A SNP molecular marker related to goose weight and size and its application

Abstract

The present invention discloses a SNP molecular marker related to goose weight and body size and an application thereof. The nucleotide sequence of the molecular marker contains a SNP site at position 61331488 of chromosome 4 of the goose, and the polymorphism of the SNP site is G or A. The polymorphic site is significantly correlated with the weight and body size traits of the goose, and can relatively accurately judge the final changes in the weight and body size of the goose in the future development process, and can be used for early screening of the weight and body size traits of the goose, greatly reducing the screening cost, accelerating the progress of genetic breeding, and effectively improving the breeding efficiency, and has high economic application value and scientific research value.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker related to goose weight and body size and an application thereof. Background Art

[0002] Geese are one of the largest poultry species raised for food. Weight and body size are significantly correlated with growth rate, weight gain, and body conformation, making them key indicators for evaluating goose production performance. Weight, among other factors, directly influences consumer choices and the economic benefits of businesses, making it the most important economic trait in geese and has been extensively studied in goose genetics and breeding. Body size traits such as chest width, chest depth, shank circumference, and keel length are also important growth traits for geese, showing a significant correlation with weight and reflecting a goose's growth potential, maturity, and production capacity.

[0003] When selecting geese based on weight and size, accurate weight and size data must be obtained until the goslings reach sexual maturity. This data is then used to determine individual breeding values, and then to decide whether to retain or eliminate the individual. This method of breeding is time-consuming, costly, and inefficient. Summary of the Invention

[0004] The purpose of the present invention is to address the above-mentioned deficiencies in the prior art and provide a SNP molecular marker related to goose weight and body size, which can quickly determine the weight and body size traits of geese in the early stage and improve breeding efficiency.

[0005] The technical solution of the present invention is described in detail as follows:

[0006] In a first aspect, the present invention provides a SNP molecular marker associated with goose weight and body size, the nucleotide sequence of which contains a SNP site at position 61331488 of goose chromosome 4, and the polymorphism of the SNP site is G or A. When the SNP site is A, the goose has a larger weight and body size trait.

[0007] The body measurements include at least chest width, chest depth, shin circumference and keel length.

[0008] It should be understood that the SNP molecular marker described herein can be a genomic fragment of any length containing the SNP site 61331488 on goose chromosome 4, as long as the primers designed for it as the target gene are capable of amplifying the SNP site. The target gene is generally between 200 and 700 bp in length.

[0009] Optionally or preferably, the nucleotide sequence of the above-mentioned SNP molecular marker is as shown in SEQ ID NO.1, and the SNP site is located at position 294 of the nucleotide sequence.

[0010] In a second aspect, the present invention provides the application of the above-mentioned SNP molecular marker in goose genetic breeding.

[0011] In a third aspect, the present invention provides the use of the above-mentioned SNP molecular markers in screening or identifying geese with large body weight and size.

[0012] In a fourth aspect, the present invention provides detection primers for the above-mentioned SNP molecular markers.

[0013] Optionally or preferably, the nucleotide sequence of the detection primer is shown in SEQ ID NO. 2~3.

[0014] In a fifth aspect, the present invention provides the use of the above-mentioned detection primers in the preparation of a reagent for screening or identifying large-bodied geese.

[0015] In a sixth aspect, the present invention provides a kit comprising the above-mentioned detection primers.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The SNP molecular markers related to goose weight and body size of the present invention have polymorphic sites that are significantly correlated with the weight and body size traits of geese. They can more accurately judge the final changes in weight and body size of geese during their future development. They can be used for early screening of goose weight and body size traits, greatly reducing screening costs and effectively improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The Manhattan plot and QQ plot of the genome-wide association analysis of goose body weight in the embodiment;

[0019] Figure 2 The Manhattan plot and QQ plot of the genome-wide association analysis of goose breast width in the embodiment;

[0020] Figure 3 The Manhattan plot and QQ plot of the genome-wide association analysis of goose breast depth in the embodiment;

[0021] Figure 4 The Manhattan plot and QQ plot of the genome-wide association analysis of goose shank circumference in the embodiment;

[0022] Figure 5 The Manhattan plot and QQ plot of the genome-wide association analysis of goose keel length in the embodiment;

[0023] Figure 6 The primer specificity test results in the embodiment;

[0024] Figure 7 The sequencing results of the PCR amplification products of six DNA samples in the example;

[0025] Figure 8 This is the molecular marker nucleotide sequence containing the Chr04:61331448 polymorphic site in the embodiment, and the base marked with shaded marks in the middle of the sequence is the SNP site. DETAILED DESCRIPTION

[0026] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments and drawings. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. Unless otherwise specified, all instruments and reagents used can be purchased through commercial channels, and the test methods used are all prior art.

[0027] Example 1

[0028] Blood samples and body weight, as well as four body trait data (chest width, chest depth, shank circumference, and keel length) were collected from 511 adult Magang geese at a goose farm in Shanwei, Guangdong Province. Raw sequencing data were obtained through next-generation whole-genome resequencing using the DNBSEQ™ sequencing system.

[0029] To ensure the quality and accuracy of the data, the original genome sequencing data of 511 Magang geese were subjected to strict quality control. First, SOAPnuke (v1.5.0) software was used to filter the data and remove low-quality sequences. Then, BWA (v0.7.17) software was used to align the filtered sequences to the swan goose reference genome to identify SNPs. Finally, GATK (v4.2.3.0) software was used to further screen and filter the SNPs, and Plink (v1.90b6.21) software was used to perform quality control and extract these SNPs, retaining the minimum allele frequency (MAF) > 0.05 and passing the Hardy-Weinberg equilibrium test (p < 10 −6 ), and SNPs in autosomes, finally 9216623 SNP sites were obtained.

[0030] Combined with the phenotypic data, the linear mixed model (LMM) in GEMMA (v0.98.1) software was used to construct a genome-wide association matrix and genome-wide association study (GWAS) for all traits (weight, chest width, chest depth, tibia circumference and keel length). GWAS is one of the methods to study the genetic mechanism of complex traits. It mainly determines the genetic factors that affect phenotypic traits by analyzing the association between phenotypic traits and genetic variation. Based on the results of GWAS, we converted the P value of each SNP site to -log (P), and the threshold of significant SNP was 0.05 / n (n is the number of SNPs on each chromosome). Finally, significant SNPs were screened for the next step of analysis, and the CMplot package of R language was used to draw Manhattan plots and Quantile-Quantile plots (QQ plots), see Figure 1-5 .

[0031] Significant SNPs within a distance of 1.5 Mb were merged to form a candidate region. The candidate regions for all traits (weight, chest width, chest depth, tibia circumference and keel length) were fine-mapped using BFMAP (v0.65) software to predict the posterior probabilities of all SNPs in the candidate region.

[0032] Combining the results of GWAS with those of fine-mapping, we screened out the Chr04:61331448 polymorphic site in the traits of weight, chest width, chest depth, tibia circumference and keel length. This site has the strongest signal in both GWAS and fine-mapping of different traits.

[0033] Table 1 P values ​​and fine-mapping posterior probabilities of Chr04:61331448 polymorphic sites in GWAS of different traits

[0034]

[0035] The association analysis between the chr04:61331448 polymorphic site and body weight and size is shown in Table 2 below.

[0036] Table 2 Association analysis between Chr04:61331448 polymorphism and body weight and size

[0037]

[0038] Note: The values ​​marked with different letters are significantly different, while the values ​​marked with the same letter are not significantly different.

[0039] In both male and female goose groups, this locus showed a highly significant association with body weight, chest width, chest depth, tibia circumference and keel length.

[0040] In this embodiment, the molecular marker nucleotide sequence of the intercepted Chr04:61331448 polymorphic site is as follows:

[0041] TCAGGGGCATGCAAACACTGTGTTAGACAAACAGACCACAAAGGATCTTTCTCATGCAGTCTGTGACAAGGATTTTGATTGCAAAGAAAATGATGCCAAGGAGGAATCAAACTGTGCTTATGCAGAAGAAATTACAAGCTCTTGTGCAGTTGTTCAAACTAACTTAAATGACT CAAAGCAAAATGAAGTTGTGGAGAAATCAAACAGTAGCAGTGAATCGGTTTTAAAAAGAAAGCCTGGTAGACCAAAGAAAATAGGTCCTCAAGTCGTTAAGCAGGTTAAGAGACCTATTGGGCGGCCTCCAAAACCAAAAATAGACGTAACTGAAAGTATGGAACATAGACCTG

[0042] CACTTAACAGTGACGGTAAAAGTACCAAATCAGATGCAGCAGTCACGGAAGAAGTTAACGGCAACAAAAATATTACTGTGACGGTTGTTTTTGGAAGGTCAAGAAGAACTAAAAGATATGTTTCTGAAGGTAATCCAAATGTCATCGGCACTCTGCCCACAAAACACGT TGATTTCAATGTTGCCAATGACCACAGCAAAGTGCGGCATAGCACGGAAACTGAAAGTGCTTTGAATGAAATAGTAAAAGCCTTACAGAAGCCTTCTGCTGAAAATGAGGTCTCTGGTTATGACTATGTTAGACCTATCAAGAGTAACCTAGCATCACCACACCCT (SEQ ID NO.1).

[0043] In the above nucleotide sequence, the 294th polymorphic site is G or A. The TurkeyHSD multiple comparison results found that when the marker mutated to A, the geese had larger weight, chest width, chest depth, tibia circumference and keel length, and this trend was more obvious in the female goose group.

[0044] In summary, blood samples of Magang geese were collected and sequenced using the DNBSEQ™ sequencing system. SOAPnuke was used to filter the sequencing data for quality and remove low-quality sequences. Then, BWA was used to align the filtered sequences to the swan goose reference genome to identify SNPs. Finally, GATK was used to further screen and filter the SNPs, and Plink was used to perform quality control and extract these SNPs to obtain a genotype dataset. Combined with its phenotypic measurement data, GEMMA software was used to adopt a single-marker LMM model to screen out the main effect genes and functional mutation sites related to the four body size traits of Magang geese, including weight and chest width, chest depth, tibia circumference, and keel length, providing new SNP sites for the breeding selection of weight, chest width, chest depth, tibia circumference and keel length of Magang geese.

[0045] Chr04:61331448 polymorphic site detection: found from https: / / www.ncbi.nlm.nih.gov / LCORL Gene sequence, primer pairs were designed using Primer premier 5.0 software. The primer pair information is shown in Table 3 (primer sequence 5'→3'). The designed primer pair sequences were sent to Sangon Biotech Co., Ltd. for synthesis. PCR was performed on blood DNA using the primer pair to test the specificity of the primers. The results are attached. Figure 6 shown.

[0046] Table 3 Primer information for screening the polymorphic site Chr04:61331448

[0047]

[0048] Two DNA samples of each genotype were randomly selected, and a total of six DNA samples were subjected to PCR amplification. The obtained PCR products were sent to Sangon Biotech for sequencing. The sequencing results showed that the genotypes of Chr04:61331448 were GG, GA and AA, which were consistent with the genotypes obtained by the second-generation genome sequencing of the individual. The sequencing results are attached. Figure 7 shown.

[0049] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.

Claims

1. An application of a SNP molecular marker in identifying geese with large body weight and size, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, the SNP site is located at the 294th position of the nucleotide sequence, the polymorphism of the SNP site is G or A, and when the site is A, the goose has a larger weight, chest width, chest depth, shank circumference and keel length.

Images