering process cause the precursor supported on the mesoporous silica nanoparticles to form perovskite crystals.
[0014] The material is ground a second time, washed several times with water, and then dried a second time.
[0015] By utilizing the high specific surface area and suitable mesopore size of mesoporous silica nanoparticles, perovskite crystals were grown inside the mesoporous silica nanoparticles. Through sintering, the perovskite crystals were encapsulated within the mesoporous structure of the mesoporous silica nanoparticles. Furthermore, by utilizing the reaction additives added in the early stage of the reaction, combined with subsequent water washing, a more stable PbBr(OH) protective coating was formed on the surface of the perovskite-silica composite nanoparticles. This successfully prepared green fluorescent nanoparticles with ultra-high photostability, solving the problem of poor photostability of traditional perovskite nanocrystals under polar solvent sensitivity and harsh environments (thermal cycling, ultrasound, ultraviolet irradiation, etc.).
[0016] The method for preparing perovskite silica composite nanoparticles, wherein the particle size of the mesoporous silica nanoparticles is between 100-300 nm, and the pore size of the mesoporous silica nanoparticles is 2-4 nm.
[0017] The particle size of the mesoporous silica nanoparticles is preferably between 100-300 nm. If the size is too small, the prepared perovskite silica composite nanoparticles are prone to agglomeration; if the size is too large, it is not conducive to subsequent applications. Specifically, the pore size of the mesopores in the mesoporous silica nanoparticles is preferably 2-4 nm. The mesopore size cannot be too large, as this can easily lead to incomplete closure of the mesopores during subsequent sintering, resulting in a decrease in luminescence intensity and stability. If the mesopore size is too small, there is insufficient space to support the perovskite crystals.
[0018] The method for preparing perovskite silica composite nanoparticles, wherein in the step of preparing the mesoporous silica nanoparticle solution, 2-2.8 mL of water is added for every 125 mg of the mesoporous silica nanoparticles;
[0019] In the step of mixing the precursor solution and the mesoporous silica nanoparticle solution, 5.8-6.2 mL of the precursor solution with a concentration of 10 mM-15 mM is added for every 125 mg of the mesoporous silica nanoparticles.
[0020] The method for preparing perovskite silica composite nanoparticles, wherein the reaction additive is a strong base-weak acid salt.
[0021] The method for preparing the perovskite silica composite nanoparticles, wherein the reaction additive is K2CO3, and 120 μL of K2CO3 solution with a concentration of 0.25-0.4 M is added for every 125 mg of the mesoporous silica nanoparticles.
[0022] The method for preparing the perovskite silica composite nanoparticles, wherein the sintering process is sintering at 500 °C for 30 min in an air atmosphere.
[0023] The method for preparing perovskite silica composite nanoparticles, wherein the first grinding and the second grinding are both performed until no visible lumps remain;
[0024] Both the first drying and the second drying were carried out at 80 °C.
[0025] The method for preparing perovskite silica composite nanoparticles, wherein each water washing process involves adding the sample that has undergone the second grinding to water, shaking at room temperature for more than 30 minutes, and then centrifuging to recover the sample.
[0026] For every 10-20 mg of the second-milled sample, add 1 mL of the water.
[0027] A perovskite-silica composite nanoparticle, wherein the perovskite-silica composite nanoparticle is prepared by the method described above for preparing perovskite-silica composite nanoparticles.
[0028] A nucleic acid detection method, comprising the following steps:
[0029] The first nucleic acid probe was coupled onto the perovskite silica composite nanoparticles as described above to prepare fluorescent nanoparticles labeled with the first nucleic acid probe.
[0030] A second nucleic acid probe is coupled onto a magnetic bead to prepare magnetic beads labeled with the second nucleic acid probe, wherein the first nucleic acid probe and the second nucleic acid probe can hybridize;
[0031] Detection: Fluorescent nanoparticles labeled with the first nucleic acid probe and the sample to be tested were added to the buffer solution and incubated for the first time; magnetic beads labeled with the second nucleic acid probe were added and incubated for the second time; the free magnetic beads labeled with the second nucleic acid probe were separated by magnetic separation, the supernatant was collected, and the fluorescent nanoparticles in the supernatant were counted and analyzed using a flow cytometer.
[0032] Beneficial effects: The method for preparing perovskite-silica composite nanoparticles provided in this application prepares green fluorescent nanoparticles with ultra-high photostability, which solves the problem of poor photostability of traditional perovskite nanocrystals under polar solvent sensitivity and harsh environments (thermal cycling, ultrasound, ultraviolet irradiation, etc.). Attached Figure Description
[0033] Figure 1The images shown are transmission electron microscope (TEM) images of blank mesoporous silica and perovskite silica composite nanoparticles, as well as EDS energy dispersive spectroscopy (EDS) surface scans, from Example 1 of this application.
[0034] Figure 2 The image shows the XRD pattern of the perovskite-silica composite nanoparticles in Example 1 of this application.
[0035] Figure 3 The figure shows the results of the N2 desorption experiment on mesoporous silica nanoparticles (MSNs) and perovskite silica composite nanoparticles (CsM-H) in Example 1 of this application.
[0036] Figure 4 This is a graph showing the detection results of the quantum yield of the perovskite-silica composite nanoparticles prepared in Example 1 of this application.
[0037] Figure 5 This is an XRD comparison image of the sample in Example 1 of this application that has undergone sintering and grinding but has not been treated with aqueous solution, and the perovskite silica composite nanoparticles.
[0038] Figure 6 This is an XRD comparison diagram of the sample prepared without the addition of K2CO3 in Example 1 of this application, which was sintered and ground but not treated with aqueous solution, and the sample treated with aqueous solution.
[0039] Figure 7 This is a graph showing the test results of the fluorescence stability of the perovskite silica composite nanoparticles prepared in Example 1 in this application.
[0040] Figure 8 This is a flowchart illustrating the nucleic acid detection method in Embodiment 1 of this application.
[0041] Figure 9 This is a graph showing the detection results of targets at different concentrations in Example 1 of this application.
[0042] Figure 10 This is a linear fitting graph of the CsM-H quantity and target concentration in Example 1 of this application.
[0043] Figure 11 This is a comparison chart of the detection results of the target substance in Example 1 of this application with those of other common detection substances.
[0044] Figure 12 This is a graph showing the detection results of testing multiple consecutive blank samples in Example 1 of this application. Detailed Implementation
[0045] This application provides perovskite silica composite nanoparticles, their preparation method, and a nucleic acid detection method. To make the objectives, technical solutions, and effects of this application clearer and more explicit, the following provides a more detailed description. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.
[0046] Mesoporous silica possesses abundant and inexpensive raw materials, high chemical and thermal stability, rich surface functional groups, simple functionalization operations, and adjustable particle size and mesopore dimensions, making it a perfect carrier for supporting lead halide perovskite nanocrystals. Therefore, this application proposes using mesoporous silica nanoparticles as a carrier to generate lead halide perovskite nanocrystals in situ. In the presence of reactive additives, through sintering and sealing followed by a protective coating, ultra-stable, high-brightness perovskite-silica composite nanoparticles suitable for digital single-particle counting analysis were prepared for the first time. These nanoparticles can also be used for the quantitative detection of the tumor-related biomarker miRNA21.
[0047] Specifically, the preparation method of the perovskite silica composite nanoparticles of this application includes the following steps:
[0048] (1) Prepare the precursor solution.
[0049] Specifically, the salt required for preparing perovskite crystals is fully dissolved under thorough stirring to obtain a clear precursor solution.
[0050] The precursor solution is a perovskite precursor solution. The salt required for the perovskite crystal can be a salt containing elements such as Cs, Pb, and Br. Different salts can be used to prepare the precursor solution depending on the desired perovskite crystal; this is prior art and will not be elaborated here. In the embodiments of this application, the synthesized perovskite crystal is CsPbBr3, and the precursor solution is a mixture of CsBr and PbBr2, with a molar ratio of the three elements in the precursor solution of Cs:Pb:Br = 1:1:3.
[0051] During the stirring process, the solution can be heated to accelerate its evaporation. In the embodiments of this application, stirring is carried out at 80 °C until the salt is fully dissolved. Fluctuations in the heating temperature within a certain range do not affect the experimental results; it can be between 70-90 °C.
[0052] (2) Prepare a solution of mesoporous silica nanoparticles.
[0053] Specifically, mesoporous silica nanoparticles are added to ultrapure water and dispersed evenly under ultrasonication to obtain a mesoporous silica nanoparticle solution.
[0054] In this application, the particle size of the mesoporous silica nanoparticles is preferably between 100-300 nm. If the size is too small, the prepared perovskite silica composite nanoparticles are prone to agglomeration; if the size is too large, it is not conducive to subsequent applications. The pore size of the mesoporous silica nanoparticles is preferably 2-4 nm. The size of the mesopores cannot be too large, as this can easily lead to incomplete closure of the mesopores during subsequent sintering, affecting the luminescence intensity and photostability. If the mesopore size is too small, there is insufficient space to support the perovskite crystals.
[0055] For every 125 mg of mesoporous silica nanoparticles, 2-2.8 mL of water can be added, and for every 125 mg of mesoporous silica nanoparticles, 5.8-6.2 mL of a precursor solution with a concentration of 10 mM-15 mM can be added. By controlling the amount of mesoporous silica and the concentration of the prepared precursor solution between 10 mM and 15 mM, it is possible to avoid the final loading and quantum yield being too low, and to avoid the excess precursor being too high, which would increase the difficulty of subsequent cleaning; incomplete cleaning of the surface precursor can easily lead to the adhesion of nanoparticles after sintering.
[0056] (3) Mix the precursor solution and the mesoporous silica nanoparticle solution, add reaction additives, and obtain mesoporous silica nanoparticles loaded with precursor.
[0057] Specifically, the precursor solution and the mesoporous silica nanoparticle solution are mixed evenly and continuously stirred at 80 °C to allow the precursor solution to enter the mesopores of the mesoporous silica nanoparticles; a reaction additive is added, and the mixture is stirred continuously at 80 °C until the mixed solution is evaporated to dryness to obtain the sample, which is the mesoporous silica nanoparticles loaded with the precursor.
[0058] The reaction additive is a strong base-weak acid salt, such as potassium carbonate, sodium carbonate, or sodium citrate. The reaction additive acts as a pore-sealing agent, reducing precursor loss during subsequent ethanol rinsing. Furthermore, using a strong base-weak acid salt as the reaction additive provides a weakly alkaline environment, which plays a crucial role in the formation of PbBr(OH) during the subsequent water washing step. In the embodiments of this application, the reaction additive is K₂CO₃, and its concentration can be adjusted between 0.25-0.4 M. For every 125 mg of mesoporous silica nanoparticles, 120 μL of a 0.25-0.4 M K₂CO₃ solution can be added. Too low a concentration can lead to poor initial pore-sealing and low quantum yield; too high a concentration may compete for the mesoporous space of the precursor in silica, also resulting in a decrease in quantum yield.
[0059] During stirring, the solution can be heated to accelerate its evaporation. In the embodiments of this application, stirring is carried out at 80 °C. Fluctuations in the heating temperature within a certain range do not affect the experimental results; it can be between 70-90 °C.
[0060] (4) Cleaning: Remove excess precursors from the surface of the mesoporous silica nanoparticles loaded with precursors.
[0061] Specifically, mesoporous silica nanoparticles loaded with precursors were collected into centrifuge tubes and washed several times with anhydrous ethanol to remove excess precursors from the surface of the mesoporous silica nanoparticles until the mesoporous silica nanoparticles loaded with precursors turned white.
[0062] This cleaning step can remove excess precursors from the surface of mesoporous silica nanoparticles, preventing them from sticking together after subsequent sintering, which would affect their dispersibility and morphology.
[0063] (5) The first drying, the first grinding, and sintering cause the precursor loaded with mesoporous silica nanoparticles to form perovskite crystals.
[0064] Specifically, white mesoporous silica nanoparticles loaded with precursors are placed in an oven until fully dried. The mesoporous silica nanoparticles loaded with precursors are then ground into fine powder in a mortar and transferred to a crucible for sintering, and the precursors form perovskite crystals.
[0065] In this application, all drying steps are performed in an 80°C oven, which allows for faster sample drying. However, the drying temperature cannot be too high, as excessively high temperatures may cause perovskite crystals to fail, as they accelerate oxidation and weaken fluorescence.
[0066] During the first grinding, grinding is sufficient until there are no visible lumps. No limit is set on the particle size of fine powder in this application. The purpose of the first grinding is to prevent the product powder from agglomerating during the subsequent sintering process.
[0067] During the sintering process, sintering at 500 °C for 30 min in air is required. Changes in sintering temperature have a significant impact on product properties, and the sintering temperature needs to be controlled at 500 °C. Furthermore, 30 min is the optimal sintering time; too short a time may lead to poor crystallization, while extending the time does not have a significant beneficial effect and instead increases the overall preparation time. Products sintered under these conditions exhibit the best quantum yield, emission spectrum, and microstructure. Excessively high temperatures cause the perovskite silica composite nanoparticles to adhere to each other and reduce dispersibility, while excessively low sintering temperatures result in low quantum yields and a significant blue shift in the emission spectrum.
[0068] (7) Grind for the second time, wash with water several times, and dry for the second time.
[0069] Specifically, after the fine powder cools, it is transferred to a mortar for a second grinding. After thorough grinding, the powder is washed several times with water and then dried a second time to obtain perovskite silica composite nanoparticles with a protective layer structure.
[0070] During the second grinding, the grinding should continue until no visible lumps remain. No limit is set on the particle size of the fine powder in this application. The purpose of the second grinding is to prevent the product powder from clumping during subsequent washing and drying.
[0071] Washing several times with water ensures complete reaction and formation of PbBr(OH) on the surface of the perovskite silica composite nanoparticles. Generally, excess water is used for each wash; in this embodiment, 1 mL of water is added for every 10-20 mg of fine powder. Each wash process involves adding the fine powder to water, shaking at room temperature for at least 30 minutes, and then centrifuging to recover the fine powder.
[0072] This application also provides a perovskite silica composite nanoparticle, which is prepared by the above-described method for preparing perovskite silica composite nanoparticles.
[0073] The method for preparing perovskite-silica composite nanoparticles provided in this application has the following advantages:
[0074] (1) Taking advantage of the high specific surface area and suitable mesopore size of mesoporous silica nanoparticles, perovskite crystals (CsPbBr3) were grown inside the mesoporous silica nanoparticles. Through sintering, the perovskite crystals were sealed in the mesoporous structure of the mesoporous silica nanoparticles. At the same time, by taking advantage of the reaction additives added in the early stage of the reaction and combined with the subsequent water washing treatment, a more stable PbBr(OH) protective coating was formed on the surface of the perovskite silica composite nanoparticles. Green fluorescent nanoparticles with ultra-high photostability were successfully prepared, which solved the problem of poor photostability of traditional perovskite nanocrystals under polar solvent sensitivity and harsh environments (thermal cycling, ultrasound, ultraviolet irradiation, etc.).
[0075] (2) The constructed perovskite silica composite nanoparticles have the characteristics of good dispersibility, high quantum yield, narrow emission spectrum and strong fluorescence stability. In order to broaden the application of perovskite quantum dots in the detection field, the surface of the above perovskite silica composite nanoparticles can be modified with nucleic acid probes and combined with magnetic microspheres modified with nucleic acid probes. Taking advantage of the high reaction efficiency of perovskite silica composite nanoparticles in solution, an enzyme-free, wash-free and highly specific nucleic acid quantitative detection platform can be constructed.
[0076] This application also provides a nucleic acid detection method, which uses commercially available avidin-coated magnetic beads (ThermoFisher) to label nucleic acid probes and adapts them to the perovskite silica composite nanoparticles prepared above to construct a nucleic acid detection platform.
[0077] Specifically, the nucleic acid testing method of this application includes the following steps:
[0078] (1) A first nucleic acid probe is coupled onto perovskite-silica composite nanoparticles to prepare fluorescent nanoparticles labeled with the first nucleic acid probe. This includes the following steps:
[0079] The perovskite-silica composite nanoparticles were resuspended in anhydrous ethanol and treated with the silanizing agent APTES for 24 h to acquire amino functional groups on the surface of the perovskite-silica composite nanoparticles. After rinsing with anhydrous ethanol and water, they were resuspended in anhydrous ethanol. This step is a routine experimental procedure and will not be described in detail here.
[0080] A layer of polyacrylic acid (PAA) is coated onto the surface of perovskite-silica composite nanoparticles via electrostatic adsorption, thereby introducing carboxyl functional groups onto the surface of the perovskite-silica composite nanoparticles. This step is a routine experimental procedure and will not be described in detail here.
[0081] After activating the carboxyl groups on the surface of perovskite silica composite nanoparticles with 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC), they were reacted with an amino-modified first nucleic acid probe to obtain fluorescent nanoparticles labeled with the first nucleic acid probe. After rinsing to remove excess first nucleic acid probe, the nanoparticles were resuspended in PBS-T buffer (PBS buffer containing 0.1% Triton X-100) and stored at 4 °C. The activation reaction was a routine experimental procedure and will not be described in detail here.
[0082] Experiments revealed that altering the volume of nucleic acid probe input can change the probe density on the particle surface, which in turn affects subsequent detection performance. 40 μg of perovskite silica composite nanoparticles with carboxyl functional groups were added to 0.5 μL, 2 μL, and 8 μL of a 100 μM amino-modified first nucleic acid probe solution, respectively. The 2 μL probe input resulted in fluorescent nanoparticles labeled with the first nucleic acid probe exhibiting the best detection performance. Therefore, in this embodiment, 2 μL of a 100 μM amino-modified first nucleic acid probe solution was added to every 40 μg of perovskite silica composite nanoparticles with carboxyl functional groups for reaction.
[0083] (2) The second nucleic acid probe is coupled to a magnetic bead to prepare magnetic beads labeled with the second nucleic acid probe, wherein hybridization can occur between the first and second nucleic acid probes. Specifically, this includes the following steps:
[0084] The magnetic beads were washed three times with B&W buffer, rinsed twice with rinsing solution, and rinsed once with 0.1 M NaCl.
[0085] Resuspend the magnetic beads in 2×B&W buffer, add a biotin-modified second nucleic acid probe, incubate at room temperature for more than 30 minutes, and couple the second nucleic acid probe to the surface of the magnetic beads using the biotin-avidin system.
[0086] Wash the magnetic beads labeled with the second nucleic acid probe three times or more with PBS-T buffer to remove excess free second nucleic acid probe. Resuspend the washed magnetic beads labeled with the second nucleic acid probe in 1% BSA solution and incubate at room temperature for 30 min or at 4 °C overnight to block the surface sites and reduce non-specific adsorption in subsequent applications.
[0087] Wash with PBS-T buffer, resuspend, and store at 4°C until use.
[0088] The B&W buffer contains 5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, and 2 M NaCl.
[0089] The rinsing solution contains 0.15 M NaOH and 0.1 M NaCl.
[0090] Experiments revealed that altering the concentration of the nucleic acid probe could affect subsequent detection results. The procedure for each experiment was as follows: 80 μL of MB was washed three times with B&W buffer, twice with rinsing buffer, and once with 0.1 M NaCl. The MB was then resuspended in 150 μL of 2×B&W buffer, and 10 μL of biotin-labeled second nucleic acid probe solutions of different concentrations (10 μM to 100 μM) were added. Subsequent processing steps were the same. Detection results were verified, showing that the detection performance of MB labeled with the second nucleic acid probe initially improved and then deteriorated when the concentration of the second nucleic acid probe solution was between 10 μM and 100 μM, reaching the best effect at 50 μM. Therefore, in this embodiment, after washing 80 μL of MB (10 mg / mL) and resuspending it in 150 μL of 2×B&W buffer, 10 μL of 50 μM biotin-labeled second nucleic acid probe solution was added for the reaction.
[0091] (3) Testing. This includes the following steps:
[0092] Add fluorescent nanoparticles labeled with the first nucleic acid probe and the sample to be tested to 2×PBS-T buffer, and incubate for the first time;
[0093] Add magnetic beads labeled with a second nucleic acid probe and incubate a second time;
[0094] Free magnetic beads labeled with the second nucleic acid probe were separated by magnetic separation, and the supernatant was collected. The fluorescent nanoparticles labeled with the first nucleic acid probe in the supernatant were counted and analyzed using a flow cytometer.
[0095] The first incubation process can be carried out at 25 ℃ for 1 hour. The second incubation process can be carried out at 30 ℃ for 1 hour.
[0096] In this step, for every 0.1 μg of fluorescent nanoparticles labeled with the first nucleic acid probe, 25 μg of magnetic beads labeled with the second nucleic acid probe can be added. This ratio is the optimal ratio obtained through experimental optimization. At this ratio, higher detection sensitivity can be achieved while maintaining low nonspecificity.
[0097] The concentration range of the sample to be tested can be 1-1000 pM, meaning that the nucleic acid detection method provided in this application can detect samples within the range of 1-1000 pM. This nucleic acid detection method, for the first time, combines prepared monodisperse, high-brightness perovskite silica composite nanoparticles with a flow cytometry platform. By rapidly and accurately counting and statistically analyzing the perovskite silica composite nanoparticles, accurate quantitative analysis of the target analyte is achieved.
[0098] The present application will be further described below through specific embodiments.
[0099] In Example 1, the nucleic acid sequences involved are shown in Table 1.
[0100] Table 1
[0101] name sequence Modification Probe1 CTGATAAGCTATTTTTTTTTTTTTTTTTTTT <![CDATA[3’NH2-C6]]> Probe2 TTTTTTTTTTTTTTTTTTTTTCAACATCAGT 5' Biotin-TEG miRNA21 UAGCUUAUCAGACUGAUGUUGA - SM-miRNA21 UAGCUUAUCAGACUGAUCUUGA - TM-miRNA21 UACCUUAUCACACUGAUCUUGA - miRNA141 UAACACUGUCUGGUAAAGAUGG - miRNA155 UUAAUGCUAAUCGUGAUAGGGGUU - NC DNA CGAATTTTTGGAGGAAGGAGG - ;
[0102] Example 1 (1) Preparation of perovskite silica composite nanoparticles (CsM-H) with a surface protective coating
[0103] A mixed solution containing 12 mM CsBr and 12 mM PbBr2 was prepared and stirred at 80 °C for 30 min until fully dissolved, yielding a clear precursor solution A. 125 mg of mesoporous silica nanoparticles (average particle size 150 nm, mesopore size approximately 3 nm) were added to 2.4 mL of ultrapure water and dispersed thoroughly under sonication to obtain solution B. 6 mL of precursor solution A was added to solution B, and the mixture was stirred continuously at 80 °C for 20 min to allow precursor solution A to enter the mesoporous structure. Subsequently, 120 μL of 0.3 M K2CO3 solution was added to the mixture, and stirring was continued at 80 °C until the mixture evaporated to dryness. The sample was collected in a centrifuge tube and washed several times with anhydrous ethanol to remove excess precursor from the surface until the sample changed from orange-yellow to white. The obtained white sample was placed in an 80 ℃ oven until fully dried. After grinding the sample into a fine powder in a mortar (without obvious lumps), it was transferred to a crucible and sintered at 500 ℃ for 30 min in air. After the fine powder cooled, it was transferred back to a mortar and ground into a fine powder (without obvious lumps). Then, water was added (1 mL of water for every 10 mg of powder), and the mixture was shaken at room temperature for at least 30 min. The fine powder was then recovered by centrifugation. After several water washings, the fine powder was placed in an 80 ℃ oven until dry and recovered to obtain perovskite silica composite nanoparticles with a protective layer structure (denoted as CsM-H).
[0104] Figures 1-4 This demonstrates the perovskite-silica composite nanoparticles successfully prepared in Example 1.
[0105] Figure 1 The results of transmission electron microscopy (TEM) images and EDS (energy dispersive spectroscopy) surface scanning spectroscopy show that perovskite crystals are uniformly distributed within the mesoporous silica nanoparticles. Figure 1 Image a is a transmission electron microscope image of blank mesoporous silica. No perovskite crystals are visible inside the mesoporous silica. Figure 1 Image b is a transmission electron microscope image of perovskite-silica composite nanoparticles (CsM-H) loaded with perovskite nanocrystals. The change in internal contrast indicates that the perovskite nanocrystals were successfully loaded. Figure 1 In the image, c is a high-resolution magnified image of b. The crystal lattice can be observed and the interplanar spacing of 0.41 nm can be measured, which is consistent with the (-111) crystal plane of CsPbBr3 crystal. Figure 1 In the middle, d represents the EDS surface scan result of the CsM-H sample, showing that elements such as Cs, Pb, Br, and K are uniformly distributed and coincide with Si and O elements, suggesting that perovskite crystals are uniformly dispersed inside mesoporous silica.
[0106] Figure 2The image shows the XRD pattern of perovskite-silica composite nanoparticles (CsM-H). X-ray diffraction (XRD) further confirmed that the internal crystallization conforms to the orthorhombic crystal system of CsPbBr3, and the presence of the PbBr(OH) phase is also visible. Literature confirms that PbBr(OH) exhibits stronger stability and can further improve the stability of CsPbBr3 crystals. The formation of the PbBr(OH) phase is due to the weakly alkaline environment provided by the K2CO3 added in the previous reaction. In the presence of water, CsPbBr3 can transform into PbBr(OH), coating the surface of the CsPbBr3 crystal to form a protective layer, further enhancing the photostability of the perovskite-silica composite nanoparticles.
[0107] Figure 3 The figure shows the results of N2 desorption-adsorption experiments on mesoporous silica nanoparticles (MSNs) and perovskite silica composite nanoparticles (CsM-H). The results show that the specific surface area and mesopore size of mesoporous silica decreased significantly before and after synthesis, further indicating that CsPbBr3 crystals do indeed grow inside the mesoporous pores.
[0108] Figure 4 The graph shows the detection results of the quantum yield of the perovskite-silica composite nanoparticles prepared in Example 1. Figure 4 As shown, the quantum yield of the perovskite silica composite nanoparticles prepared in Example 1 reached 86.5%, which is a relatively high level.
[0109] XRD analysis was performed on the sample prepared in Example 1, which underwent sintering and grinding but not aqueous solution treatment, and perovskite silica composite nanoparticles (CsM-H). The results are as follows: Figure 5 As shown, "after" represents perovskite silica composite nanoparticles (CsM-H), and "before" represents the sample prepared in Example 1 that underwent sintering and grinding but was not treated with aqueous solution. Comparing the XRD results of the sintered and ground samples before and after water treatment reveals that before water treatment, only the CsPbBr3-related crystalline phase was present in the sample, and no PbBr(OH)-related crystalline phase was observed; however, after water treatment, a significant PbBr(OH) phase was observed.
[0110] Meanwhile, to verify the role of the reaction additive (K2CO3), XRD analysis was performed on samples prepared without K2CO3 (after sintering and grinding but without aqueous solution treatment) and samples treated with aqueous solution (except for the absence of K2CO3, the preparation process was the same as in Example 1). The results are as follows... Figure 6As shown, "before" represents a sintered and ground sample prepared without added K2CO3 but without aqueous solution treatment, while "after" represents a sintered and ground sample prepared without added K2CO3 and treated with aqueous solution. The differences in XRD patterns before and after water treatment were compared in the absence of reactive additives. Figure 6 It can be seen that, firstly, due to the lack of K2CO3 as a sealing agent, the rinsing with anhydrous ethanol before sintering leads to the loss of a large amount of precursor, resulting in poor crystallinity of the perovskite during later sintering, thus causing weak diffraction peak intensity; secondly, the comparison shows that the sample without K2CO3 added during the preparation process did not form PbBr(OH) (two characteristic peaks near 34°) after water treatment, indicating the key role of K2CO3 in the formation process of this phase.
[0111] (2) CsM-H photostability characterization
[0112] To demonstrate the fluorescence stability of CsM-H prepared in this embodiment, CsM-H was stored in deionized water. Figure 7 a) Applying ultrasound (40 kHz) to deionized water ( Figure 7 (b) Irradiate deionized water with ultraviolet light (1mW / cm²). 2 () Figure 7 c) Thermal circulation is performed in deionized water (25 ℃-100 ℃) Figure 7 After treatment for the corresponding time (d), the fluorescence intensity of CsM-H was measured. The results are as follows: Figure 7 As shown, a) is the fluorescence intensity test result of CsM-H after different storage times in water (0 days, 1 day, 3 days, 7 days, 14 days, 21 days, 36 days, 72 days); b) is the fluorescence intensity test result of CsM-H after different ultrasonic treatment times (0 minutes, 10 minutes, 20 minutes, 30 minutes, 50 minutes, 70 minutes, 90 minutes); c) is the fluorescence intensity test result of CsM-H after different UV irradiation times (0 hours, 1 hour, 2 hours, 4 hours, 6 hours, 8 hours, 12 hours, 16 hours, 20 hours, 24 hours); and d) is the fluorescence intensity test result of CsM-H after different thermal cycling times (0 cycles, 3 cycles, 5 cycles, 10 cycles, 15 cycles, 20 cycles). Figure 7As can be seen, after 72 days of storage in aqueous solution, the fluorescence intensity of CsM-H remained almost unchanged; even under more severe environments (ultrasound, ultraviolet irradiation, thermal cycling), the fluorescence intensity of CsM-H still showed no significant change, ultimately maintaining more than 98% of its initial fluorescence intensity. This demonstrates that the perovskite silica composite nanoparticles prepared in this application exhibit excellent photostability, stronger environmental adaptability and compatibility, and can broaden their applications in various fields.
[0113] (3) CsM-H surface marking
[0114] 10 mg of CsM-H was resuspended in 4.5 mL of anhydrous ethanol, and 0.5 mL of the silanizing reagent APTES was added. The mixture was reacted at 50 °C for 24 h with continuous stirring. After the reaction was complete, the mixture was washed with anhydrous ethanol and water, and then resuspended in 5 mL of anhydrous ethanol. Under sonication, 2 mL of 5 mg / mL PAA solution was added to the above solution, followed by stirring for 10 min. The product was washed three times with water and resuspended in water to prepare a 10 mg / mL suspension.
[0115] Resuspend 40 μg of the above product in 80 μL of MEST (100 mM, pH 4.5, containing 0.1% Tween-20). Add 10 μL of freshly prepared 10 mg / mL EDC solution and 2 μL of 100 μM amino-modified nucleic acid probe solution (Probe1). Incubate at room temperature with shaking for 30 min, then add another 10 μL of freshly prepared 10 mg / mL EDC solution and continue the reaction for 2 h. Wash the product with PBST and 0.1% SDS to remove excess nucleic acid probe, then resuspend in PBS-T buffer (PBS buffer containing 0.1% Triton X-100) and store at 4 °C. CsM-H labeled with the nucleic acid probe (Probe1) is designated CsM-H@Probe1.
[0116] (4) Preparation of magnetic microspheres labeled with surface probes
[0117] Using commercially available avidin-coated magnetic beads (Thermo Fisher), 80 μL of MB (10 mg / mL) was washed three times with B&W buffer (5 mM Tris-HCl (pH 7.5), 0.5 mM EDTA, 2 M NaCl), then twice with solution A (0.15 M NaOH, 0.1 M NaCl), and then once with solution B (0.1 M NaCl). After resuspending in 150 μL of 2×B&W, 10 μL of 50 μM biotin-labeled nucleic acid probe solution (Probe2) was added, and the reaction was carried out with shaking at room temperature. After 30 minutes of reaction, the sample was washed three times with PBS-T (PBS containing 0.1% Triton X-100) to remove excess biotinylated nucleic acid probe. Non-specific binding sites were blocked with 1% BSA solution at 25 °C for 30 min. After multiple washes with PBS-T, the sample was resuspended in 400 μL of PBS-T and stored at 4 °C. MB labeled with a nucleic acid probe (Probe2) is denoted as MB@Probe2.
[0118] (5) Nucleic acid detection platform based on CsM-H counting
[0119] The assay was performed in 2×PBS (2×PBS-T) buffer containing 0.1% Triton X-100. The total reaction volume was 100 μL, and the reaction mixture contained 0.1 μg CsM-H@Probe1, 25 μg MB@probe2, and the test sample. The concentration of the test sample varied depending on the assay.
[0120] Figure 8 A schematic flowchart of the nucleic acid detection method of this application is shown. Specifically, 32.5 μL of CsM-H@Probe1, 50 μL of 3×PBS-T, and 5 μL of the target (miRNA21) are added to a 1.5 mL Eppendorf centrifuge tube and incubated with shaking at 25 °C for 60 minutes to allow hybridization between the target and the nucleic acid probe Probe1. Then, 12.5 μL of MB@Probe2 is added, and the resulting mixture is incubated for another 3 hours. After incubation, free CsM-H@Probe1 is separated from the reaction mixture by magnetic separation, and the supernatant is collected for particle counting analysis using flow cytometry. This method indirectly reflects the concentration of the target by counting CsM-H@Probe1 particles in solution that did not participate in the formation of the CsM-H@Probe1-target-MB@Probe2 sandwich structure. Figure 9The graph shows the detection results of supernatants collected at different target concentrations using flow cytometry. As can be seen from the graph, the number of CsM-H@Probe1 particles detected in the supernatant gradually decreases with increasing target concentration, indicating an inverse relationship between target concentration and the number of CsM-H@Probe1 particles, and possibly a linear relationship. Here, CR represents the counting reference, indicating the count result of the supernatant without MB @Probe2 and the target in the test tube; Blank represents the count result of the supernatant without the target in the test tube; 100 pM and 5 nM represent the count results of the supernatant containing 100 pM and 5 nM of the target, respectively.
[0121] Figure 10 The linear fit plot of CsM-H quantity versus target concentration is shown below. Figure 10 As shown, the amount of CsM-H remaining in the supernatant is proportional to the target concentration (target concentrations of 1 pM, 2.5 pM, 10 pM, 25 pM, 100 pM, 250 pM, and 1000 pM), and the linearity of the fit is relatively high (R0). 2 =0.99), and the calculated detection limit is 0.79 pM. According to the reference, when detecting low-concentration targets, the capture process of CsM-H@Probe1 by MB@Probe2 follows a Poisson distribution and conforms to the following formula:
[0122] ;
[0123] Wherein, ANTC represents the average number of target molecules bound to each CsM-H@Probe1 particle, and N... sample This indicates the counting results of the supernatant in test tubes containing samples of different concentrations; N CR This indicates the counting result of the supernatant in the counting reference test tube (a test tube containing only CsM-H@Probe1, but not MB@Probe2 and the target), used to calibrate the initial total amount of CsM-H@Probe1 in the test tube; P Negative This indicates the negative rate.
[0124] Using the same technique as step (5), the other common detection substances (SM-miRNA21, TM-miRNA21, miRNA141, miRNA155, NCDNA) besides the target substance (miRNA21) were detected. 5 μL of each sample was taken and detected according to step (5), with a concentration of 100 pM for each sample. Results are as follows: Figure 11As shown, at the same concentration, common detection agents with sequences similar to the target did not lead to significant nonspecific results. Even when the SM-miRNA21 sequence differed from the target miRNA21 by only one base, it showed good differentiation. This demonstrates that the nucleic acid detection method provided in this application has extremely high specificity.
[0125] Figure 12 To repeatedly test blank samples using the nucleic acid detection method proposed in this application, and to compare the particle count differences between the blank samples and the counting reference samples, the results are as follows: Figure 12 As shown, repeated tests demonstrate that the detection platform exhibits stable and low nonspecific capture rates, with a nonspecific capture rate of approximately 2-3%, which ensures the stability and reliability of the detection.
[0126] It should be understood that the application of this application is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of this application.
Claims
1. A nucleic acid detection method, characterized in that, Includes the following steps: A first nucleic acid probe was coupled onto perovskite silica composite nanoparticles to prepare fluorescent nanoparticles labeled with the first nucleic acid probe. A second nucleic acid probe is coupled onto a magnetic bead to prepare magnetic beads labeled with the second nucleic acid probe, wherein the first nucleic acid probe and the second nucleic acid probe can hybridize; Detection: Fluorescent nanoparticles labeled with the first nucleic acid probe and the sample to be tested were added to the buffer solution and incubated for the first time; magnetic beads labeled with the second nucleic acid probe were added and incubated for the second time; the free magnetic beads labeled with the second nucleic acid probe were separated by magnetic separation, the supernatant was collected, and the fluorescent nanoparticles in the supernatant were counted and analyzed using a flow cytometer; The preparation method of the perovskite-silica composite nanoparticles includes the following steps: Prepare a precursor solution, wherein the precursor solution is a perovskite precursor solution; Prepare a solution of mesoporous silica nanoparticles; The precursor solution and the mesoporous silica nanoparticle solution were mixed, and a reaction additive was added to obtain mesoporous silica nanoparticles loaded with the precursor; the reaction additive was K2CO3, and 120 μL of 0.25-0.4M K2CO3 solution was added for every 125 mg of the mesoporous silica nanoparticles. In the step of mixing the precursor solution and the mesoporous silica nanoparticle solution, 5.8-6.2 mL of the precursor solution with a concentration of 10 mM-15 mM is added for every 125 mg of the mesoporous silica. Cleaning is performed to remove excess precursor from the surface of the mesoporous silica nanoparticles loaded with the precursor. The precursor is dried and ground for the first time, and then sintered to form perovskite crystals; the sintering process is carried out at 500°C for 30 minutes in an air atmosphere. The material is ground a second time, washed several times with water, and then dried a second time.
2. The nucleic acid detection method according to claim 1, characterized in that, The mesoporous silica nanoparticles have a particle size between 100-300 nm, and the pore size of the mesoporous silica nanoparticles is 2-4 nm.
3. The nucleic acid detection method according to claim 1, characterized in that, In the step of preparing the mesoporous silica nanoparticle solution, 2-2.8 mL of water is added for every 125 mg of the mesoporous silica nanoparticles.
4. The nucleic acid detection method according to claim 1, characterized in that, Both the first and second grinding processes involve grinding until no visible lumps remain; Both the first drying and the second drying were carried out at 80°C.
5. The nucleic acid detection method according to claim 1, characterized in that, Each water washing process involves adding the sample that has undergone the second grinding to water, shaking at room temperature for at least 30 minutes, and then centrifuging to recover the sample. Add 1 mL of the water to every 10-20 mg of the second-milled sample.