A KASP molecular marker for identifying corn stalk puncture strength and its application

Abstract

The present invention relates to a KASP molecular marker for identifying corn stalk puncture strength and its application. Studies have found that there is a G / A polymorphism on the nucleotide at position 59899287 of chromosome 10 of the corn genome (B73, V4), and the SNP site is significantly associated with the corn stalk puncture strength; a KASP molecular marker related to the stalk puncture strength is developed based on the SNP site. The molecular marker can be used to identify or assist in identifying the stalk puncture resistance, and has a high accuracy rate. The SNP_10_59899287 site of the present invention has a large contribution to the phenotype, and the KASP detection is convenient and has a high throughput. Materials with strong stalk puncture resistance can be quickly screened out for lodging resistance breeding of corn varieties, with a clear selection target, which greatly saves breeding costs.

Description

Technical Field

[0001] The invention relates to a KASP molecular marker for identifying corn stalk puncture strength and application thereof, belonging to the technical field of genetic breeding and molecular biology. Background Art

[0002] Lodging is an important factor affecting corn high yield and mechanized harvesting. Every year, the world's corn yield loss due to lodging reaches 5%-35%. Lodging not only affects corn yield and quality, but also seriously restricts the improvement of mechanized corn harvesting. Therefore, strengthening the genetic research on corn stalk lodging resistance is of great significance to improving the lodging resistance of corn varieties. At present, there is no consensus on the standardized identification of corn lodging resistance. It is generally believed that the morphological characteristics of the puncture strength of the third internode of the corn stalk are important traits reflecting the lodging resistance of corn, and are also important indicators for evaluating the lodging resistance of corn stalks.

[0003] Marker-assisted selection (MAS) is a new technology that has emerged with the rapid development of modern molecular biology technology. It is based on gene cloning or positioning, and uses molecular markers closely linked to the target gene to select test materials. It can select varieties containing target trait genotypes without complex phenotypic collection. This method combines molecular marker technology with traditional breeding. Compared with conventional breeding, it has the advantages of high efficiency, reliability, and safety. It can be selected throughout the crop growth period, greatly shortening the breeding period. With the development and application of molecular marker technology at home and abroad, molecular marker-assisted selection plays an increasingly important role in the selection of varieties that are difficult to identify phenotypes and in the aggregation of multiple excellent traits. Some research progress has been made at home and abroad on maize stalk puncture strength-related loci or QTLs, but because lodging resistance is controlled by multiple genes and has a complex mode of action, different researchers use different population backgrounds for positioning, and the research results are quite different. In addition, these QTLs contribute little to the phenotype and lack stability, making these markers have little potential for application in lodging resistance breeding. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a KASP molecular marker for identifying corn stalk puncture strength and its application. The molecular marker can be used to accurately and quickly identify corn stalk puncture strength in the seedling stage, which can significantly shorten the phenotypic identification cycle and improve breeding efficiency.

[0005] The present invention provides a KASP marker (SNP_10_59899287) for identifying corn stalk puncture strength, wherein the marker corresponds to the 59899287th base of chromosome 10 of the corn reference genome B73 V4 version. In diploid corn plants with strong stalk puncture resistance, the genotype of the 59899287th base of chromosome 10 is GG; in diploid corn plants with weak stalk puncture resistance, the genotype of the 59899287th base of chromosome 10 is AA; in plants with medium stalk puncture resistance, the genotype of the 59899287th base of chromosome 10 is AG.

[0006] The present invention also provides a primer set for identifying KASP molecular markers, wherein the primer set includes Primer-AlleleFAM, Primer-AlleleHEX and Primer-Common.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] A KASP molecular marker for identifying corn stalk puncture strength, wherein the KASP molecular marker corresponds to the base at position 59899287 of chromosome C10 of the corn reference genome B73 V4 version, and the base is G or A.

[0009] The KASP molecular marker is located at the DNA fragments shown in SEQ ID NO.1 and SEQ ID NO.2.

[0010] A primer set for amplifying the KASP molecular marker, the primer set comprising:

[0011] Primer-AlleleFAM:ATGCATTTCCAAAAATACATGATGAACTGA,

[0012] Primer-AlleleHEX:GCATTTCCAAAAATACATGATGAACTGG,

[0013] Primer-Common: CCAAGGAACATAGACATGGTGTTGATAAT.

[0014] The application of the KASP molecular marker in identifying the puncture strength of corn stalks.

[0015] The primer set is used in corn lodging resistance breeding.

[0016] Application of the primer set kit in corn lodging resistance breeding.

[0017] The application of the reagents of the primer set in corn lodging resistance breeding.

[0018] Beneficial effects of the present invention:

[0019] (1) The present invention uses genome-wide association analysis (GWAS) of resequencing natural populations to achieve fine positioning of the target gene and screen out a SNP molecular marker associated with the ability to distinguish corn stalk puncture resistance. The molecular marker is located at nucleotide 59899287 [A or G] on chromosome 10 of corn.

[0020] (2) The present invention develops the site SNP into a KASP molecular marker, which is reliable, easy to operate, and has high throughput, and can accurately perform genotyping on corn. The molecular marker and primer can be used for auxiliary selection in the corn seedling stage, and can quickly and accurately distinguish the puncture resistance of corn stalks, effectively improve the efficiency of corn lodging resistance breeding, and shorten the breeding period. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : Frequency distribution of stem puncture intensity of associated groups;

[0022] Figure 2 : Manhattan plot of the results of genome-wide association analysis of stalk puncture intensity. DETAILED DESCRIPTION

[0023] The specific implementation methods of the present invention are further described in detail below in conjunction with the examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the test methods involved are all conventional methods.

[0024] The present invention constructed an association population of 270 maize inbred lines, performed genotyping using resequencing technology, and completed a genome-wide association analysis based on the phenotypic data of stalk puncture intensity under 4 environments at two points in two years, aiming to locate and screen molecular markers related to stalk puncture intensity, and developed them into KASP for molecular marker-assisted selection, molecular breeding and related gene cloning.

[0025] Example 1 Identification of corn stalk puncture strength of associated populations

[0026] The association population used was 270 core maize inbred lines from home and abroad. The plant stalk strength tester (YYD-1A produced by Zhejiang Top Instrument Co., Ltd.) was used to measure the puncture strength of the third internode of maize stalks in the populations under Yuanyang and Dancheng environments for two consecutive years in 2021 and 2022. The multi-year and multi-point phenotypic data were processed using the best linear unbiased estimate (BLUP); according to the formula: heritability = genotype variance / phenotypic variance, where genotype variance = (468.52-17.01) / 2; phenotypic variance

[0027] =[(468.52-17.01) / 2]+17.01; the heritability of the puncture intensity of the third internode was 0.93, indicating that the puncture intensity of the third internode was mainly determined by genetic factors.

[0028] The results of the maize stalk puncture intensity distribution in the association population showed that the trait was continuously normally distributed, proving that stalk puncture intensity is a quantitative trait controlled by multiple genes (see Figure 1 ).

[0029] Table 1 Analysis of variance of stem puncture intensity in associated populations

[0030]

[0031] Among them, within-environment blocks represent: between 2 blocks under 4 environments; between genotypes represent: between 270 materials; between environments represent: between 4 environments; genotype × environment represents: between genotype and environment interactions.

[0032] Example 2 Extraction of total DNA from leaves of related populations

[0033] The total DNA of the leaves of each cross of the associated population was extracted using the CTAB method. The specific method is as follows:

[0034] a) Cut 0.1-0.2 g of young leaves into a mortar, grind quickly into powder using liquid nitrogen, and put into a 2 mL centrifuge tube;

[0035] b) Add 700 μL of preheated DNA extraction solution; mix well and place in a 65°C water bath for 30 min, gently inverting and mixing every 10-15 min;

[0036] c) Add 700 μL of plant DNA extraction mixture (phenol: chloroform: isoamyl alcohol = 25:24:1, volume ratio), gently invert and mix for 10 minutes; centrifuge at 12000×g for 10 minutes at room temperature;

[0037] d) Pipette the supernatant into a new 2 mL centrifuge tube; add an equal volume of mixed solution (chloroform: isoamyl alcohol = 24:1, volume ratio), mix by inversion for 10 min, let stand for 5 min, centrifuge at 12000×g for 10 min, and pipette the supernatant into a new 2 mL centrifuge tube;

[0038] e) Add 2 volumes of anhydrous ethanol, mix well, let stand at -20°C for 2 hours, centrifuge at 12000×g for 10 minutes, and discard the supernatant; then add 500 μL of pre-cooled 75% ethanol to wash the precipitate, and discard the supernatant; after washing the precipitate twice in succession, dry it;

[0039] f) Add 50 μL of 2% RNase A solution, let stand at 37°C for 1 hour, and then let stand at 4°C overnight; extract the DNA solution again with an equal volume of mixed solution (chloroform:isoamyl alcohol=24:1), invert and mix, let stand for 10 minutes, centrifuge at 12000×g for 15 minutes to remove RNase A, and aspirate about 30 μL of supernatant;

[0040] g) using 0.8-1.0% agarose gel electrophoresis and Nanodrop 2000 spectrophotometer to detect DNA concentration, quality and integrity;

[0041] h) Determine that the 260 / 280 ratio of absorbance for each DNA sample is between 1.8 and 2.0.

[0042] After the DNA concentration test is qualified, it is stored in a -20℃ refrigerator for future use, and the material DNA is genotyped using a simplified resequencing method.

[0043] Example 3 Genome-wide association analysis of corn stalk puncture intensity

[0044] Based on the phenotypic and genotypic data of the obtained population, the Q+K model in the mixed linear model (MLM) in Tassel 5.0 software was used for genome-wide association analysis. The results showed that, except for chromosome C8, a total of 57 significantly associated SNPs were detected on the other nine chromosomes of maize (P<9.89×10 -5 ), phenotypic contribution rate: 6.32-16.78% ( Figure 2 ).

[0045] Figure 2 The horizontal axis represents the SNPs arranged in order of position on different chromosomes, and the vertical axis is the -log of the SNP 10 (P) value, the horizontal line represents the threshold of significance level (-log 10 (P) = 4.00), points above the horizontal line represent SNPs that are significantly associated with stem penetration intensity.

[0046] Among the 57 significantly associated SNPs, the most significant SNP site on C10 (SNP_10_59899287) with the highest contribution to the phenotype corresponds to base G or A at position 59899287 on chromosome 10 of the maize genome (B73, V4).

[0047] The genotypes of this locus in 270 maize inbred lines were analyzed and divided into three types of variation (Table 2). Among them, the genotype of SNP_10_59899287 was GG inbred line, and its average stalk puncture strength was 62.08N / mm 2 ; The genotype is AA inbred line, and its average stem puncture strength is 27.77N / mm 2; The average stem puncture strength of the AG inbred line is 33.92N / mm 2 Therefore, the genotype of SNP_10_59899287 can be used to pre-evaluate the stalk puncture strength of the corn to be tested to speed up breeding.

[0048] Table 2 Statistics of genotype and phenotype data of SNP_10_59899287 in the association population

[0049]

[0050] Example 4 Development of KASP molecular markers related to corn stalk puncture intensity

[0051] The SNP_10_59899287 site on chromosome 10 of the maize genome (B73, V4) was developed into a KASP marker with high-throughput, rapid and low-cost detection.

[0052] First, extract the 100 bp sequence of the site upstream and downstream, as shown in SEQ ID NO.1 and SEQ ID NO.2, and design the detection primers. The SNP marker has two polymorphic single nucleotides A or G.

[0053] SNP-labeled single nucleotide A (SEQ ID NO.1)

[0054] CATTTCATTTTTGTATTTGAGTATAATGTTATTATACTGAAAAATACAGCTAAA TAAACATAAATATCTAGATGCATTTCCAAAAATACATGATGAACTG [A] TGTAT TATCAACACCATGTCTATGTTCCTTGGACAACAAGAACAAAGCCTTTTTAGT CCCAATGAAGTCAGCTTGCAGGCCATGATGTCTACAGTAGTCC SNP-tagged single nucleotide G (SEQ ID NO. 2)

[0055] CATTTCATTTTTGTATTTGAGTATAATGTTATTATACTGAAAAATACAGCTAAA TAAACATAAATATCTAGATGCATTTCCAAAAATACATGATGAACTG [G] TGTATTATCAACACCATGTCTATGTTCCTTGGACAACAAGAACAAAGCCTTTTTAG TCCCAATGAAGTCAGCTTGCAGGCCATGATGTCTACAGTAGTCC

[0056] The Primer-AlleleFAM primer of the primer set was designed based on the 59899287th nucleotide and upstream sequence of chromosome 10 of maize genome B73; the Primer-AlleleHEX primer was designed based on the 59899287th nucleotide mutation and upstream sequence of chromosome 10 of maize genome B73; the Primer-Common primer was designed based on the downstream sequence of 59899287th nucleotide of chromosome 10 of maize genome B73. The primers were synthesized by Shanghai Beijing Biotechnology Co., Ltd.

[0057] The primer sequences are as follows:

[0058] Primer-AlleleFAM: ATGCATTTCCAAAAATACATGATGAACTGA (SEQ ID NO. 3); Primer-AlleleHEX: GCATTTCCAAAAATACATGATGAACTGG (SEQ ID NO. 4); Primer-Common: CCAAGGAACATAGACATGGTGTTGATAAT (SEQ ID NO. 5).

[0059] PCR reaction system: DNA 15ng (dry powder), 2×KASP Master mix 0.5μl, KASP Assay mix 0.014μl (primer mixed working solution, including Primer-AlleleFAM, Primer-AlleleHEX, Primer-Common), H2O 0.486μl, a total of 1μl.

[0060] PCR detection procedure: Step 1: pre-denaturation at 94°C for 15 min; Step 2: denaturation at 94°C for 20 s, annealing / extension at 55-61°C for 60 s, 10 cycles; Step 3: denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, 26 cycles; Store at 15°C.

[0061] Example 5 Application of KASP detection primers in corn lodging resistance breeding

[0062] DNA was extracted from leaves of 15 domestic and foreign maize inbred lines collected and cultivated at the seedling stage, and molecular identification was performed using the KASP primer sequence developed at the SNP_10_59899287 site (Example 4), and the stem puncture strength was measured at the later maturity.

[0063] The results showed that among the 15 inbred lines, 9 had a GG genotype at the mutation site, and their average stem puncture strength was 60.94 N / mm 2The remaining genotypes were all AA, and their average stem puncture strength was 27.77 N / mm 2 The phenotypic and genotypic detection results were basically consistent, indicating that the genotype of SNP_10_59899287 can be used to preliminarily identify the corn stalk puncture strength at the seedling stage, as shown in Table 3.

[0064] It can be seen that by identifying the SNP_10_59899287 genotype, the ability of corn stalk puncture resistance can be predicted, and individual plants or plant lines can be eliminated at the seedling stage, which not only saves production costs, but also greatly improves the selection efficiency and accelerates the breeding process of corn lodging-resistant varieties.

[0065] Table 3 Phenotypes of 15 domestic and foreign inbred lines and KASP marker typing results

[0066]

Claims

1. A primer set for amplifying and identifying KASP molecular markers for corn stalk puncture intensity, characterized in that: The primer set is: Primer-AlleleFAM:ATGCATTTCCAAAAATACATGATGAACTGA, Primer-AlleleHEX:GCATTTCCAAAAATACATGATGAACTGG, Primer-Common: CCAAGGAACATAGACATGGTGTTGATAAT.

2. Use of the primer set according to claim 1 in corn lodging resistance breeding.

3. Use of a kit containing the primer set according to claim 1 in corn lodging resistance breeding.

4. Use of a reagent containing the primer set according to claim 1 in corn lodging resistance breeding.

Images