Molecular markers associated with low temperature tolerance in tomato seedlings and their application
By identifying tomato genome Indel markers through whole-genome association analysis and designing primer pairs for PCR amplification, the problem of detecting low temperature tolerance of tomatoes at the seedling stage was solved, accurate breeding improvement was achieved, and the adaptability of tomatoes to low temperatures was improved.
Patent Information
- Application Number
- CN202411073509.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-06
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-08-06
AI Technical Summary
Existing technologies make it difficult to effectively detect and improve the low temperature tolerance of tomatoes in the seedling stage, resulting in damaged or dead tomatoes under low temperature stress, affecting the tomato industry.
Through genome-wide association study (GWAS), an indel molecular marker located at position 6494531 to 6494551 on chromosome 5 of the tomato genome SL2.50 ITAG2.4 was identified. Primers were designed for PCR amplification of COLD-F and COLD-R, and combined with electrophoresis detection, the low temperature tolerance of tomato seedlings was determined.
It has achieved accurate detection of low temperature tolerance of tomatoes at the seedling stage, improved breeding efficiency, provided closely related molecular markers for breeding improvement, and improved the adaptability of tomatoes to low temperatures.
Smart Images

Figure CN118792440B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of tomato genetic breeding, and in particular to molecular markers associated with low temperature tolerance of tomatoes at the seedling stage and their applications. Background Art
[0002] Tomato (Solanum lycopersicum) is the world's largest vegetable crop and one of the most widely cultivated vegetables in my country. Native to the highlands of western South America near the equator, tomatoes are temperature-sensitive, thermophilic plants with an optimum growth temperature of 15-32°C. Low temperature stress can adversely affect tomato growth and is a major constraint on the tomato industry. In production, when temperatures fall below 13°C, growth and development are stunted. Below 5°C, stems and leaves stop growing. Prolonged exposure to temperatures below 6°C leads to plant death. The structure and function of plant cells are affected by low temperatures. Under low temperature induction, plants synthesize protective substances to enhance membrane stability, maintain intracellular metabolic balance, and thus improve their tolerance to low temperatures. Severe low temperatures increase the permeability of plant cell membranes, leading to the extravasation of large amounts of soluble substances within the cells, causing metabolic disorders in the plant. This damages the semipermeability of the cell membranes and causes waterlogged leaves. Under low temperatures, cold-sensitive tomato varieties experience slow or complete cessation of cytoplasmic circulation, leading to severe leaf dehydration, wilting, and even plant death. However, cold-tolerant tomato varieties can synthesize osmotic regulatory substances to maintain metabolic balance. This suggests that the degree of leaf dehydration and wilting under low-temperature stress can reflect the cold tolerance of tomato seedlings. Summary of the Invention
[0003] This application identifies an indel molecular marker associated with low-temperature tolerance in tomato seedlings by phenotyping natural tomato populations under low temperatures and using genome-wide association analysis (GWAS) to identify the association between phenotype and tomato genome sequence variation. This molecular marker enables accurate detection of low-temperature tolerance in tomato seedlings. Furthermore, this application provides closely associated molecular markers for cloning genes that control the degree of leaf wilting caused by water loss in tomato seedlings under low-temperature stress, as well as for breeding tomato varieties for low-temperature tolerance, thus having important application value.
[0004] To this end, the embodiments of the present application disclose at least the following technical solutions:
[0005] In a first aspect, the embodiments disclose a molecular marker associated with low temperature tolerance in tomato seedlings. The molecular marker comprises an Indel deletion sequence from position 6494531 to position 6494551 on chromosome 5 of the tomato reference genome SL2.50 ITAG2.4, wherein the deletion sequence is TTTGTTATACAATTAGCCATT (SEQ ID NO: 1).
[0006] In a second aspect, the embodiments disclose nucleic acid molecules associated with low-temperature tolerance in tomato seedlings. The nucleic acid molecules are set forth in SEQ ID NO: 2 or 3. For example, if a nucleic acid molecule (e.g., a DNA molecule) set forth in SEQ ID NO: 2 is detected in a tomato material, the tomato is homozygous for low-temperature tolerance. If a nucleic acid molecule (e.g., a DNA molecule) set forth in SEQ ID NO: 3 is detected in a tomato material, the tomato is homozygous for non-low-temperature tolerance.
[0007] In a third aspect, the embodiments disclose a primer pair. The primer pair comprises the DNA molecules set forth in SEQ ID NOs: 4 and 5. The primer pair is used to amplify a target sequence comprising nucleotides 6494531 to 6494551 of chromosome 5, SL2.50 ITAG2.4, of the tomato genome. The target sequence is set forth in SEQ ID NO: 1.
[0008] In a fourth aspect, the embodiment discloses a PCR amplification kit, which includes the primer pair of the third aspect and other reagents required for amplification.
[0009] In a fifth aspect, embodiments disclose a method for detecting low-temperature tolerance of tomatoes at the seedling stage. The method comprises: extracting genomic DNA from a tomato material to be tested; performing PCR amplification on the genomic DNA using the primer pair shown in SEQ ID NOs: 4 and 5; and performing electrophoresis on the amplified product. If the electrophoresis shows only a single 253 bp band (SEQ ID NO: 2), the tomato is a homozygous low-temperature-tolerant material; if the electrophoresis shows only a single 232 bp band (SEQ ID NO: 3), the tomato is a homozygous non-low-temperature-tolerant material.
[0010] In a sixth aspect, the embodiments disclose applications of the molecular markers described in the first aspect, the nucleic acids described in the second aspect, the primer pairs described in the third aspect, and the kit described in the fourth aspect. The applications are selected from at least one of detecting low temperature tolerance of tomato seedlings and tomato breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 GWAS diagram associated with low temperature tolerance of tomato seedlings provided in the examples.
[0012] Figure 2The electrophoresis diagram of the PCR amplification products of tomato materials (the lane order is LA1482, LA1542, LA1021, LA2283, LA1544, LA1218, LA0012, LA2845, LA2285, LA2133, LA3130, LA0533, LA2626, LA1623, LA0373, LA3214, LA2183 and LA3238) amplified using the primer pairs provided in the examples.
[0013] Figure 3 The electrophoresis diagram of the PCR amplification products of tomato materials (the lane order is LA0422, LA1457, LA2660, LA1847, LA1037, LA3625, LA1620, LA2131, LA2137, LA1307, LA2009, LA1582, LA2670, LA2463, LA2706 and LA0395) amplified using the primer pairs provided in the examples. DETAILED DESCRIPTION
[0014] In order to make the purpose, technical solutions and advantages of this application more clearly understood, the present application is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely for the purpose of explaining this application and are not intended to limit this application. Reagents not described in detail in this application are all conventional reagents and can be obtained from commercial channels; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.
[0015] Molecular markers associated with low temperature tolerance in tomato seedlings
[0016] Example The molecular markers associated with low temperature tolerance in tomato seedlings were screened by genome-wide association analysis.
[0017] The specific process includes:
[0018] 1) Plant and manage a natural population of 34 tomato materials and preserve leaf samples from each plant.
[0019] 2) Under low temperature (4-10°C) stress, the degree of water loss and wilting of tomato leaves at the seedling stage was examined according to the grading system shown in Table 1. If the grading is 0, the material is low-temperature tolerant; if the grading is 1, 2, 3, or 4, the material is not low-temperature tolerant. At least 5 individual plants were investigated for each material.
[0020] Table 13 Grading of wilting degree of water loss in 4 tomato materials after low temperature stress
[0021]
[0022]
[0023] 4) DNA of all tomato materials was extracted using the CTAB method, and high-throughput sequencing libraries were constructed and sequenced using HiSeq4000 (Illumina). The data volume of each material was 35G.
[0024] 5) Bioinformatics and Genome-Wide Association Analysis: The sequenced fragments of each sample were aligned to the tomato reference genome (database ID: Tomato SL2.50 ITAG2.4, https: / / solgenomics.sgn.cornell.edu / ) using bwa software. After alignment, variants were identified using samtools and bcftools. After quality filtering of variant sites, a genome-wide SNP matrix was generated and converted to a bed file. Genome-wide association analysis was performed in tomato using EMMAX.
[0025] The results are as follows Figure 1 As shown, an Indel molecular marker was found at bases 6494531 to 6494551 of the tomato genome SL2.50 ITAG2.4 chromosome 5. The molecular marker comprises an Indel deletion sequence at bases 6494531 to 6494551 of the tomato reference genome SL2.50 ITAG2.4 chromosome 5, and the deletion sequence is TTTGTTATACAATTAGCCATT (SEQ ID NO: 1).
[0026] Application of molecular markers
[0027] Using the designed primer pair COLD-F (SEQ ID NO: 4) and COLD-R (SEQ ID NO: 5), PCR amplification was performed on tomato DNA samples. After separation of the amplified products by 3% agarose gel electrophoresis, if a 253bp band was detected, the tomato material would not experience leaf wilt after exposure to cold, indicating strong cold tolerance. If a 232bp band was detected, the material would experience leaf wilt after exposure to cold, indicating low cold tolerance. Therefore, this marker can be used to determine the cold tolerance of tomatoes at the seedling stage, improving breeding efficiency.
[0028] Based on this, the embodiment provides a primer pair. The primer pair includes the DNA molecules described in SEQ ID NOs: 4 and 5. The primer pair is used to amplify a target sequence comprising nucleotides 6494531 to 6494551 of chromosome 5 of the tomato genome SL2.50 ITAG2.4. The target sequence is shown in SEQ ID NO: 1.
[0029] The embodiment provides a PCR amplification kit. The kit includes the primer pair and other reagents required for amplification. In some embodiments, the reagents required for amplification include Taq DNA polymerase, PCR buffer, and dNTPs.
[0030] The embodiments disclose a method for detecting low-temperature tolerance of tomatoes at the seedling stage. The method comprises: extracting genomic DNA from a tomato material to be tested; performing PCR amplification on the genomic DNA using the primer pair shown in SEQ ID NOs: 4 and 5; and detecting the amplified product by electrophoresis. If the electrophoresis shows only a single 253 bp band (SEQ ID NO: 2), the tomato is a homozygous low-temperature-tolerant material; if the electrophoresis shows only a single 232 bp band (SEQ ID NO: 3), the tomato is a homozygous non-low-temperature-tolerant material.
[0031] The embodiment discloses applications of the molecular marker, the nucleic acid, the primer pair, and the kit, wherein the application is selected from at least one of detecting low temperature tolerance of tomato seedlings and tomato breeding.
[0032] In some embodiments, molecular markers and primers associated with low temperature tolerance of tomato seedlings were used to perform genotyping on 34 tomato materials, and the identification results were used to predict their low temperature tolerance and the degree of water loss and wilting after low temperature stress. The steps are as follows:
[0033] (1) The genomic DNA of the tomato material to be tested was extracted using the CTAB method.
[0034] (2) PCR amplification of tomato genomic DNA was performed using primer pair COLD-F (SEQ ID NO: 4) and COLD-R (SEQ ID NO: 5). The PCR reaction system (20 μL) contained 0.4 μL COLD-F (10 mM), 0.4 μL COLD-R (10 mM), 1.0 μL tomato genomic DNA (100 ng / μL), 2.0 μL 10× PCR Buffer, 0.4 μL dNTPs (10 mM), 0.2 μL Taq DNA polymerase (5 U / μL), and 15.6 μL ddH2O.
[0035] (3) PCR reactions were performed on an S1000 PCR instrument manufactured by Bio-Rad, USA. The PCR amplification program was as follows: pre-denaturation at 95.0°C for 3 min; denaturation at 95.0°C for 30 s, annealing at 55.0°C for 30 s, extension at 72.0°C for 60 s, cycle setting to 95°C for 30 s, 35 cycles; extension at 72.0°C for 5 min, and storage at 4°C.
[0036] (4) The amplified products were detected by 3% agarose gel electrophoresis, and all amplified bands were detected.
[0037] (5) Observe the amplified bands. If electrophoresis detection shows only a 253 bp band (such as SEQ ID NO: 2), the tomato is a homozygous low-temperature-resistant material; if electrophoresis detection shows only a 232 bp band (such as SEQ ID NO: 3), the tomato is a homozygous non-low-temperature-resistant material.
[0038] (6) The identification results are shown in Table 2. Based on the phenotype of wilting after cold exposure to this batch of tomatoes, the accuracy of the marker was found to be 76% (Table 2). In Table 2, wilting after cold exposure to water loss in the field was recorded as 1, and no wilting was recorded as 0; a marker band pattern of 232 bp was recorded as 1, and a marker band pattern of 253 bp was recorded as 0.
[0039] like Figures 2-3 As shown in Table 2, the molecular markers provided by this application can accurately detect or predict the low-temperature tolerance of tomatoes at the seedling stage using these tomato materials. Furthermore, this application provides closely related molecular markers for cloning genes that control the degree of leaf wilting caused by water loss in tomato seedlings under low-temperature stress, as well as for breeding tomato varieties for low-temperature tolerance, thus possessing important application value.
[0040] Table 2
[0041] Tomato material name Mark judgment results Actual phenotype in the field Tomato material name Mark judgment results Actual phenotype in the field LA1482 0 1 LA3238 0 0 LA1542 0 0 LA0442 0 0 LA1021 1 1 LA1457 1 1 LA2283 0 1 LA2660 1 0 LA1544 1 1 LA1847 1 0 LA1218 1 1 LA1037 0 0 LA0012 0 0 LA3625 0 0 LA2845 0 0 LA1620 0 0 LA2285 1 0 LA2131 0 0 LA2133 0 0 LA2137 0 0 LA3130 0 0 LA1307 0 0 LA0533 0 0 LA2009 0 0 LA2626 0 0 LA1582 1 0 LA1623 1 0 LA2670 0 0 LA0373 0 0 LA2463 0 0 LA3214 0 0 LA2706 0 0 LA2183 1 0 LA0395 0 0
[0042] The above is only a preferred specific implementation method of the present application, but the scope of protection of the present application is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed in this application should be covered by the scope of protection of the present application.
Claims
1. The method for detecting the low temperature tolerance of tomato seedlings includes: Extracting genomic DNA of tomato materials to be tested; PCR amplification of the genomic DNA using the primer pair shown in SEQ ID NOs: 4 and 5; The amplified products were detected by electrophoresis; If the electrophoresis detection shows only one 253 bp band, the tomato is a homozygous low-temperature-resistant material; if the electrophoresis detection shows only one 232 bp band, the tomato is a homozygous non-low-temperature-resistant material.