A medicine for treating drug-resistant lung cancer
By combining the use of inhibitors that suppress NSUN7 gene expression with EGFR-TKI inhibitors, the expression of MZF1 splicing variants was regulated, solving the treatment challenge of drug-resistant lung cancer and restoring the sensitivity of lung cancer cells and enhancing the anti-tumor effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV
- Filing Date
- 2024-06-28
- Publication Date
- 2026-07-10
AI Technical Summary
Existing treatments for EGFR-TKI-resistant lung cancer have limitations, making it difficult to effectively regulate gene expression and enhance anti-tumor effects, especially targeting the expression differences of MZF1 splice variants, which leads to the inability to effectively reverse drug resistance in lung cancer cells.
By combining inhibitors that suppress NSUN7 gene expression (such as shNSUN7 or 5-Aza-CdR) with EGFR-TKI inhibitors, MZF1L expression is promoted and MZF1S expression is inhibited, thereby regulating methylation-sensitive transcription factors to enhance anti-tumor effects.
It significantly improved the sensitivity of drug-resistant lung cancer cells to EGFR-TKI, reduced the proliferation and invasion of tumor cells, and achieved effective treatment of drug-resistant lung cancer.
Smart Images

Figure BDA0004916902510000081 
Figure BDA0004916902510000101 
Figure HDA0004916902530000011
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, specifically to a drug for treating drug-resistant lung cancer. Background Technology
[0002] Lung cancer is a highly prevalent cancer worldwide, ranking first among malignant tumors in my country. Non-small cell lung cancer (NSCLC) is the most common histological type of lung cancer, accounting for about 85% of lung cancer patients (Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin 2022, 72(1):7-33). EGFR mutation is an important oncogenic driver in NSCLC, opening the door to biomarker-guided therapy for patients with advanced disease (Cooper AJ, Sequist LV, Lin JJ. Third-generation EGFR and ALK inhibitors: mechanisms of resistance and management. Nature reviews Clinical oncology 2022.). Many EGFR tyrosine kinase inhibitors (EGFR-TKIs) have been developed, including the commonly used first-generation TKI gefitinib and the highly effective third-generation TKI osimertinib. Despite the remarkable efficacy of EGFR-TKIs in treating patients, resistance to them remains a fundamental challenge that has not yet been resolved.
[0003] Currently, there are two main viewpoints regarding the development of acquired resistance to EGFR-TKIs: alteration of the targeted kinase (such as EGFR C797S mutations (Thress KS, Paweletz CP, Felip E, Cho BC, Stetson D, Dougherty B, Lai Z, Markovets A, Vivancos A, Kuang Y, Ercan D, Matthews SE, Cantarini M, Barrett JC, ...). PA, Oxnard GR. Acquired EGFR C797S mutation mediates resistance to AZD9291 in non-small cell lung cancer harboring EGFR T790M. Nature Medicine 2015, 21(6):560-562) and changes in downstream signaling pathways of the target (such as BRAF fusion, KRAS mutation, NRAS mutation, MAP2K1 mutation in the RAS-MAPK pathway). Schoenfeld AJ, Chan JM, Kubota D, Sato H, Rizvi H, Daneshbod Y, Chang JC, Paik PK, Offin M, Arcila ME, Davare MA, Shinde U, Pe'er D, Rekhtman N, Kris MG, Somwar R, Riely GJ, Ladanyi M, Yu HA. Tumor Analyses Reveal Squamous Transformation and Off-Target Alterations As Early Resistance Mechanisms to First-line Osimertinib in EGFR-Mutant Lung Cancer. Clinicalcancer research: an official journal of the American Association for Cancer Research 2020, 26(11):2654-2663.)). However, most of these studies focus on the genetic changes of EGFR-related genes. Epigenetic changes often occur in patients who do not respond well to TKIs, and regulating epigenetic changes can enhance the cytotoxic effect of antitumor therapy (Chen Z, Chen Q, Cheng Z, Gu J, Feng W, Lei T, Huang J, Pu J, Chen X, Wang Z. Long non-coding RNA CASC9 promotes gefitinib resistance in NSCLC by epigenetic repression of DUSP1. Cell death & disease 2020, 11(10):858.).Compared with permanent gene mutations, epigenetic changes that control gene expression play an important role in gradually regulating cell differentiation and malignant transformation after cell resistance to drugs. They can serve as potential sensitive biomarkers and drug targets for drug resistance biomonitoring.
[0004] Zinc finger proteins bind to Zn 2+ It forms a stable, self-folding "finger" structure and is closely related to various pathological processes, including cancer invasion and metastasis and resistance to antitumor drugs. Therefore, it is regarded as an important molecular target (Jen J, Liu CY, Chen YT, Wu LT, Shieh YC, Lai WW, Wang YC. Oncogenic zinc finger protein ZNF322A promotes stem cell-like properties in lung cancer through transcriptional suppression of c-Myc expression. Cell death and differentiation 2019, 26(7):1283-1298. Lin S, Ruan H, Qin L, Zhao C, Gu M, Wang Z, Liu B, Wang H, Wang J. Acquired resistance to EGFR-TKIs in NSCLC mediatesepigenetic downregulation of MUC17 by facilitating NF-κB activity via UHRF1 / DNMT1 complex. International Journal of Biological Sciences 2019, 26(7):1283-1298. 2023, 19(3):832-851.). Zinc activates EGFR by activating intracellular Src and metalloproteinases, and activated EGFR induces respiratory inflammation by upregulating the expression of inflammatory proteins. Members of the zinc finger protein family play an important role in regulating the expression and activity of EGFR. The methyl-sensitive zinc finger protein myeloid zinc finger 1 (MZF1) belongs to the Krüppel-like family of transcription factors and is involved in cell proliferation and differentiation. MZF1 itself has three known splicing variants (MZF1-V1, MZF1-V2, and MZF1-V3), among which MZF1-V1 and MZF1-V2 have the same coding region, that is, they encode the complete isoform 1 (MZF1). LThe C2H2 type zinc domain has functional domains including an acidic domain, a SCAN domain, a TAD domain, and a DNA-binding domain, namely a zinc finger domain composed of 13 zinc fingers. The core sequences recognized by this C2H2 type zinc domain are all rich in G sites, making it a methyl-sensitive transcription factor. MZF1-V3 encodes a truncated isoform 2 (MZF1) lacking the C-terminus of the carboxyl group. S Therefore, it is similar to a truncated version of the DNA-binding domain of MZF1. In our work, we found that the DNA-binding capacity of the zinc finger domains of the two protein isoforms differs, potentially playing an important role in gene transcriptional regulation. This is because the MZF1 zinc finger domains often cluster together to bind divalent cations (such as Zn). 2+ MZF1 exhibits methylation sensitivity. Therefore, the expression of different splicing variants of MZF1 has different effects on EGFR phosphorylation activation. MZF1S is highly expressed in drug-resistant cells and tissues, promoting tumor cell proliferation and invasion, while MZF1L is silenced in drug-resistant cells and has antitumor effects and inhibits cell invasion. It has been reported that mRNA m... 5 The C site is modified by RNA methyltransferases NSUN2 and NSUN6. Further studies have revealed that RNAm 5 C-methyltransferase NSUN7 is the main regulator of differential expression in MZF1 splicing variants.
[0005] Synergistic combination of targeted epigenetic drugs plays an important role in cancer treatment. Epigenetic drugs affect gene expression through mechanisms such as regulating DNA methylation and demethylation, thereby inhibiting tumor cell growth and promoting their death (Epigenetic modulation of antitumor immunity for improved cancer immunotherapy. Mol Cancer. 2021; 20:171.). However, the use of epigenetic drugs alone may have limitations. Therefore, combining them with other treatments (such as immunotherapy, chemotherapy and targeted therapy) can significantly enhance the anti-tumor effect (Babar Q, Saeed A, Tabish TA, Pricl S, Townley H, Thorat N. Novel epigenetic therapeutic strategies and targets in cancer. Biochim Biophys Acta Mol Basis Dis. 2022 Sep 17; 1868(12):166552. doi:10.1016 / j.bbadis.2022.166552.Epub aheadofprint.PMID:36126898.). Studies have shown that tumor invasion and progression are highly dependent on the mutual regulation of genetics and epigenetics (Zhang Ziling, Zhang Yanan, Zhang Yanli, et al. Research progress on the epigenetic regulation of EZH2 in tumorigenesis [J]. International Journal of Genetics, 2022, 45(1):44-49.DOI:10.3760 / cma.j.cn231536-20210810-00102.). Targeting epigenetic modifying enzymes can effectively inhibit tumor growth and metastasis. Synergistic targeted combination epigenetic drugs can overcome the limitations of single treatment methods and enhance anti-tumor effects in cancer treatment. Therefore, for the treatment of drug-resistant non-small cell cancer, while improving the immune effect, optimizing the precision medicine plan, it is urgent to propose new synergistic targeted combination epigenetic drug treatment plans. Summary of the Invention
[0006] This invention, in its study of drug-resistant lung cancer cells, found that overexpression of the NSUN7 gene in lung cancer cells can inhibit MZF1. L The expression of MZF1 also promotes S When the expression of NSUN7 gene was suppressed, no promotion of MZF1 was found. L The expression of MZF1 can be suppressed at the same time. SThe expression of NSUN7 was not reversed, but when NSUN7 gene expression was inhibited and EGFR-TKI inhibitors were administered to lung cancer cells, MZF1 cells in drug-resistant lung cancer cells showed a positive result. L Upregulation, MZF1 S The decreased expression of these substances allows drug-resistant lung cancer cells to transform into drug-sensitive cells. Based on this, the present invention was completed.
[0007] In a first aspect, the present invention provides a drug for treating drug-resistant lung cancer, wherein the drug is an inhibitor of NSUN7 gene expression and an EGFR-TKI inhibitor, and when the drug acts on drug-resistant lung cancer cells, it can promote the expression of MZF1 in the cells. L Expressing and inhibiting MZF1 S Expression of this substance allows drug-resistant lung cancer cells to transform into drug-sensitive cells.
[0008] Furthermore, the inhibitors of NSUN7 gene expression are shNSUN7 or 5-Aza-CdR;
[0009] Furthermore, the inhibitor of NSUN7 gene expression is the shNSUN7 gene, which includes shNSUN7-1 and / or shNSUN7-2, the nucleotide sequence of shNSUN7-1 is shown in SEQ ID NO.3; and the nucleotide sequence of shNSUN7-2 is shown in SEQ ID NO.4.
[0010] Furthermore, the shNSUN7 gene may also include other vectors expressing the shNSUN7 gene, such as cells.
[0011] Furthermore, the drug-resistant lung cancer cells are drug-resistant non-small cell lung cancer cells.
[0012] Furthermore, the drug-resistant lung cancer is drug-resistant non-small cell lung cancer, preferably gefitinib-resistant non-small cell lung cancer and osimertinib-resistant non-small cell lung cancer.
[0013] Furthermore, the EGFR-TKI inhibitor is selected from one or more of gefitinib, osimertinib, erlotinib, icotinib, dacomitinib, ametinib, vometinib, befotinib, lapatinib, and afatinib.
[0014] In a second aspect, the present invention provides a pharmaceutical composition for treating drug-resistant lung cancer, the composition comprising the drug described in the first aspect and other active ingredients of the drug for treating drug-resistant lung cancer, and pharmaceutically acceptable excipients thereof.
[0015] Thirdly, the present invention provides the application of an inhibitor of NSUN7 gene expression and an EGFR-TKI inhibitor in the preparation of a treatment for drug-resistant lung cancer, wherein the inhibitor of NSUN7 gene expression is shNSUN7 or 5-Aza-CdR; wherein the shNSUN7 gene fragment includes shNSUN7-1 and shNSUN7-2, shNSUN7-1 as shown in SEQ ID NO.3; shNSUN7-2 as shown in SEQ ID NO.4.
[0016] Furthermore, the shNSUN7 may also include other vectors expressing the shNSUN7 gene, such as cells.
[0017] Furthermore, the drug-resistant lung cancer cells are drug-resistant non-small cell lung cancer cells.
[0018] Furthermore, the drug-resistant lung cancer is drug-resistant non-small cell lung cancer, preferably gefitinib-resistant non-small cell lung cancer and osimertinib-resistant non-small cell lung cancer.
[0019] Furthermore, the EGFR-TKI inhibitor is selected from one or more of gefitinib, osimertinib, erlotinib, icotinib, dacomitinib, ametinib, vometinib, befotinib, lapatinib, and afatinib.
[0020] Fourthly, this invention provides a method for the NSUN7 gene to regulate the methyl-sensitive zinc finger protein myeloid zinc finger 1 (MZF1) in MZF1. L and MZF1 S In terms of expression, overexpression of the NSUN7 gene can suppress MZF1. L Promote MZF1 S The expression.
[0021] Fifthly, the present invention provides a method for downregulating the expression of the DNMT1 / UHRF1 complex in lung cancer cells, the method comprising: transfecting lung cancer cells with the shNSUN7 plasmid or obtaining it by inhibiting NSUN7 expression with 5-Aza-CdR.
[0022] Beneficial effects
[0023] When the NSUN7 gene is overexpressed in cells, it can inhibit MZF1. L The expression of MZF1 also promotes S When the expression of NSUN7 gene was suppressed, no promotion of MZF1 was found. L The expression of MZF1 can be suppressed at the same time. SThe expression of NSUN7 gene was inhibited, meaning no opposite result was obtained. However, when NSUN7 gene expression was inhibited and EGFR-TKI inhibitors were administered to cells, MZF1 cells in drug-resistant lung cancer cells showed positive results. L Upregulation, MZF1 S Decreased expression of NSUN7 leads to the transformation of drug-resistant lung cancer cells into drug-sensitive cells. Therefore, interfering with NSUN7 in combination with epigenetic drugs to regulate the alternative splicing of methylation-sensitive transcription factors can increase the specificity of regulatory targets and synergistically enhance the in vitro and in vivo antitumor effects. Attached Figure Description
[0024] Figure 1 Effects of NSUN7 overexpression or interference on the function of gefitinib and osimertinib resistant cells: A. Expression of NSUN1-7 in EGFR-TKIs-sensitive (HCC827, PC9) and resistant (HCC827 / GR and HCC827 / OR, PC9 / GR and PC9 / OR) cells. B. MZF1 cells after overexpression of NSUN2 and NSUN6 in EGFR-TKIs-sensitive (HCC827, PC9) and resistant (HCC827 / GR and HCC827 / OR, PC9 / GR and PC9 / OR) cells. L and MZF1 S Expression of MZF1 cells after overexpression of NSUN7 in C. EGFR-TKI-sensitive (HCC827, PC9) and resistant (HCC827 / GR and HCC827 / OR, PC9 / GR and PC9 / OR) cells. L and MZF1 S Expression of MZF1 cells after NSUN7 interference in D. EGFR-TKIs-sensitive (HCC827, PC9) and drug-resistant (HCC827 / GR and HCC827 / OR, PC9 / GR and PC9 / OR) cells. L and MZF1 S The expression of NSUN7 was investigated. EF colony formation assays and Transwell assays were used to examine the effects of NSUN7 overexpression (E) and NSUN7 interference (F) on cell proliferation and invasion in EGFR-TKIs-sensitive (HCC827, PC9) and resistant (HCC827 / GR and HCC827 / OR, PC9 / GR and PC9 / OR) cells. Representative images are shown in the left half of the figure, and quantitative data are shown in the right half. *P<0.05, **P<0.01.
[0025] Figure 2 Changes in the expression and biological function of MZF1 splice variants after the addition of shNSUN7 or 5-Aza-CdR to lung cancer cells
[0026] A. Western blot analysis of EGFR-TKIs-sensitive (HCC827) and resistant (HCC827 / GR and HCC827 / OR) cells: 5-Aza-CdR (5 μM), EGFR-TKI inhibitors (gefitinib 1 μM or osimertinib 0.5 μM), transfected with shNSUN7 plasmid, or 5-Aza-CdR + EGFR-TKI inhibitor, or shNSUN7 + EGFR-TKI inhibitor combined with DNMT1, UHRF1, NSUN7, and MZF1 were performed. L and MZF1 S Expression of EGFR-TKIs. Clonogenesis assay (B) and Transwell assay (C) were used to detect the expression of EGFR-TKIs in EGFR-TKIs sensitive (HCC827) and resistant (HCC827 / GR and HCC827 / OR) cells after administration of 5-Aza-CdR (5 μM), EGFR-TKIs inhibitors (gefitinib 1 μM or osimertinib 0.5 μM), transfection with shNSUN7 plasmid, or 5-Aza-CdR + EGFR-TKIs inhibitor, or shNSUN7 + combined use of EGFR-TKIs inhibitor. Representative images are shown in the left half of the figure, and quantitative data are shown in the right half. *P<0.05, **P<0.01. Detailed Implementation
[0027] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.
[0028] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.
[0029] the term
[0030] Azacitidine, a cytidine analogue, also known as 5-azacitidine (trade names Vidaza or Vidaza), along with its deoxycytidine analogue 5-Aza-2'-deoxycytidine (5-Aza-CdR), or decitabine (DAC), has been widely used clinically to treat viral infections and cancer. Decitabine inhibits DNA methylation at low doses and DNA synthesis at high doses. 5-Aza-CdR's inhibition of DNA methylation is nonspecific and can induce diffuse changes in gene expression.
[0031] RNA interference: a post-transcriptional gene silencing mechanism that uses double-stranded RNA (dsRNA) to degrade or inhibit homologous mRNA in cells, thereby blocking the expression of target genes.
[0032] Epidermal growth factor receptor (EGFR): EGFR is a large transmembrane glycoprotein with a molecular weight of approximately 180 kDa. It possesses ligand-induced tyrosine kinase activity and is a member of the conserved ErbB receptor family, which includes HER2 / Neu / ErbB2, HER3 / ErbB3, and HER4 / ErbB4. Common characteristics of ErbB receptors include an extracellular (EC) ligand-binding region, a single transmembrane region consisting of two repeating cysteine-rich regions, and an intracellular sequence containing tyrosine kinase and autophosphorylation sites. Upon ligand binding, the receptor dimers, which is crucial for altering the high-affinity state between the ligand and receptor and for transmitting phosphorylation signals between molecules. Whether a homodimer or heterodimer is formed depends on the relative levels of the four receptor types and the activated ligand. EGFR itself possesses tyrosine kinase activity, and when combined with epidermal growth factor (EGF), it can activate relevant genes in the cell nucleus, thereby promoting cell division and proliferation. Increased EGFR expression is observed in gastric cancer, breast cancer, bladder cancer, and head and neck squamous cell carcinoma.
[0033] DNA methyltransferases (DNMTs): DNA methylation primarily depends on DNMTs, and the DNMT family has five members: DNMT1, DNMT2, DNMT3A, DNMT3B, and DNMT3L. DNMT1 is involved in maintaining sequence methylation during cell proliferation, which is essential for maintaining DNA methylation patterns and the aberrant silencing of TSG in cancer cells. DNMT2 can act as an RNA methyltransferase, modifying the 38th cytosine residue in the anticodon loop of certain tRNAs. The main function of DNMT3A and DNMT3B is denovo methylation. DNMT3L belongs to the DNMT3 family and lacks methyltransferase activity, but it can interact with DNMT3A / B to promote denovo DNA methylation. DNMT3A has two different isoforms, while DNMT3B has more than 30 isoforms. Their common characteristics are catalytic activity and a structurally conserved C-terminal domain responsible for binding SAM cofactors and targeting cytosine. This is why they can catalyze the transfer of the CH3 group from SAM to the C5 position of cytosine to form 5-methylcytosine (5mC). In summary, DNMT1 is involved in the maintenance of sequence methylation, while the main role of DNMT3A and DNMT3B is de novo methylation, and they can also participate in the maintenance of methylation.
[0034] DNA methyltransferase DNMT1: An important epigenetic modification gene that plays a crucial role in mammalian gene expression. DNMT1 expression is regulated by cytokines. High levels of cytokines can increase DNMT activity and promote its expression, thereby causing abnormal DNA methylation during gene expression and participating in the occurrence and development of diseases such as inflammation and malignant brain tumors.
[0035] The DNMT1 / UHRF1 complex: This complex consists of UHRF1 (ubiquitin-associated protein) and DNMT1. It mediates the maintenance of DNA methylation, which is involved in the regulation of many important activities, from inhibiting structural opening to maintaining methylation throughout the entire molecular process. In this invention, a decrease in the DNMT1 / UHRF1 complex indicates a significant reduction in tumor cell proliferation, colony formation, and migrating cell numbers at the cellular level.
[0036] Transwell assays, also known as Transwell migration or invasion assays, are laboratory techniques used in cell biology and molecular biology to study cell movement through porous membranes. They are commonly used to investigate cell migration, chemotaxis, and invasion in response to various stimuli, such as growth factors, chemokines, or extracellular matrix components. Transwell assays are also an important tool for studying cell behavior in vitro, providing insights into various biological processes, including cancer metastasis, immune cell migration, and tissue development. Cell behavior is quantified by counting the number of cells migrating or invading at the bottom of the chamber or within the culture medium, or by measuring changes in various cell parameters, such as cell motility and chemotactic responses.
[0037] Example
[0038] Example 1: Detection of the biological function of NSUN7 in lung cancer sensitive and drug-resistant cells
[0039] 1.1 Test Materials
[0040] The tested non-small cell lung cancer cells sensitive to EGFR-TKIs were HCC827 and PC9.
[0041] All the cells mentioned above were purchased from the National Biomedical Experimental Cell Resource Bank and cultured and passaged under normal conditions in the applicant's laboratory.
[0042] The EGFR-TKI-resistant non-small cell lung cancer cells used in the tests—HCC827 / GR (gefitinib resistant), HCC827 / OR (osimertinib resistant), PC9 / GR (gefitinib resistant), and PC9 / OR (osimertinib resistant)—were prepared in our laboratory. The preparation process was as follows: HCC827 and PC9 sensitive cells were treated with 10 nM gefitinib (Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: G125799) or osimertinib (Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: A302849). After two weeks, the concentration was increased to 50 nM, after four weeks to 100 nM, and after six weeks to 500 nM. Osimertinib-resistant cells were maintained at a drug concentration of 500 nM for 12 weeks. Gefitinib-resistant cells had their concentration increased to 1 μM at 8 weeks and maintained for 12 weeks.
[0043] The universal empty vector plasmid, pCDH-CMV-3×FLAG-mCherry-Neo, was provided by Beijing Yibaike Biotechnology Co., Ltd.
[0044] The NSUN2 plasmid, NM_001193455, was constructed by Beijing Yibaike Biotechnology Co., Ltd.
[0045] The NSUN6 plasmid, NM_001351115, was constructed by Beijing Yibaike Biotechnology Co., Ltd.
[0046] The NSUN7 plasmid, NM_024677, was constructed by Beijing Yibaike Biotechnology Co., Ltd.
[0047] The universal empty vector plasmid, PLKO.1-U6-Neo, was provided by Beijing Yibaike Biotechnology Co., Ltd.
[0048] The shNSUN7-1 sequence, GGGCTATCCGGACTCCGTTTA, was constructed by Beijing Yibaike Biotechnology Co., Ltd.
[0049] The shNSUN7-2 sequence, GGACAAATCTCGAAGTCTTGC, was constructed by Beijing Yibaike Biotechnology Co., Ltd.
[0050] Table 1. Primers for NSUN7 and nucleotide sequences of shNSUN7-1
[0051]
[0052] 1.2 Test Methods
[0053] A. Select HCC827 and PC9 cell lines, which are sensitive and drug-resistant to non-small cell lung cancer, for stable transfection.
[0054] Cells were seeded in 6-well cell culture plates. When the cells reached 60% confluence, 200 μL of RPMI 1640 was added to both the 20 nM expression plasmid and the empty vector plasmid, and mixed well. Then, 200 μL of RPMI 1640 was added to 6 μL of Lipofectamine 2000, and mixed well. 200 mL of Lipofectamine 2000 dilution (Thermo Fisher Scientific, catalog number: 11668019) was added to the expression plasmid, and mixed well. 400 μL of the mixture was added to the cell culture plate, and after serum-free incubation, the plate was replaced with 10% FBS RPMI 1640. After incubation, the cells were analyzed by RT-qPCR and Western blot.
[0055] B. Cell RNA Extraction and Reverse Transcription Process
[0056] (1) The cell RNA extraction process is as follows: select cells in good growth condition, and extract RNA at a rate of 1 mL / 100000 mL / mL. 6 Each cell was treated with Trizol reagent (Invitrogen, USA, catalog number: 15596026). The tissue RNA extraction procedure involved removing the frozen tissue from the liquid nitrogen tank, cutting approximately 200 mg, and grinding the tissue sample in a cold mortar. 1 mL of Trizol reagent was added to every 100 mg of tissue sample.
[0057] (2) After complete lysis, extract with chloroform, adding 0.2 ml of chloroform to every 1 mL of Trizol. Shake vigorously, then centrifuge at 12000 g, 4 °C for 15 min.
[0058] (3) Transfer the colorless upper layer of the separated liquid to a new centrifuge tube and precipitate it using pre-cooled isopropanol. Add 0.5 mL of isopropanol for every 1 mL of Trizol. Centrifuge at 12000 g for 10 min at 4 °C and discard the supernatant.
[0059] (4) Wash the precipitate with 75% ethanol, add 1 mL of 75% ethanol to 1 mL of Trizol, centrifuge at 7500 g and 4 °C, and discard the supernatant. After drying, dissolve in an appropriate amount of DEPC-H2O, confirm by agarose gel electrophoresis, determine the RNA concentration by NanoDrop, and store frozen.
[0060] (5) Take 1.0 μg of RNA and reverse transcribe it into cDNA. Use the TransScript II First-Strand cDNA Synthesis SuperMix kit (catalog number: AH301-02) produced by Beijing TransGen Biotech Co., Ltd.: Add 1 μL of Anchored Oligo(dT)20, 10 μL of 2×TS Reaction Mix and 1 μL of RT / RI Enzyme Mix to DEPC-H2O to a final volume of 20 μL. Reaction conditions: 42℃ for 30 min, 85℃ for 5 min. The cDNA obtained by reverse transcription is then stored at -20℃.
[0061] C. qPCR detection
[0062] (1) qPCR primer sequences:
[0063] Primer pair 1 NSUN7 primers
[0064] Upstream primer: 5'-CCAGATCATTTGAGCAGTCTTATT-3';
[0065] Downstream primer: 5'-GGTTCTCTACTTCTTGAACTTCTGA-3'.
[0066] Primer pair 2 NSUN1(NOP2) primers
[0067] Upstream primer: 5'-CCCTCAGTCCCAGACAGGAAA-3';
[0068] Downstream primer: 5'-CTGAGTCTGCCCCTTTGGAG-3'.
[0069] Primer pair 3 NSUN2 primers
[0070] Upstream primer: 5'-GAACTTGCCTGGCACACAAAT-3';
[0071] Downstream primer: 5'-TGCTAACAGCTTCTTGACGACTA-3'.
[0072] Primer pair 4 NSUN3 primers
[0073] Upstream primer: 5'-TGGGTCTGTTTGGAATCCTATT-3';
[0074] Downstream primer: 5'-TGCACCACCTTAAATCATTGTTAC-3'.
[0075] Primer pair 5 NSUN4 primers
[0076] Upstream primer: 5'-CCATCAATCCGTGTCAGTCTC-3';
[0077] Downstream primer: 5'-GCTTAGCACTTACATGATCCCAG-3'.
[0078] Primer pair 6 NSUN5 primers
[0079] Upstream primer: 5'-CGCTACCATGAGGTCCACTAC-3';
[0080] Downstream primer: 5'-GCATCTCGCACCACGTCTT-3'.
[0081] Primer pair 1 NSUN6 primers
[0082] Upstream primer: 5'-CAGAATGCCTTATTGTTAGGGCT-3';
[0083] Downstream primer: 5'-ACCATATCAAGTTTAACCGCCTT-3'.
[0084] The internal reference primer used for homogenization is a primer with Beta-Aactin as the internal reference.
[0085] Upstream primer: 5'-TTAGTTGCGTTACACCCTTTC-3';
[0086] Downstream primer: 5'-ACCTTCACCGTTCCAGTTT-3'.
[0087] (2) Reaction system for qPCR amplification
[0088] As shown in Table 2.
[0089] Table 2. Reaction system for qPCR amplification
[0090]
[0091] Note: 2×SYBR-Green: Zymo Research, USA, product number E2004.
[0092] (3) The PCR reaction conditions are as follows:
[0093] The fluorescence was collected after 40 cycles of 50℃ for 2 min, 95℃ for 10 min, 95℃ for 15 s, and 60℃ for 1 min. A melting curve was then constructed using the same cycle. The experimental results were analyzed using 2... -ΔΔCt The analytical data and melting curves ensure the specificity of the product.
[0094] D. Western blotting analysis
[0095] (1) Sample preparation
[0096] The lung cancer cells to be tested were seeded into culture dishes. When the cells grew to about 60-80%, 3-5 culture dishes were collected from each group.
[0097] (2) Collect and wash the samples
[0098] Wash cells with PBS, then treat with 1% formalin for 10 min. Wash cells with ice-cold PBS, then transfer them to PBS using a cell scraper, centrifuge at 3,000 rpm for 2 min at 4°C, and discard the supernatant. Resuspend the cell pellet in 400 μl of lysis buffer and incubate on ice.
[0099] (3) Western blotting
[0100] After quantification, 30 μg / well was calculated as the loading volume. The sample was added to 5×SDS gel loading buffer (Genstar, China, catalog number: E153-05), heated, and the following samples were added sequentially: (control, transfected shNSUN7, 5-Aza-CdR (5 μM), EGFR-TKIs (gefitinib 1 μM or osimertinib 0.5 μM), shNSUN7 combined with EGFR-TKIs (gefitinib 1 μM or osimertinib 0.5 μM), 5-Aza-CdR combined with EGFR-TKIs (gefitinib 1 μM or osimertinib 0.5 μM)). SDS-PAGE electrophoresis was performed at 120V. After electrophoresis, the membrane was transferred to a wet electroporator. After transfer, the PVDF membrane (Millipore, USA, catalog number: IPVH00010) was removed. After blocking with skim milk, the sample was incubated overnight with primary antibody NSUN7 (Wuhan Sanying Biotechnology Co., Ltd., catalog number: 17546-1-AP). Then, secondary antibody labeled with anti-rabbit horseradish peroxidase (Abcam, UK, catalog number: ab6721) was added for incubation. A colorimetric reaction was then performed using an ECL chemiluminescence kit (Themo Fisher Scientific, USA, catalog number: 32132), and development was performed using a Smart Gel Image Analysis System.
[0101] E. Cell biological function experiments
[0102] (1) Cell clone formation experiment
[0103] Cell lines in logarithmic growth phase containing empty vectors and overexpression of the sensitive and resistant NSUN7 gene in HCC827 and PC9 were digested and counted, and seeded into 6-well cell culture plates, with the culture medium changed every three days. Once the cell clones reached a visible size, the culture medium was aspirated, and the cells were washed with PBS. The cells were fixed with paraformaldehyde and washed with PBS. After crystal violet staining, the cells were rinsed, air-dried, photographed, and the number of clones was counted.
[0104] (2) Transfer Experiment
[0105] The cell lines constructed in Step 1, containing empty vectors and overexpressing the NSUN7 gene from sensitive and resistant HCC827 and PC9 cells, were digested and counted. The cells were then added to the upper chamber of a Transwell chamber (Corning Laboratories, USA, catalog number: CLS3422). Serum-free cell suspension was added to each upper chamber, with 2 × 10⁶ cells per well. 4 Cells were cultured in a cell culture incubator and washed with PBS. The cells were fixed with paraformaldehyde and washed with PBS. The cells were stained with crystal violet and rinsed until the wash solution was colorless. The cells in the upper chamber were removed with a cotton swab and the number of migrating cells was counted under a microscope (100×).
[0106] F. Statistical Analysis
[0107] All experiments were repeated at least three times. Results were presented using two-tailed t-tests and are expressed as mean ± standard deviation. *p<0.05 indicates a statistically significant difference, and **p<0.01 indicates an extremely statistically significant difference.
[0108] 1.3 Results Analysis
[0109] Experiments were conducted on NSUN1-7, members of the NOL1 / NOP2 / SUN (NSUN) protein family. Results showed that compared to sensitive cell lines (HCC827 and PC9), NSUN2, NSUN6, and the low-expression NSUN7 were significantly upregulated in drug-resistant cell lines (HCC827 / GR, HCC827 / OR, and PC9 / GR, PC9 / OR). Figure 1 (As shown).
[0110] Overexpression of NSUN2, NSUN6, and NSUN7 revealed no difference in MZF1 splicing variant expression after overexpression of NSUN2 and NSUN6, while overexpression of NSUN7 inhibited MZF1 expression. L Promote MZF1 SInterfering with NSUN7 did not yield the opposite result, suggesting that its differential expression may be synergistically regulated by DNA methylation and RNA methylation.
[0111] The cellular biological functions of exogenously overexpressed or interfered NSUN7-sensitive and drug-resistant lung cancer cells were significantly different. After NSUN7 overexpression, proliferation, colony formation, and migration were significantly increased in both sensitive and drug-resistant cells compared to the control (p<0.01), while proliferation, colony formation, and migration of tumor cells interfered with by NSUN7 were significantly reduced (p<0.01). Example 2 detected the changes in the expression and biological function of MZF1 splice variants in lung cancer cells after the addition of shNSUN7 or 5-Aza-CdR (decitabine).
[0112] 2.1 Test Materials
[0113] The EGFR-TKI-resistant non-small cell lung cancer cells used in the tests, HCC827 / GR (gefitinib resistant) and HCC827 / OR (osimertinib resistant), were prepared in our laboratory. The preparation process was as follows: HCC827 and PC9 sensitive cells were treated with 10 nM gefitinib (Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: G125799) or osimertinib (Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: A302849). After two weeks, the concentration was increased to 50 nM, after four weeks to 100 nM, and after six weeks to 500 nM. Osimertinib resistant cells were maintained at a drug concentration of 500 nM for 12 weeks. Gefitinib resistant cells had their concentration increased to 1 μM at 8 weeks and maintained for 12 weeks.
[0114] 2.2 Test Methods
[0115] A. Western blotting analysis
[0116] (1) Sample preparation
[0117] The lung cancer cells to be tested were seeded into culture dishes. When the cells grew to about 60-80%, 3-5 culture dishes were collected from each group.
[0118] (2) Collect and wash the samples
[0119] Wash cells with room temperature PBS, then treat with formalin. Wash cells with PBS, then transfer them to PBS using a cell scraper, centrifuge at 3000 rpm for 2 min, and discard the supernatant. Resuspend the cell pellet in lysis buffer and incubate on ice.
[0120] (3) Western blotting
[0121] After quantification, 30 μg of sample was added to each well to calculate the loading volume. The sample was then added to SDS gel loading buffer (Genstar, China, catalog number: E153-05), heated, and loaded sequentially. SDS-PAGE electrophoresis was performed at 120V. After electrophoresis, the sample was transferred to a wet electroporator for membrane transfer. After transfer, the PVDF membrane (Millipore, USA, catalog number: IPVH00010) was removed. The membrane was blocked with skim milk and incubated overnight with primary antibody: NSUN7 polyclonal antibody (Wuhan Sanying Biotechnology Co., Ltd., catalog number: 17546-1-AP). Secondary antibody labeled with anti-rabbit horseradish peroxidase (Abcam, UK, catalog number: ab6721) was added for incubation. A colorimetric reaction was then performed using an ECL chemiluminescence kit (Themo Fisher, USA, catalog number: 32132), and development was performed using a Smart Gel Image Analysis System.
[0122] B. Cell biological functional experiments
[0123] (1) Cell clone formation experiment
[0124] Sensitive and resistant HCC827 and PC9 cells in the logarithmic growth phase were digested and counted separately, and seeded into cell culture plates at 100 cells per well. The culture medium was changed every three days. The cells were transfected with the shNSUN7 plasmid and then treated with 5-Aza-CdR (MCE, USA, catalog number: HY-A0004, 5 μM), EGFR-TKI inhibitors (gefitinib 1 μM, Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: G125799 or osimertinib 0.5 μM, Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: A302849), or shNSUN7 + EGFR-TKI inhibitors (gefitinib 1 μM or osimertinib 0.5 μM), or 5-Aza-CdR (5 μM) + EGFR-TKI inhibitors (gefitinib 1 μM or osimertinib 0.5 μM). After the cell clones reached a visible size, the culture medium was aspirated and the cells were washed with PBS. Fixed with paraformaldehyde and washed with PBS. Stained with crystal violet, rinsed, air-dried, photographed, and the number of clones was counted.
[0125] (2) Transfer Experiment
[0126] Resistant HCC827 cells in the logarithmic growth phase were digested and counted, and then added to the upper chamber of a Transwell chamber (Corning Laboratories, catalog number: CLS3422). Serum-free cell suspension was added to each upper chamber, and 2 × 10⁶ cells were added to each well. 4Cells were cultured in the following ways: 5-Aza-CdR (5 μM), EGFR-TKI inhibitors (gefitinib 1 μM or osimertinib 0.5 μM), and transfected with shNSUN7 plasmid; or 5-Aza-CdR + EGFR-TKI inhibitors (gefitinib 1 μM or osimertinib 0.5 μM), or shNSUN7 + combined with EGFR-TKI inhibitors (gefitinib 1 μM or osimertinib 0.5 μM). Complete culture medium was added to the lower chamber; cells were cultured in a cell culture incubator and carefully washed with PBS; fixed with paraformaldehyde and washed with PBS; stained with crystal violet, and rinsed until the wash buffer was colorless. Cells were carefully removed from the upper chamber with cotton swabs and the number of migrating cells was counted under a microscope (100×).
[0127] C. Statistical Analysis
[0128] All experiments were repeated at least three times. Results were presented using two-tailed t-tests and are expressed as mean ± standard deviation. *p<0.05 indicates a statistically significant difference, and **p<0.01 indicates an extremely statistically significant difference.
[0129] 2.3 Results Analysis
[0130] Adding shNSUN7 to cells or treating cells with 5-Aza-CdR or EGFR-TKI inhibitors, and using shNSUN7 or 5-Aza-CdR alone, significantly decreased the expression of the DNA methyltransferase DNMT1 / UHRF1 complex and the methyltransferase NSUN7 in EGFR-TKI-sensitive cell lines, as well as the expression of the EGFR-TKI-sensitive gene MZF1. L Upregulated expression of the EGFR-TKI resistance gene MZF1 S Expression decreased, however, no significant changes were observed in DNA methyltransferase and RNA methyltransferase in drug-resistant cell lines.
[0131] After the combined use of shNSUN7 and EGFR-TKI inhibitors or 5-Aza-CdR and EGFR-TKI inhibitors, the expression of the DNA methyltransferase DNMT1 / UHRF1 complex and the methyltransferase NSUN7 was significantly decreased, and the expression of the EGFR-TKI sensitive gene MZF1 was also significantly reduced. L Upregulated expression of the EGFR-TKI resistance gene MZF1 S Expression decreased.
[0132] When shNSUN7 was used in combination with an EGFR-TKI inhibitor or 5-Aza-CdR and an EGFR-TKI inhibitor, the proliferation, colony formation and migration of HCC827 / GR and HCC827 / OR cells were significantly reduced compared with the control group and the group using shNSUN7, 5-Aza-CdR and EGFR-TKI inhibitors alone (p<0.01).
Claims
1. A method to promote MZF1 in drug-resistant non-small cell lung cancer cells L Expressing and inhibiting MZF1 S The pharmaceutical composition expressed is an inhibitor of NSUN7 gene expression and an EGFR inhibitor, which, when applied to drug-resistant non-small cell lung cancer cells, causes the drug-resistant lung cancer cells to transform into sensitive cells; the inhibitor of NSUN7 gene expression is shNSUN7; the shNSUN7 gene includes shNSUN7-1 and shNSUN7-2, the nucleotide sequence of shNSUN7-1 is shown in SEQ ID NO.3; the nucleotide sequence of shNSUN7-2 is shown in SEQ ID NO.
4.
2. A combination of an inhibitor of NSUN7 gene expression and an EGFR inhibitor in the preparation of MZF1 cells that promote drug-resistant non-small cell lung cancer. L Expressing and inhibiting MZF1 S The application of expressed drugs, among which, The inhibitor that suppresses NSUN7 gene expression is shNSUN7; wherein, the shNSUN7 gene fragment includes shNSUN7-1 and shNSUN7-2, shNSUN7-1 is shown in SEQ ID NO.3; shNSUN7-2 is shown in SEQ ID NO.4.
Citation Information
Patent Citations
Biomarker for screening drug-resistant lung cancer
CN118584109A
Drug for improving sensitivity of drug-resistant lung cancer patient to EGFR-TKI inhibitor
CN120392963A