Primers, kits, methods, and applications for detecting pathogenic *Pseudomonas proteus* strains based on the *oprL* gene.
By using oprL gene-specific primers and PCR amplification electrophoresis detection, the problem of distinguishing pathogenicity of Pseudomonas proteus was solved, enabling rapid and accurate pathogenicity determination, reducing antibiotic use, and protecting the ecosystem.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- FUJIAN AGRI & FORESTRY UNIV
- Filing Date
- 2024-10-11
- Publication Date
- 2026-05-26
AI Technical Summary
Existing technologies make it difficult to quickly and accurately distinguish whether Pseudomonas proteus is pathogenic, leading to excessive use of antibiotics in aquaculture and increasing the risk of drug-resistant strains and ecosystem damage.
Specific primers for the oprL gene were designed. Pathogenic *Pseudomonas proteus* were distinguished by PCR amplification and agarose gel electrophoresis based on the electrophoresis images. The primer sequences were oprL-F1, oprL-F2, and oprL-R. Electrophoresis detection of the amplified products showed that 487bp and 407bp bands indicated pathogenicity, while 490bp bands indicated non-pathogenicity.
It enables rapid and accurate detection of the pathogenicity of Pseudomonas murine, is simple and intuitive, provides a basis for the detection and classification of pathogens in aquaculture water, reduces the frequency of antibiotic use, and protects the ecosystem.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial detection technology, specifically relating to primers, kits, methods, and applications for detecting pathogenic Pseudomonas proteus based on the oprL gene of Pseudomonas proteus strain. Background Technology
[0002] *Pseudomonas plecoglossicida*, belonging to the family Pseudomonadaceae and the genus *Pseudomonas*, is an aerobic, rod-shaped, Gram-negative bacterium. It is non-spore-forming, flagellated, and motile. It was first discovered in the sweetfish (*Plecoglossus altivelis*) in 2000, hence its scientific name. Since its discovery and naming, *Pseudomonas plecoglossicida* has been widely detected in fish, water, soil, airborne dust, and on human skin and in saliva. In the research process of Pseudomonas proteus, people have successively discovered that different Pseudomonas proteus isolates have the ability to cause pathogenicity, decompose organic matter, and produce enzymes. At present, the functions of some isolates are still unknown, and not all Pseudomonas proteus are pathogenic. Therefore, it is of great significance to distinguish whether Pseudomonas proteus is pathogenic, to judge its pathogenicity, and to conduct further research on Pseudomonas proteus.
[0003] Studies have shown that pathogenic *Pseudomonas proteus* can infect fish such as sweetfish, large yellow croaker (*Larimichthyscrocea*), grouper (*Epinephlus coioides*), and rainbow trout (*Oncorhynchus mykiss*), posing a significant threat to the aquaculture industry. Currently, there is no vaccine available for this disease, and antibiotics remain the first-line treatment for prevention and treatment in aquaculture. However, prolonged and excessive use of antibiotics can lead to a continuous increase in drug-resistant strains, damage to the aquaculture ecosystem, and threats to the quality and safety of finished products, among other risks. Therefore, determining the pathogenicity of bacterial strains in the water before aquaculture and implementing preventative measures in advance is crucial for improving the economic efficiency of fish farming. Summary of the Invention
[0004] To address the above problems, this invention provides primers, kits, methods, and applications for detecting pathogenic *Pseudomonas proteus* strains based on the oprL gene. This method enables rapid detection of pathogenic *Pseudomonas proteus*, is simple and intuitive, and has good applicability.
[0005] This invention is achieved through the following technical solution:
[0006] A primer for detecting pathogenic *Pseudomonas proteus* strains based on the *oprL* gene, the primer comprising:
[0007] oprL-F1: GCTGAAGTTTGGTAAATTTGCTGCG;
[0008] oprL-F2:CTGGTGAAGGCGCTGTCGAT;
[0009] oprL-R:CTTACGCAGTTCTACGCGACGG.
[0010] A kit for detecting pathogenic *Pseudomonas proteus* strains based on the oprL gene, the kit comprising the primers described above.
[0011] A method for detecting pathogenic *Pseudomonas proteus* strains based on the *oprL* gene, wherein the method uses primers as described above to amplify the *oprL* gene of *Pseudomonas proteus*, and specifically includes the following steps:
[0012] (1) Streak the test strain of Pseudomonas proteus on a TSA plate to obtain a single colony of the test strain, and mix the single colony with water to obtain a mixture.
[0013] (2) Using the mixture as a template, perform PCR amplification reaction using the primers described above to obtain PCR amplification products;
[0014] (3) After the amplification is completed, the PCR amplification products are subjected to agarose gel electrophoresis, and the electrophoresis gel image is observed to determine the pathogenicity of the tested Pseudomonas proteus strain.
[0015] Furthermore, if two target bands of 487bp and 407bp are present in the electrophoresis gel image, the tested strain is pathogenic *Pseudomonas proteus*; if only one band of 490bp is present, the tested strain is non-pathogenic *Pseudomonas proteus*.
[0016] Further, in step (3), the electrophoresis conditions are as follows: detection on a 2.0% agarose gel, PCR amplification product volume of 20 μL, voltage of 100 V, electrophoresis for 60 min.
[0017] Further, in step (2), the PCR amplification reaction system is 50 μL, including: 25 μL of 2×Taq Master Mix, 0.5 μL of primer oprL-F1, 1 μL of primer oprL-F2, 1 μL of primer oprL-R, 0.5 μL of mixed template, and 22 μL of ddH2O.
[0018] Further, in step (2), the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 63℃ annealing for 30 s, 72℃ extension for 40 s, and 16℃ incubation for 10 min.
[0019] Application of the method described above in detecting Pseudomonas proteus infection in fish.
[0020] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows:
[0021] 1. This invention provides specific primers for detecting pathogenic *Pseudomonas proteus* strains based on the *oprL* gene. The primers are designed based on the differential patterns identified after multiple sequence alignment (MSA). Specifically, the PCR amplification primers for the *oprL* gene of all *P. proteus* strains in the NCBI database are compiled from the MSA results. The nucleotide sequences of the primers are shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3. The *oprL* gene of *P. proteus* is amplified by PCR, and the PCR amplification products are then subjected to electrophoresis. The pathogenicity of *P. proteus* can be effectively distinguished based on the electrophoresis images. This invention enables rapid detection of *P. proteus* infection in fish. The primers have good specificity, the method is simple and intuitive, and it has good applicability.
[0022] 2. This invention designs specific primers for detecting pathogenic *Pseudomonas proteus* based on the differential typing patterns. These primers exhibit high specificity and, as verified experimentally, can effectively distinguish pathogenic *Pseudomonas proteus*, providing a basis for future assessments of the pathogenicity of *Pseudomonas proteus*. This method can be applied to the detection of pathogens in aquatic organisms, bacteriological classification, and epidemiological surveys, offering significant social and economic benefits. Attached Figure Description
[0023] Figure 1 This is an image of the electrophoresis results of the PCR amplification products in this invention.
[0024] Figure 2 This is a curve showing the survival rate of *Pseudomonas proteus* during viral challenge in this invention.
[0025] Figure 3 This is an anatomical diagram of a fish after being challenged with Pseudomonas proteus NyZ12 in this invention.
[0026] Figure 4 This is an anatomical diagram of a fish after being challenged with Pseudomonas proteus sea in this invention.
[0027] Figure 5 This is an anatomical diagram of a fish after being challenged with Pseudomonas proteus PQLYC4 in this invention.
[0028] Figure 6This is an anatomical diagram of a fish after being challenged with Pseudomonas proteus 2022L in this invention.
[0029] Figure 7 This is an anatomical diagram of a fish after being challenged with Pseudomonas proteus DSM15088 in this invention. Detailed Implementation
[0030] The present invention will be further described in detail below through embodiments. These embodiments are only used to illustrate the present invention and do not limit the scope of protection of the present invention.
[0031] The experimental strains, main instruments, and reagents used in the following examples are:
[0032] Experimental strains: *P. plecoglossicida* 2013, *P. plecoglossicida* 2014, *P. plecoglossicida* 2015, *P. plecoglossicida* 2016, *P. plecoglossicida* 2017, *P. plecoglossicida* 2018, *P. plecoglossicida* PQLYC4, *P. plecoglossicida* 2019R, *P. plecoglossicida* 2022L (the above strains were isolated from lesions in fish with visceral white spot disease in the laboratory), *P. plecoglossicida* NB2011 (Zhejiang Wanli University, Mao Zhijuan), *P. plecoglossicida* DSM15088 (China Center for Type Culture Collection), *P. plecoglossicida* NZBD9 (Jimei University, Yan Qingpi). These strains are pathogenic. *P. plecoglossicida* NyZ12 (by Yan Dazhong of Wuhan University of Light Industry) and P. plecoglossicida sea (isolated from seawater samples in the laboratory) are non-pathogenic strains.
[0033] Main instruments: Applied Biosystems SimpliAmp PCR thermal cycler, electrophoresis apparatus, fully automated digital gel imaging system. Main reagents: High-purity low-electroosmotic agarose, nucleic acid gel dyes, 1×TAE buffer.
[0034] Example 1: Method for detecting pathogenic *Pseudomonas proteus* strains based on the *oprL* gene.
[0035] Based on the publicly available genome sequence of *Pseudomonas proteus*, the *oprL* gene was selected as the target gene for detection. Primer pairs were designed based on the differential patterns identified by multiple sequence alignment, specifically primers designed from the *oprL* genes in all complete *Pseudomonas proteus* genomes included in the NCBI database. The nucleotide sequences of the primers are as follows:
[0036] oprL-F1: GCTGAAGTTTGGTAAATTTGCTGCG (SEQ ID No. 1);
[0037] oprL-F2: CTGGTGAAGGCGCTGTCGAT (SEQ ID No. 2);
[0038] oprL-R: CTTACGCAGTTCTACGCGACGG (SEQ ID No. 3).
[0039] The method for detecting the oprL genotype of Pseudomonas proteus strains includes the following steps:
[0040] (1) The test strain of Pseudomonas proteus was streaked on a TSA plate to obtain single colonies of the test strain. The specific process is as follows: after streaking the test strain of Pseudomonas proteus on a TSA plate culture medium with an inoculation loop, it was incubated at 25℃ for 24h to obtain single colonies of bacteria.
[0041] (2) In a clean bench, use a pipette tip to collect a single colony of the test strain and thoroughly mix it into 20 μL of deionized water. Using this mixture as a template, perform PCR amplification using primers oprL-F1, oprL-F2, and oprL-R to amplify the oprL gene of the test strain and obtain the PCR amplification product. The PCR amplification reaction system and procedure are as follows:
[0042] The PCR amplification reaction system consisted of 50 μL, including: 25 μL of 2×Taq Master Mix, 0.5 μL of primer oprL-F1, 1 μL of primer oprL-F2, 1 μL of primer oprL-R, 0.5 μL of mixed template, and 22 μL of ddH2O. The PCR amplification reaction program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 63℃ annealing for 30 s, 72℃ extension for 40 s, and 16℃ incubation for 10 min.
[0043] (3) Agarose gel electrophoresis: After amplification, the PCR amplification products were subjected to agarose gel electrophoresis. The electrophoretic gel image was observed to determine the pathogenicity of the tested *Pseudomonas proteus* strain. The specific steps of agarose gel electrophoresis are as follows:
[0044] ① Gel preparation (2%): Add 60mL of 1×TAE buffer and 1.2g of agarose to an Erlenmeyer flask, heat the flask in a microwave oven until boiling, and shake well until there are no particles.
[0045] ② Pouring the gel: First, place the gel plate, insert the comb, and then pour the gel. After the gel cools to about 60℃, add dye (60mL gel + 6μL GelRed) and slowly pour it into the electrophoresis tank. After the gel solidifies, remove the comb.
[0046] ③ Sample loading: 20 μL of PCR amplification product (place the sample wells at the negative end, i.e., black to black, red to red).
[0047] ④ Electrophoresis: Electrophoresis at 100V under stable voltage conditions, and stop electrophoresis when the bromophenol blue has migrated to about 2 / 3 of the gel (about 60 minutes).
[0048] ⑤ Observation Results: Observe the electrophoresis gel imaging on a UV analyzer, such as... Figure 1 As shown.
[0049] from Figure 1 It can be seen that the following Pseudomonas proteobacterium strains are present: PQLYC4 (P. plecoglossicida PQLYC4), NZBD9 (P. plecoglossicida NZBD9), NB2011 (P. plecoglossicida NB2011), and DSM15088.
[0050] (P.plecoglossicida DSM15088), PP2013 (P.plecoglossicida 2013), PP2014
[0051] P. plecoglossicida 2014, PP2015, PP2016, PP2017, PP2018, PP2019R, and PP2022L all showed two target bands of 487bp and 407bp respectively. In contrast, NyZ12 and sea showed only one band of 490bp. The electrophoretic gel imaging results indicate that if the tested *Pseudomonas proteus* strain exhibits two target bands of 487 bp and 407 bp, it is considered pathogenic; if only one band of 490 bp is observed, it is considered non-pathogenic. This allows for rapid detection of the pathogenicity of *Pseudomonas proteus* infecting fish.
[0052] Confirmatory experiments:
[0053] (1) Further challenge experiments were conducted to verify the non-pathogenicity of *Pseudomonas proteus* NyZ12 (*P. plecoglossicida* NyZ12) and *P. plecoglossicida sea* (*P. plecoglossicida sea*). The challenge experiment lasted for 15 days, with 15 large yellow croakers as the sample size. A control group was set up using PBS (PBS is a phosphate buffered saline solution, generally used as a solvent for dissolution and protection). A blank control group was set up to eliminate errors such as the health of the fish, the health of the water, and the intraperitoneal injection technique. Three experimental groups with different concentrations of NyZ12 were set up: NyZ12 1×10⁻⁶. 6 CFU / mL, NyZ12 1×10 7 CFU / mL, NyZ12 1×10 8 CFU / mL and a 1×10 6 The sea experimental group with a CFU / mL concentration.
[0054] Large yellow croaker were intraperitoneally injected with 200 μL of the above-mentioned PBS and 1×10 6 CFU / mL of *Pseudomonas proteus sea* and three different concentrations of *Pseudomonas proteus NyZ12* were used to record the mortality of large yellow croaker over 15 days, and survival rate curves after challenge were plotted. The curves are shown in the figure below. Figure 2 As shown. The bodies of large yellow croakers challenged with *Pseudomonas proteus* NyZ12 and *Sea* bacteria were dissected to examine the visceral infection status, such as... Figure 3 and 4 As shown.
[0055] from Figure 2 As can be seen, after 15 days of experimentation, the large yellow croaker injected with high concentrations of *Pseudomonas aeruginosa* NyZ12 and *Pseudomonas aeruginosa* sea remained healthy and survived, with a survival rate of 100%. Figure 3 and Figure 4 The anatomical diagram shows that the spleen of the large yellow croaker is normal and has not developed any lesions, indicating that *Pseudomonas proteus* NyZ12 and *Pseudomonas proteus* sea do not cause white spot disease of the large yellow croaker's internal organs.
[0056] (2) Further challenge experiments were conducted to verify the pathogenicity of *Pseudomonas proteoglycans* PQLYC4, DSM15088, and 2022L. The challenge experiment lasted for 15 days, with 15 large yellow croakers as the sample size. A control group was set up using PBS (phosphate buffered saline solution, generally used as a solvent for dissolution and protection). A blank control group was set up to eliminate errors such as the health of the fish, the health of the water, and the method of intraperitoneal injection. The experimental group consisted of PQLYC4 2×10⁻⁶. 3 CFU / mL, 2022L 2×10 3 CFU / mL. And three different concentrations of DSM15088 in the experimental groups: DSM1508 1×10⁻⁶. 6 CFU / mL, DSM1508 1×10 7 CFU / mL, DSM1508 1×10 8 CFU / mL (PQLYC4 and 2022L were isolated from lesions of visceral white spot disease in the laboratory, so low concentrations were used in the challenge experiment; DSM15088 was purchased from the China Center for Type Culture Collection, so medium to high concentrations were used in the challenge experiment).
[0057] Large yellow croaker were intraperitoneally injected with more than 200 μL of PBS and 2×10 3 CFU / mL concentration of Pseudomonas proteus PQLYC4, 2×10 3 CFU / mL concentration of Pseudomonas proteus 2022L, and 1×10 6 CFU / mL, 1×10 7 CFU / mL, 1×10 8CFU / mL concentration of *Pseudomonas proteoglycans* DSM15088 was used to record mortality in large yellow croaker over 15 days. Survival rate curves for challenges with *Pseudomonas proteoglycans* PQLYC4, 2022L, and DSM15088 were plotted. The curves are shown below. Figure 2 As shown. The bodies of large yellow croakers challenged with three types of *Pseudomonas proteus* were dissected to examine the visceral infection status, such as... Figure 5 , 6 As shown in Figure 7.
[0058] from Figure 2 It was found that after 15 days of experimentation, even at low concentrations, *Pseudomonas aeruginosa* PQLYC4 and 2022L could cause the death of all large yellow croakers, with a mortality rate of 100%. Furthermore, at medium to high concentrations, *Pseudomonas aeruginosa* DSM15088 exhibited strong pathogenicity, with mortality beginning on the third day and all fish dying by the fifth day, resulting in a 100% mortality rate. This indicates that *Pseudomonas aeruginosa* PQLYC4, 2022L, and DSM15088 can cause visceral white spot disease in large yellow croakers. Figure 5 , 6 As shown in the anatomical diagram of Figure 7, the spleen of the large yellow croaker is diseased, with many white nodules growing, which are internal visceral white spots.
[0059] The results of the above virus challenge experiments verified that Figure 1 The conclusion that Pseudomonas proteus is pathogenic based on electrophoretic gel imaging demonstrates the accuracy of the method of the present invention.
[0060] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A primer for detecting pathogenic Pseudomonas aeruginosa based on a Pseudomonas aeruginosa strain oprL gene, characterized by, The primers include: oprL-F1: GCTGAAGTTTGGTAAATTTGCTGCG; oprL-F2:CTGGTGAAGGCGCTGTCGAT; oprL-R:CTTACGCAGTTCTACGCGACGG.
2. A kit for detecting pathogenic *Pseudomonas proteus* strains based on the *oprL* gene, characterized in that... The kit includes the primers as described in claim 1.
Citation Information
Patent Citations
Multiple PCR detection kit for rapidly identifying pathogenic Pseudomonas plecoglossicida, and method thereof
CN103993072A
PCR (Polymerase Chain Reaction) primer and kit for detecting pseudomonas proteinans
CN116987805A