Application of slchp16 gene and its overexpression vector in tomato planting

By constructing an overexpression vector for the SlCHP16 gene in tomatoes and utilizing Agrobacterium-mediated transformation technology, the problem of limited growth of tomatoes under salt and alkali stress was solved, and root growth and salt and alkali stress resistance were enhanced, thereby improving the growth and resistance of tomatoes.

CN118440977BActive Publication Date: 2026-05-05NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410610573.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-16
Publication Date
2026-05-05
Estimated Expiration
2044-05-16

AI Technical Summary

Technical Problem

Tomatoes are restricted in their growth under salt and alkali stress, resulting in reduced yield and quality. Existing technologies have failed to effectively enhance their resistance to salt and alkali stress.

Method used

An overexpression vector for the SlCHP16 gene was constructed and introduced into tomato plants using Agrobacterium-mediated transformation technology to promote root growth and enhance resistance to salt and alkali stress.

Benefits of technology

It promotes root growth in tomatoes, enhances their tolerance to salt and alkali stress, strengthens root morphology indicators and resistance to salt and alkali stress, and improves the growth status and physiological indicators of tomatoes under salt and alkali stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118440977B_ABST
    Figure CN118440977B_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic engineering technology, specifically disclosing the application of the SlCHP16 gene and its overexpression vector in tomato cultivation. The cDNA sequence of the SlCHP16 gene is shown in SEQ ID No. 1. Transforming tomato plants with the overexpression vector constructed using the SlCHP16 gene significantly promotes tomato root growth and significantly enhances the tomato's resistance to salt and alkali stress. The SlCHP16 gene overexpression vector provided by this invention is beneficial for promoting tomato root growth and enhancing the tomato's resistance to salt and alkali stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to SlCHP16 Application of genes and their overexpression vectors in tomato cultivation. Background Technology

[0002] tomato( Solanum lycopersicum L. is one of my country's important vegetable crops, with an annual cultivation area exceeding 1 million hectares. 2 China ranks first in the world in fresh tomato production. However, tomatoes are susceptible to various abiotic stresses throughout their growth cycle. As a moderately salt-sensitive plant, its yield and quality are severely constrained by salt-alkali stress. With the continuous deterioration of the global environment and inappropriate irrigation and fertilization practices, soil salinization has become a significant environmental problem restricting the sustainable and high-quality development of the vegetable industry. As one of the vegetable crops with the largest area of ​​greenhouse cultivation, the growth and development of tomatoes are severely affected by salt-alkali stress, resulting not only in smaller fruits and reduced yields, but also affecting the synthesis and accumulation of soluble proteins, organic acids, lycopene, vitamin C, and other nutrients in tomatoes.

[0003] In nature, salt stress and alkali stress often occur together, jointly constituting salt-alkali stress, which is far more harmful to plants than any single stress. Under salt-alkali stress, the high salt and high pH environment in the rhizosphere causes various physiological activities in plants, including osmotic stress, nutrient imbalance, ion-specific toxicity, and oxidative damage, inhibiting various physiological activities. The root system plays a crucial role in plant growth, development, and survival, with functions including water and nutrient absorption and plant stabilization. When plants are subjected to salt-alkali stress, the root system is the first to be affected, slowing its growth and subsequently impacting the development of the above-ground parts. In horticultural crops such as tomatoes, peppers, and melons, morphological indicators of the root system, such as length, diameter, surface area, and volume, are significantly affected under salt-alkali stress. Furthermore, the roots change from milky white to brown, their vitality decreases, and in severe cases, they may even die.

[0004] The DC1 (Divergent C1) domain protein was first discovered in animals and is a domain of the lipid-binding module of protein kinase Cs (PKCs). Currently, some DC1 domain proteins found in plants are involved in plant disease resistance, stress tolerance, and growth and development. DC1 domain proteins have been reported to participate in plant resistance to pathogen infection in tobacco and pepper. DC1 domain proteins in wheat and cotton have been found to improve plant tolerance to salt stress. Tomatoes contain both 21 and DC1 domain proteins, but their roles in tomato growth, development, and stress response have not yet been studied. SlCHP16 It is highly expressed in the root system and responds to salt and alkali stress, therefore, research SlCHP16This study aims to elucidate the role and function of genes in tomato growth, development, and salt-alkali stress response, and to discover synergistic regulatory factors between stress response and growth and development. This is of great significance for breeding new salt-alkali tolerant tomato varieties, developing new salt-alkali tolerant cultivation measures for vegetable crops, and achieving efficient and sustainable development of modern agriculture. Summary of the Invention

[0005] To improve the salt tolerance of tomatoes, this invention provides SlCHP16 The application of genes and their overexpression vectors in tomato cultivation, provided by this invention. SlCHP16 Gene overexpression vectors promote root growth in tomatoes and enhance their resistance to salt and alkali stress.

[0006] This invention provides SlCHP16 The application of genes in tomato cultivation, the aforementioned SlCHP16 The cDNA sequence of the gene is shown in SEQ ID No. 1. SlCHP16 Transforming tomato plants with gene-constructed overexpression vectors promotes root growth and enhances the salt and alkali stress resistance of tomatoes.

[0007] The present invention also provides SlCHP16 Gene overexpression vector, wherein the overexpression vector is the aforementioned overexpression vector, by means of... SlCHP16 The gene fragment was constructed by ligating it into the pHellsgate8 vector.

[0008] The present invention also provides the aforementioned SlCHP16 The method for constructing gene overexpression vectors includes the following steps:

[0009] Using tomato cDNA as a template, and the sequences shown in SEQ ID No. 2-3 as primers, the following amplification was obtained. SlCHP16 Gene fragments;

[0010] The obtained using homologous recombinase Exnase II SlCHP16 Gene fragments and linearized pHellsgate8 vectors are recombinantly ligated to obtain recombinant vectors, i.e. overexpression vectors.

[0011] Furthermore, the reaction system for PCR amplification was as follows: Phanta Max Super-Fidelity DNA Polymerase (1 U / μL) 1 μL; 2×Phanta Max Buffer 25 μL; forward primer (10 μM) 2 μL; reverse primer (10 μM) 2 μL; DNA template 1 μL; dNTP Mix 1 μL; ddH2O up to 50 μL.

[0012] Furthermore, the reaction system for recombination and ligation was: 40 ng of linearized pHellsgate8 vector. SlCHP16 Gene fragment 6 ng, Exnase II 1 ul, 2×CE II Buffer 2 ul, ddH2O added to 10 uL.

[0013] The present invention also provides a method for utilizing the aforementioned SlCHP16 The method of using gene overexpression vectors to promote tomato root development and improve salt and alkali stress tolerance includes the following steps:

[0014] Cloned tomatoes SlCHP16 Genes were used to construct an overexpression vector, which was transformed into Agrobacterium and then transferred into tomatoes using Agrobacterium infection. T0 transgenic plants with SlCHP16 overexpression were obtained by culturing. Single plants were selected for self-pollination to obtain T1 generation transgenic plants.

[0015] The T1 generation transgenic plant seedlings exhibited increased primary root growth rate, increased root tip cell length, accelerated root growth, and enhanced salt tolerance.

[0016] The specific plan for the above method is as follows: Cloning tomatoes SlCHP16 The gene was designed to knock out the CRISPR-Cas9 target site, and overexpression and knockout vectors were constructed. These vectors were then transformed into tomatoes via Agrobacterium infection, resulting in T0 transgenic plants with SlCHP16 overexpression and knockout. DNA was extracted from the leaves of the T0 generation plants. Overexpression plants were tested for positive results using specific primers, and positive plants were selected for self-pollination to obtain T1 generation transgenic plants. The knockout plants were amplified using target-specific primers, and sequencing was used to identify whether the target site had been edited. Edited plants were selected for self-pollination, and homozygous edited plants were screened from the progeny.

[0017] The construction SlCHP16 The primers used for the overexpression vector are:

[0018] SlCHP16 -OE-Fw: CATTTGGAGAGGACACGCTCGAGATGCTCCAAATCAGAATAGTAAAGAG

[0019] SlCHP16 -OE-Rv:TCTCATTAAAGCAGGACTCTAGACTAGTATTGCGTGTCTGACGAGTC

[0020] The SlCHP16 The target sites for gene knockout are:

[0021] Target1: CCTCTTTACTATTCTGATT

[0022] Target2: AGGCCAAATGTACATATGC

[0023] The construction SlCHP16 The primers used for the gene knockout vector are:

[0024] SlCHP16- R-Fw: GAATCTAACAGTGTAGTTTGCCTCTTTACTATTCTGATTGTTTTAGAGCTAGAAATAGC

[0025] SlCHP16 -R-RV: GCTATTTCTAGCTCTAAAACGCATATGTACATTTGGCCTCAAACTACACTGTTAGATTC

[0026] The primers used for positive detection of overexpressing plants are:

[0027] 35S: ACGCACAATCCCACTATCCTTC

[0028] SlCHP16 -OE-Rv:TCTCATTAAAGCAGGACTCTAGACTAGTATTGCGTGTCTGACGAGTC

[0029] The primers used for positive detection by knocking out plants are:

[0030] pTX-Fw:AGCGGATAACAATTTCACACAGGA

[0031] pTX-Rv:GCAGGCATGCAAGCTTATTGG

[0032] The primers used to detect the editing status of target sites in knockout plants are:

[0033] SlCHP16 -Rdet-FW:GCATTACTGCACACATCCCAATCA

[0034] SlCHP16- Rdet-RV: CTCCAATCTTGCGGCATACA

[0035] The SlCHP16 The gene sequence is shown in Seq. No. 1.

[0036] The present invention also provides a bacterial culture containing the overexpression vector, obtained by transforming competent cells with the overexpression vector.

[0037] Furthermore, the competent cells are Agrobacterium.

[0038] Furthermore, the bacterial culture is obtained by culturing transformed Agrobacterium on LB liquid medium.

[0039] The present invention also provides the aforementioned SlCHP16 The application of gene overexpression vectors or the aforementioned bacterial solutions in tomato cultivation, utilizing... SlCHP16 Transgenic tomato plants were obtained by transforming Agrobacterium tumefaciens with an overexpression vector and then infecting them with the tomato plants. The total root length and total root surface area of ​​the transgenic tomato plants were increased.

[0040] Furthermore, transgenic tomato plants transformed with overexpression vectors exhibit enhanced resistance to salt and alkali stress.

[0041] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0042] 1. The present invention provides SlCHP16 Gene overexpression vectors promote root growth in tomatoes and enhance their resistance to salt and alkali stress.

[0043] 2. This invention clones the... SlCHP16 Genes were used to construct an overexpression vector, which was transformed into Agrobacterium and then transferred into tomatoes using Agrobacterium infection. T0 transgenic plants with SlCHP16 overexpression were obtained by culturing. Single plants were selected for self-pollination to obtain T1 generation transgenic plants.

[0044] The T1 generation transgenic plant seedlings exhibited increased primary root growth rate, increased root tip cell length, accelerated root growth, and enhanced salt tolerance. Attached Figure Description

[0045] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0046] Figure 1 for SlCHP16 Detection of overexpression and knockout plants and root morphology indicators;

[0047] In the diagram, 'a' represents... SlCHP16 Overexpression and knockout lineages and root morphology;

[0048] b is SlCHP16 Gene expression levels in leaves of overexpressing lines;

[0049] c is SlCHP16Gene expression levels in the roots of overexpressing lines;

[0050] d is SlCHP16 Schematic diagram of target detection in knockout strains;

[0051] e is SlCHP16 Statistical graph of total root length of overexpressing and knockout plants;

[0052] f is SlCHP16 Statistical chart of total root surface area of ​​overexpressed and knocked-out plants.

[0053] Figure 2 for SlCHP16 The growth of primary roots in plants with overexpression and knockout;

[0054] In the diagram, 'a' represents... SlCHP16 Root growth status of overexpressing and knockout plants on plate culture medium;

[0055] b is SlCHP16 Statistical chart of primary root length of OE-3 plants and AC plants;

[0056] c is SlCHP16 -Statistical chart of primary root length of OE-15 plants and AC plants; d represents SlCHP16 -R-1 plant and AC primary root length statistics; e is... SlCHP16 -R-2 plant and AC primary root length statistics chart. Figure 3 for SlCHP16 Overexpression and knockout of plant root tip cell morphology;

[0057] In the figure, a represents the morphology of AC root tip cells; b represents... SlCHP16 -OE-3 root tip cell morphology; c is... SlCHP16 -OE-15 root tip cell morphology; d is SlCHP16 -R-1 Root tip cell morphology; e is SlCHP16 -R-2 Root tip cell morphology; f is SlCHP16 Statistical graph of root tip cell length in overexpressed and knockout plants.

[0058] Figure 4 for SlCHP16 Morphological and physiological parameters of plants with overexpression and knockout after salt stress treatment;

[0059] In the diagram, 'a' represents... SlCHP16 Morphology of plants subjected to salt stress after overexpression and knockout treatment;

[0060] b is SlCHP16 Relative electrical conductivity (REC) of cells after salt stress treatment in plants with overexpression and knockout;

[0061] c is SlCHP16Overexpression and knockout of malondialdehyde (MDA) levels in plants under salt-alkali stress;

[0062] d is SlCHP16 Chlorophyll fluorescence parameters (Fv / Fm) in plants subjected to salt stress after overexpression and knockout. Detailed Implementation

[0063] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0064] This invention provides SlCHP16 Application of genes and their overexpression vectors in tomato cultivation.

[0065] The materials used in this invention are as follows:

[0066] (1) The tomatoes used were common cultivated tomatoes, Ailsa Craig (AC), purchased from the Tomato Genetics Center TGRC (https: / / tgrc.ucdavis.edu / ).

[0067] (2) Escherichia coli Trans1-T1 was purchased from Beijing TransGen Biotechnology Co., Ltd.;

[0068] (3) Agrobacterium strain C58 was purchased from Yangling Jinbairui Biotechnology Co., Ltd.;

[0069] (4) SlCHP16 The backbone vector for the gene overexpression vector was the pHellsgate8 vector, as described in the literature "Li GB, Wang JF, Zhang CL, Ai G., Zhang DD, Wei J, Cai LY, Li CB, Zhu WZ, Robert M. L., Zhang JH". * . L2, a chloroplast metalloproteinase, regulates fruitripening by participating in ethylene autocatalysis under the control of ERFs. Journal of Experimental Botany, 2021, 72 (20):7035-7048".

[0070] (5) The PTX041 and 043 vectors are described in the literature “Deng,L., Wang,H., Sun,C., Li,Q., Jiang,H., Du,M., Li,C.-B., Li,C., Efficient generation of pink-fruited tomatoes using CRISPR / Cas9 system, Journal of Genetics and Genomics (2017), doi:10.1016 / j.jgg.2017.10.002.”

[0071] Example 1: Construction SlCHP16 Overexpression vector.

[0072] 1. Find it on the SNG tomato genome database website (http: / / solgenomics.net / ). SlCHP16 The cDNA sequence of the gene, as shown in SEQ ID No. 1, was designed using Snap Gene software. SlCHP16 The gene amplification primers (as shown in SEQ ID No. 2-3) were used, and a pHellsgate8 vector-specific homologous recombination arm was added to the 5' end of the designed primers. The primer sequences are shown below:

[0073] SEQ ID No. 1:

[0074]

[0075] SEQ ID No.2 ( SlCHP16 -OE-Fw):

[0076] CATTTGGAGAGGACACGCTCGAGATGCTCCAAATCAGAATAGTAAAGAG;

[0077] SEQ ID No.3 ( SlCHP16 -OE-Rv):

[0078] TCTCATTAAAGCAGGACTCTAGACTAGTATTGCGTGTCTGACGAGTC.

[0079] 2. Using phanta enzyme and tomato cDNA as a template, PCR amplification was performed using primers with the synthesized sequence shown in SEQ ID No. 2-3 to obtain a 1461 bp sequence. SlCHP16 Gene fragment. The PCR amplification reaction system consisted of: 1 μL Phanta Max Super-Fidelity DNA Polymerase (1 U / μL); 25 μL 2×Phanta Max Buffer; 2 μL forward primer (10 μM); 2 μL reverse primer (10 μM); 1 μL DNA template; 1 μL dNTP Mix; and ddH2O up to 50 μL. The reaction program was: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 55℃ for 15 s, extension at 72℃ for 1 min, for 35 cycles; and final extension at 72℃ for 10 min.

[0080] 3. The pHellsgate8 vector was linearized to obtain a linearized pHellsgate8 vector. The linearization reaction system for the pHellsgate8 vector was as follows: 6 μg of pHellsgate8 plasmid. XbaI Enzyme (NEB, USA) 2uL XhoI Enzyme (NEB, USA) 2 uL, CutSmart Buffer 10 uL, ddH2O added to 10 uL, reaction conditions: 37℃, 2 h. After the reaction, the enzyme digestion effect was detected by agarose gel electrophoresis. Once successful digestion was confirmed, the product was recovered by gel extraction.

[0081] The homologous recombinase Exnase II (Novizan, Nanjing) was used to convert the product from step 2... SlCHP16The gene fragment and the linearized pHellsgate8 vector were recombinated and ligated to obtain the recombinant vector. The reaction mixture for recombination ligation consisted of 40 ng of the linearized pHellsgate8 vector. SlCHP16 Gene fragment 6 ng, Exnase II 1 ul, 2×CE II Buffer 2 ul, ddH2O added to 10 ul, reaction conditions: 37℃, 30 min.

[0082] 4. The recombinant vector was heat-shocked and transformed into competent E. coli cells, followed by colony PCR detection. The primers used for colony PCR detection were 35S (sequence shown in SEQ ID No. 4) and gate8-RV (sequence shown in SEQ ID No. 5):

[0083] 35S (SEQ ID No. 4): ACGCACAATCCCACTATCCTTC;

[0084] gate8-RV (SEQ ID No. 5): CATAAAAATACGATAGTAACGGGTG.

[0085] For the detection of recombinant vector E. coli, the reaction system was as follows: Taq enzyme (5 U / μL) 0.1 μL; 2×Taq Buffer 2 μL; forward primer (10 μM) 0.4 μL; reverse primer (10 μM) 0.4 μL; DNA template 1 μL; dNTPs 0.4 μL; ddH2O to 20 μL. The reaction program was as follows: pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min 30 s, for 35 cycles; final extension at 72℃ for 10 min. A positive clone with a fragment of approximately 1500 bp detected by gel electrophoresis was considered a successfully transformed positive clone. Successfully transformed positive single clones were randomly selected and cultured in liquid LB medium containing 100 mg / L spectinomycin (Spe). The culture was incubated at 37°C for 4-5 h. The recombinant plasmid was identified by PCR and sequencing. After correct identification, the recombinant plasmid was extracted and used to transform Agrobacterium C58.

[0086] 5. After freezing and thawing competent cells on ice, add 3 μL of plasmid to the competent cells, mix well, and incubate on ice for 5 min. Then, freeze the competent cell tubes in liquid nitrogen for 5 min, and incubate them at 37°C for 5 min. After incubation at 37°C, place the competent cells on ice for 5 min. Next, add 500 μL of blank liquid LB from a clean bench to the competent cells and incubate at 28°C on a shaker for 3 h. Then, plate the cells onto plates containing rifampicin (Rif) and Spe antibiotics, and incubate them upside down at 28°C for 2 days. After single colonies grow, perform PCR detection. The detection primers are 35S and gate8-RV. A positive single colony is identified by gel electrophoresis with a fragment of approximately 1500 bp and stored for later use.

[0087] Example 2: Construction SlCHP16 Knock out the expression vector.

[0088] 1. Using the online software CCTop - CRISP R / Cas9 target online predictor (http: / / crispr.cos.uni-heidelberg.de / ), sgRNA target sequences were designed. Two highly specific sequences on the first exon were selected as target site sequences. The selected target site sequences are shown below:

[0089] Target1: CCTCTTTACTATTCTGATT (SEQ ID No.6);

[0090] Target2: AGGCCAAATGTACATATGC (SEQ ID No. 7).

[0091] 2. Primers were designed targeting PTX041 and the target gene site. The primer sequences are shown below:

[0092] SlCHP16 -R-Fw:

[0093] GAATCTAACAGTGTAGTTTGCCTCTTTACTATTCTGATTGTTTTAGAGCTAGAAATAGC (SEQ IDNo. ​​8);

[0094] SlCHP16 -R-RV:

[0095] GCTATTTCTAGCTCTAAAACGCATATGTACATTTGGCCTCAAACTACACTGTTAGATTC (SEQ ID No. 9).

[0096] 3. Using phanta enzyme and intermediate vector 043 as a template, PCR amplification was performed using the primers synthesized above to obtain a 600 bp double sgRNA cloning frame. The fragment was then recovered, and homologous recombination with linearized pTX041 was used to construct a recombinant vector. The PCR system, recombination method, and transformation methods for *E. coli* and *Agrobacterium* are as described in Example 1. The primers used for PCR detection of the knockout vector bacterial culture were:

[0097] pTX-Fw: AGCGGATAACAATTTCACACAGGA (SEQ ID No. 10);

[0098] pTX-Rv: GCAGGCATGCAAGCTTATTGG (SEQ ID No. 11).

[0099] Example 3: Agrobacterium-mediated genetic transformation of tomato and PCR positive identification.

[0100] Using cultivated tomato AC as experimental material, sterilized seeds were inoculated onto 1 / 2 MS medium, and the resulting cotyledons were cut into explants for dark culture. The constructed explants were then used... SlCHP16 Agrobacterium strains containing both overexpression and knockout vectors were used to infect tomato cotyledons. After two rounds of antibiotic selection, seedlings with growth points emerged from the explants. These seedlings were then transferred to rooting medium for rooting culture. Finally, the rooted, resistant seedlings were transferred to plastic cups containing nutrient soil and cultured in a plant growth chamber for one month. DNA was extracted from the transgenic seedlings for PCR positive detection. The primers used for the overexpression plants were 35S and... SlCHP16 -OE-RV, the primers used for knockout plant detection were PTX-FW and PTX-RV. Further detection of target editing in knockout plants is needed, utilizing... SlCHP16 The target sites were amplified using -Rdet-FW and SlCHP16-Rdet-RV, and sequenced. The sequences were compared with reference gene sequences, and single plants exhibiting editing or bimodal sequencing were selected for self-pollination. Positive and edited T0 generation plants were transferred to a greenhouse for cultivation. Seeds from the T0 generation transgenic plants were harvested after fruiting. Knockout plants were further examined for target site editing in the T1 generation, and homozygous edited single plants were selected for subsequent phenotypic identification.

[0101] Example 4: SlCHP16 Identification of the effects of overexpression and knockout on root development.

[0102] T2 generation SlCHP16 Overexpression and knockout plants were cultured in a plant growth chamber and grown for 60 days. SlCHP16 The root systems of overexpressing and knockout plants were measured, and the results showed that... SlCHP16After overexpression, both the total root length and total root surface area were significantly higher than those in AC, and SlCHP16 After knockout, both the total root length and total root surface area were significantly lower than AC ( Figure 1 (e and f).

[0103] Next SlCHP16 Seeds from overexpressed and knockout plants were sown in agar plates and cultured vertically. After 7 days of growth, the plants were subjected to... SlCHP16 Observations were conducted using overexpression and knockout of primary roots in plants, and the results showed that... SlCHP16 -OE plant seedlings have a faster primary root growth rate than AC, and SlCHP16 -R's primary root growth rate is less than AC's ( Figure 2 Next, will SlCHP16 Paraffin sections of root tissue 1 cm from the root tip of overexpressing and knockout plants were examined, and the results showed that... SlCHP16 -OE plants have root tip cell lengths greater than AC, while SlCHP16 -R plant root tip cell length is less than AC ( Figure 3 ).show SlCHP16 Genes promote tomato root growth by encouraging root tip cell elongation.

[0104] Example 5: SlCHP16 Evaluation of salt and alkali stress resistance in plants with overexpression and knockout.

[0105] Plants grown in a growth incubator for 60 days SlCHP16 Overexpression and knockout plants were treated with a 300 mM complex saline-alkali solution (NaCl:Na₂SO₄:NaHCO₃:Na₂CO₃ = 1:9:9:1 molar ratio). After 7 days of saline-alkali stress, SlCHP16 Gene knockout plants exhibited obvious wilting and dehydration, while SlCHP16 Overexpression plants showed almost no wilting and exhibited significantly better growth than AC ( Figure 4 a). Simultaneously, stress damage indicators such as leaf electrical conductivity (REC), malondialdehyde (MDA) content, and chlorophyll fluorescence parameter (Fv / Fm) were detected, and the results showed... SlCHP16 -OE showed a significantly lower ERC value than AC after salt-alkali stress, while SlCHP16 -R stress resulted in a significantly higher REC value than AC ( Figure 4 (b). Similarly [[ID=1 -OE plants under stress have lower MDA content than AC. ​ -R plants have higher MDA content than AC plants, indicating ​ -R cells are more severely damaged, while ​ -OE cell damage is relatively mild ( ​ c). ​-OE plants still had higher Fv / Fm values ​​than AC plants after salt-alkali stress. ​ -R plants indicate ​ Overexpressing plants still exhibit high photosynthetic capacity under salt-alkali stress. ​ (d). In summary, the above indicators reflect... ​ Overexpression of SlCHP16 enhanced the salt and alkali stress resistance of tomatoes, while knockout of SlCHP16 reduced the salt and alkali stress resistance of tomatoes.

[0106] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0107] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. SlCHP16 The application of genes in tomato cultivation is characterized by, The SlCHP16 The cDNA sequence of the gene is shown in SEQ ID No.

1. SlCHP16 Transforming tomato plants with gene-constructed overexpression vectors promotes root growth and enhances the salt and alkali stress resistance of tomatoes.

2. A method of utilizing SlCHP16 A method for promoting tomato root development and improving salt-alkali stress tolerance using gene overexpression vectors, characterized in that... Includes the following steps: Cloned tomatoes SlCHP16 Genes were used to construct an overexpression vector, which was transformed into Agrobacterium and then transferred into tomatoes using Agrobacterium infection. T0 transgenic plants with SlCHP16 overexpression were obtained by culturing. Single plants were selected for self-pollination to obtain T1 generation transgenic plants. The T1 generation transgenic plant seedlings exhibited increased primary root growth rate, increased root tip cell length, accelerated root growth, and enhanced salt tolerance.

3. SlCHP16 The application of gene overexpression vectors or bacterial solutions in tomato cultivation is characterized by, The bacterial solution is composed of SlCHP16 Gene overexpression vectors were obtained by transforming competent cells, and then... SlCHP16 Transgenic tomato plants were obtained by transforming Agrobacterium tumefaciens with an overexpression vector and then infecting them. The total root length and total root surface area of ​​the transgenic tomato plants were increased.

4. The application according to claim 3, characterized in that, Transgenic tomato plants obtained by overexpression vector transformation exhibit enhanced resistance to salt and alkali stress.