Antimicrobial peptide PmAMP12 from pearl cylindrotheca and its application

Abstract

The present invention discloses an antimicrobial peptide PmAMP12 from pearl columnar algae, and its amino acid sequence is shown in SEQ ID NO: 2. The present invention also discloses its application in antibacterial. Expressing PmAMP12 on the cell surface of Agrobacterium tumefaciens can destroy the integrity of Agrobacterium tumefaciens cells; PmAMP12 exhibits inhibitory activity against a variety of Gram-negative bacteria, Gram-positive bacteria and fungi, and studies have also found that PmAMP12 can directly destroy the integrity of cells and cause changes inside cells. The antimicrobial peptide PmAMP12 of the present invention provides a new and excellent biological resource for the development of green biological pesticides, and has great application potential in agricultural production.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to an antimicrobial peptide PmAMP12 from a pearly columnar algae and an application thereof. Background Art

[0002] While the long-term and large-scale use of antibiotics brings benefits, it also causes ecological safety problems. In particular, in recent years, the problem of antibiotic resistance in microorganisms has become increasingly serious, threatening the health of humans, animals and plants. Because antibiotics are used for a long time and have a single target, they are easy to cause pathogens to develop resistance, and the mining of antibiotics also faces bottlenecks such as low flux and poor activity. Therefore, there is an urgent need to explore alternatives to antibiotics. Antimicrobial peptides (AMPs) are a class of small molecule peptides with antibacterial activity, also known as host defense peptides (HDPs). They are the product of natural evolution of organisms and are widely present in the biological world. They have excellent characteristics such as broad-spectrum bactericidal, high stability, and not easy to develop resistance, and have great application potential (Campos Marcelo Lattarulo et al., 2018). Current studies have shown that AMPs are generally composed of 15 to 100 amino acids (Campos Marcelo Lattarulo et al., 2018), have broad-spectrum antifungal and antibacterial activity, and also exhibit good inhibitory and killing effects on viruses, parasites, tumor cells, etc., and are generally considered to be an effective alternative to antibiotics.

[0003] Unlike animals, plants do not have a specific immune system. However, in the face of various microbial infections and environmental stresses, plants have developed a unique nonspecific immune defense system after long-term evolution, of which AMPs are an important part of the plant defense system (Neeloffer Mookherjee et al., 2020). Effective mining and utilization of plant-derived AMPs can provide excellent genetic resources for the application of agricultural biotechnology. According to previous literature reports, researchers have divided plant-derived AMPs into eight categories based on the amino acid sequence and structural characteristics of plant-derived antimicrobial peptides, including thiophene, plant defense peptides, lipid transfer proteins, rubber, knotting, ecdysone, cyclic peptides, and impatiens; the polypeptide structure of AMPs directly affects its function (James P. Tam et al. 2015). According to the spatial structure of AMPs, it can be divided into α-helix, β-fold, AMPs rich in Cys residues or other special amino acid residues, among which α-helix AMPs are the most widely distributed and have been studied relatively more. AMPs have been used in biomedicine, environmental science and other related fields due to their advantages such as broad antibacterial spectrum, fast action, good thermal stability and low resistance to drug resistance. However, there are not many studies and applications in the field of agricultural plant disease prevention and control, and research on the mechanism of action of AMPs also needs further exploration.

[0004] In the actual activities of agricultural plant disease prevention and control, pesticides have always occupied a dominant position. Agricultural antibiotics are one of the main active substances in pesticides. At present, they have problems such as single type, poor effect, toxicity to plants when used in high doses, and easy to produce drug resistance (George W.Sundin et al., 2018). Therefore, it is extremely urgent to develop green and safe biological pesticides. AMPs, as natural substances with antibacterial activity, have great potential to be developed into pesticides with commercial value. Identification of AMPs can fully tap the value of important genetic resources in plants, develop green biological pesticides, and provide effective biological resources for plant disease prevention and control.

[0005] References

[0006] 1.Campos Marcelo Lattarulo, de Souza Camila Maurmann, de Oliveira Kamlla Botelho Sampalo, Dias Simoni Campos and Franco Luiz.The role ofantimicrobial peptides in plant immunity[J].Journal of Experimental Botany,2018,69(21):4997-5011.

[0007] 2.Neeloffer Mookherjee,Marilyn A.Anderson,Henk P.Haagsman and DonaldJ.Davidson.Antimicrobial host defense peptides:functions and clinicalpotential[J].Nat Rev Drug Discov,2020,19(5):311-332.

[0008] 3.James P.Tam,Shujing Wang,Ka H.Wong and Wei Liang Tan.AntimicrobialPeptides from Plants[J].Pharmaceuticals(Basel),2015,8(4):711-757.

[0009] 4.George W.Sundin and Nian Wang.Antibiotic resistance in plant-pathogenic bacteria[J].Annu Rev Phytopathol.2018,25(56):161-180. Summary of the invention

[0010] The purpose of the present invention is to provide a pearl columnar drum algae antimicrobial peptide PmAMP12 and its application, so as to solve the shortcomings of the prior art.

[0011] The present invention adopts the following technical solutions:

[0012] In a first aspect, the present invention provides an antimicrobial peptide PmAMP12 from the pearly columnar algae, the amino acid sequence of which is shown in SEQ ID NO:2.

[0013] The second aspect of the present invention provides a gene encoding the antimicrobial peptide PmAMP12 of the pearl columnar algae, and the nucleotide sequence thereof is shown in SEQ ID NO:1.

[0014] The third aspect of the present invention provides a recombinant vector, an expression cassette, a transgenic cell line, a transgenic plant or a recombinant microorganism containing the gene encoding the antimicrobial peptide PmAMP12 of the pearl columnar algae.

[0015] The fourth aspect of the present invention provides the use of any one of the following 1)-3) substances in antibacterial treatment:

[0016] 1) the above-mentioned antimicrobial peptide PmAMP12 from the pearl columnar algae;

[0017] 2) The gene encoding the antimicrobial peptide PmAMP12 of the aforementioned pearl columnar drum algae;

[0018] 3) A recombinant vector, expression cassette, transgenic cell line, transgenic plant or recombinant microorganism containing the coding gene of the above-mentioned pearl columnar drum antimicrobial peptide PmAMP12.

[0019] Furthermore, the antibacterial activity is the inhibition of Gram-negative bacteria, Gram-positive bacteria, and fungi.

[0020] Furthermore, the Gram-negative bacteria include Agrobacterium tumefaciens, Burkholderia, Pseudomonas syringae, Xanthomonas, Pectobacterium, Erwinia, and Bacillus; the Gram-positive bacteria include Bacillus; and the fungi include Fusarium.

[0021] Beneficial effects of the present invention:

[0022] The present invention provides an antimicrobial peptide PmAMP12 from pearl columnar drum algae. PmAMP12 can be expressed on the cell surface of Agrobacterium tumefaciens to destroy the integrity of Agrobacterium tumefaciens cells. PmAMP12 shows inhibitory activity against a variety of Gram-negative bacteria, Gram-positive bacteria and fungi (Gram-negative bacteria include Agrobacterium tumefaciens, Burkholderia gladiolus, Pseudomonas syringae pv. tomato, Pseudomonas syringae pv. kiwifruit, citrus canker, rice bacterial leaf streak pathogen, rice white leaf blight pathogen, carrot soft rot pectinobacterium, Asian amylovora, and Dadantidicella; Gram-positive bacteria include Bacillus cereus, and fungi include Saccharomyces cerevisiae and Fusarium graminearum). Studies have also found that PmAMP12 can directly destroy the integrity of cells and cause changes inside cells.

[0023] The antimicrobial peptide PmAMP12 of the present invention is a plant-derived antimicrobial peptide that can significantly inhibit the activity of a variety of plant pathogenic bacteria and fungi, and is used to prevent and control plant diseases caused by plant pathogenic bacteria and fungi. It is expected to be used at a low concentration, with rapid effects, long action time, and is eco-friendly. Pathogens are not likely to develop resistance after treatment, etc. The antimicrobial peptide PmAMP12 of the present invention provides a new and excellent biological resource for the development of green biological pesticides, and has great application potential in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 These are the results of observing Agrobacterium tumefaciens cells under a scanning electron microscope (SEM). A is the observation picture of the Agrobacterium tumefaciens strain that expressed PmAMP12 without IPTG induction, and B is the observation picture of the Agrobacterium tumefaciens strain that expressed PmAMP12 after IPTG induction, i.e., after expressing PmAMP12 on the surface of Agrobacterium tumefaciens cells.

[0025] Figure 2 These are the results of scanning electron microscopy (SEM) / transmission electron microscopy (TEM) observations of Pseudomonas syringae pv. tomato DC3000 strain. Figure A is the SEM observation result after exogenous treatment with PmAMP12, Figure B is the TEM observation result of the section after exogenous treatment with PmAMP12, and Figure C is the negative staining TEM observation result after exogenous treatment with PmAMP12.

[0026] Figure 3 These are the results of scanning electron microscopy (SEM) / transmission electron microscopy (TEM) observations of Agrobacterium tumefaciens LBA4404 strain and Liberibacter crescens BT-1 strain. Figure A is the SEM observation result after LBA4404 was co-incubated with sterile double distilled water, Figure B is the SEM observation result after LBA4404 was co-incubated with 10μM PmAMP12, Figure C is the TEM observation result of the slice after LBA4404 was co-incubated with sterile double distilled water, Figure D is the TEM observation result of the slice after LBA4404 was co-incubated with 10μM PmAMP12, Figure E is the SEM observation result after BT-1 was co-incubated with sterile double distilled water, and Figure F is the SEM observation result of BT-1 and 10μM Figure 1 is the scanning electron microscopy observation result after co-incubation with PmAMP12, Figure G is the transmission electron microscopy observation result of the slice after co-incubation of BT-1 with sterile double distilled water, and Figure H is the transmission electron microscopy observation result of the slice after co-incubation of BT-1 with 10μM PmAMP12. DETAILED DESCRIPTION

[0027] The present invention is further explained below in conjunction with the examples and drawings. The following examples are only used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0028] The following examples are related to the following culture medium formula:

[0029] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder, pH 7.4. Sterilize at 121°C for 15 minutes. Remove the agar powder from the liquid medium.

[0030] KB medium: peptone 20 g / L, dipotassium hydrogen phosphate 1.5 g / L, magnesium sulfate heptahydrate 1.5 g / L, glycerol 10 ml / L, agar powder 15 g / L, pH = 7.2. Sterilize at 121°C for 15 minutes.

[0031] NA medium: peptone 10g / L, beef extract 3g / L, sodium chloride 5g / L, agar powder 15g / L, pH = 7.3. Sterilize at 121℃ for 15 minutes.

[0032] YEP medium: beef extract 5g / L, yeast extract 1g / L, peptone 5g / L, sucrose 5g / L, magnesium sulfate heptahydrate 4g / L, agar powder 15g / L, pH = 7.4. Sterilize at 121℃ for 15 minutes.

[0033] YPD medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, agar powder 20 g / L, pH = 6.5. Sterilize at 121°C for 15 minutes.

[0034] YPDA medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, adenine sulfate 0.03 g / L, agar powder 20 g / L, pH = 6.5. Sterilize at 121°C for 15 minutes.

[0035] BAK6.5 medium: 550 ml water, 4 g α-ketoglutarate, 20 g ACES buffer, 7.5 g KOH, pH 6.5, sterilize at 121°C for 15 minutes, cool to room temperature, add 150 ml fetal bovine serum (Hyclone), 300 ml insect culture medium (TNM-FH, Hyclone).

[0036] The diameter of the culture dishes (plates) involved in the following examples is 6 cm.

[0037] Example 1 Antibacterial phenotype of antimicrobial peptide PmAMP12 expressed on the cell surface of Agrobacterium tumefaciens

[0038] The present invention firstly performs large-scale antimicrobial peptide analysis and screening on plant genomes through bioinformatics, and then uses the Agrobacterium tumefaciens cell surface display system (CN117904161A) developed by us in the early stage to perform functional screening on the predicted antimicrobial peptide sequences, thereby obtaining the antimicrobial peptide PmAMP12 from Peniummargaritaceum, whose amino acid sequence is shown in SEQ ID NO.2 (the specific full sequence is: methionine-arginine-valine-glutamine-glycine-histidine-tryptophan-histidine-glycine-glutamine-arginine-phenylalanine-cysteine-arginine-arginine-proline-cysteine-glutamate-glutamine-arginine-glutamine-glutamine-arginine-arginine-arginine-glycine-tryptophan-arginine-arginine-arginine-arginine-cysteine-proline-serine-serine-valine-leucine-proline-proline-glutamine-glycine-serine-histidine-leucine), and the nucleotide sequence is shown in SEQ ID NO.1. PmAMP12 can be expressed in prokaryotes, eukaryotes or artificially synthesized. It contains 45 amino acid residues, has a molecular weight of 5620.4 Da, a theoretical isoelectric point of 12.20, 1 negatively charged amino acid residue (glutamic acid), 16 positively charged amino acid residues (arginine and histidine), an aliphatic amino acid index of 30.22, and a hydrophilicity index of -1.702.

[0039] The Agrobacterium tumefaciens cell surface display system (CN117904161A) displays PmAMP12 on the surface of Agrobacterium tumefaciens cells. After IPTG induction, the cells of strains expressing PmAMP12 are observed by scanning electron microscopy to form holes on their cell surfaces, while the cell surfaces of strains not expressing PmAMP12 are relatively intact and no holes are formed. The specific operation is as follows:

[0040] 1. The recombinant Agrobacterium tumefaciens LBA4404 strain containing the Agrobacterium tumefaciens outer membrane protein Atuporin cell surface display PmAMP12 gene vector (reference CN117904161A construction and identification, the gene is PmAMP12 gene (shown in SEQ ID NO.1), the identification primers are AMP-NdeI-F: CGCTGAGGCTCCAGCTGCGGGTATC, AMP-SalI-R: GCCAAGCTTGCATGCCTGCAGGTCG) was inoculated into LB medium containing 100 ng / ul spectinomycin and cultured at 28°C for 24 to 48 hours. It can be seen that the colonies grew well.

[0041] 2. Inoculate the activated colony in step 1 into LB liquid culture medium containing 100 ng / ul spectinomycin, shake and culture at 28°C and 180 rpm for 3 hours, then divide it into two equal parts, add IPTG (isopropyl-β-D-thiogalactoside) to one part to a final concentration of 0.1 μM, and do not treat the other half, continue to shake and culture at 28°C and 180 rpm for 6 hours, collect the bacterial liquid in a 1.5 ml centrifuge tube, centrifuge at 6000 rpm for 5 minutes, remove the culture medium, add 1 ml of 2.5 v / v% glutaraldehyde, mix well and fix at 4°C overnight.

[0042] 3. Centrifuge at 3000rpm for 5 minutes, remove the supernatant, wash the sample three times with 0.1M PBS buffer (pH 7.0), 15 minutes each time, centrifuge at 3000rpm for 5 minutes after each wash, remove the supernatant; add 1ml of 1v / v% osmium acid to the sample for fixation for 1.5 hours, carefully remove the osmium acid solution (suck it out with a pipette in a fume hood), and then use 0.1M The samples were washed three times with PBS buffer at pH 7.0 (same as above); the samples were gradient dehydrated with alcohol of different concentrations, in the order of 30 v / v%, 50 v / v%, 70 v / v%, 85 v / v%, 95 v / v%, and 100 v / v%, with each concentration treated for 15 minutes, and the supernatant was removed by centrifugation at 3000 rpm for 5 minutes after each concentration treatment; the samples were then washed twice with 100 v / v% alcohol, each time for 15 minutes, and the supernatant was removed by centrifugation at 3000 rpm for 5 minutes after each wash; finally, the samples were stored in 100 v / v% alcohol for future use.

[0043] 4. Drying and observation: Drying and coating were carried out in a Hitachi HCP-2 critical point dryer. The treated samples were observed in a Hitachi SU-8010 scanning electron microscope and photographed.

[0044] The results are as follows Figure 1 As shown in the figure, the cell surface of the Agrobacterium tumefaciens strain (A) expressing PmAMP12 without IPTG induction is smooth and undamaged, and the cell morphology is complete and plump; while the cell surface of the Agrobacterium tumefaciens strain (B) expressing PmAMP12 after IPTG induction is rough, with holes, damaged cell morphology, and abnormal structure. This indicates that after expressing PmAMP12 on the cell surface, PmAMP12 damages the bacterial cell membrane, causing damage to the cell integrity. This fully demonstrates the inhibitory and killing effect of PmAMP12 on Agrobacterium tumefaciens.

[0045] Example 2 In vitro incubation to detect the inhibitory effect of antimicrobial peptide PmAMP12 on different plant pathogens

[0046] 1. First, the test strains frozen at -80°C were activated on fresh appropriate solid culture medium plates. The test strains included Agrobacterium tumefaciens, Burkholderia gladioli, Pseudomonas syringaepv.tomato, Pseudomonas syringaepv.actinidia, Xanthomonas citri pv.citri, Xanthomonas oryzae pv.oryzicola, Xanthomonas oryzae pv.oryzae, Pectobacterium carotovorum subsp.carotovorum, Erwinia amylovora, and Pectobacterium oryzae. pyrifoliae), Dickeya dadantii (also known as Erwinia chrysanthemi), Bacillus cereus, Fusarium graminearum, and Saccharomyces cerevisiae; among them, LB medium was used for Agrobacterium tumefaciens, Burkholderia gladiolus, Pseudomonas syringae pv. kiwifruit, Pectinobacterium carrot soft rot, Erwinia amylovora, and Dickeya dadantii, KB medium was used for Pseudomonas syringae pv. tomato, NA medium was used for citrus canker, bacterial leaf streak pathogen of rice, and Xanthoceras oryzae, YEP medium was used for Bacillus cereus, YPD medium was used for Fusarium graminearum, and YPDA medium was used for Saccharomyces cerevisiae; colonies were visible after culturing at 28°C for 24-48 hours.

[0047] 2. Scrape the activated colonies on the culture plate into a 1.5 ml centrifuge tube, suspend and wash twice with sterile double distilled water, centrifuge at 6000 rpm for 5 minutes after each wash to remove the supernatant, then resuspend and dilute with sterile double distilled water to a final concentration of OD600 = 0.05 to obtain the test bacterial solution; dissolve the antimicrobial peptide PmAMP12 (amino acid sequence as shown in SEQ ID NO.2, synthesized by GenScript Biotech Co., Ltd., with a purity of >98%) with sterile double distilled water, dilute to a final concentration of 1 mM, and then dilute with the test bacterial solution to obtain test bacterial solutions with final concentrations of PmAMP12 of 100 μM, 10 μM, 5 μM, 2.5 μM, 1.25 μM, and 0.625 μM, respectively, add the same volume of sterile double distilled water as a negative control (PmAMP12 final concentration of 0 μM), and incubate the prepared samples at 28°C for 6 hours.

[0048] 3. Dilute the incubated samples 100 times and 1000 times with sterile double distilled water, then take 10 μl and spread it evenly on the fresh solid culture medium plate corresponding to the strain to be tested, wrap it with sealing film and culture it at 28°C for 24 to 48 hours.

[0049] 4. Count the number of colonies grown and calculate the antibacterial rate. The antibacterial rate calculation formula is: antibacterial rate = 1-(number of colonies in the treatment group / number of colonies in the control group) x 100%. The results are shown in Table 1.

[0050] The sensitivity test of Gram-negative bacteria to the antimicrobial peptide PmAMP12 showed that PmAMP12 at a concentration of 1.25 μM showed a 100% inhibition rate against Agrobacterium tumefaciens of the α-proteobacteria; the inhibition rate against Burkholderia gladiolus of the β-proteobacteria was over 95%; at the same time, 8 strains of the γ-proteobacteria were tested, among which PmAMP12 at a concentration of 1.25 μM had an inhibition rate of 100% against Pseudomonas syringae pv. tomato, and PmAMP12 at a concentration of 0.625 μM had an inhibition rate of 100% against Pseudomonas syringae pv. kiwifruit. %, and the results of the test on three Xanthomonas showed that the inhibition rate of PmAMP12 against citrus canker reached 100% at a concentration of 5μM, the inhibition rate against rice bacterial leaf spot pathogen reached 100% at a concentration of 2.5μM, and the inhibition rate against rice bacterial leaf blight pathogen exceeded 90% at a concentration of 5μM; the inhibition rate against carrot soft rot pectinobacterium reached 100% at a concentration of 1.25μM, the inhibition rate against Asian fire blight pathogen reached 100% at a concentration of 2.5μM, and the inhibition rate against Dictyoshinoides davidii exceeded 98% at a concentration of 0.625μM; at the same time, we tested the inhibitory effect of PmAMP12 on Gram-positive bacteria (Gram-positive The results showed that the inhibition rate of PmAMP12 at a concentration of 0.625 μM against Bacillus cereus was more than 98%, the inhibition rate of AMP12 at a concentration of 0.625 μM against Saccharomyces cerevisiae was 100%, and the inhibition rate of AMP12 at a concentration of 100 μM against Fusarium graminearum was 100%.

[0051]

[0052] Example 3 Scanning electron microscopy observation of the phenotype of Pseudomonas syringae treated with exogenous PmAMP12

[0053] 1. First, activate the DC3000 strain (the Pseudomonas syringae strain is the model strain Pseudomonas syringae pv. tomato DC3000) frozen at -80°C on a fresh KB medium plate, and colonies appear after culturing at 28°C for 48 hours.

[0054] 2. Scrape the activated colonies on the culture plate into a 1.5 ml centrifuge tube, suspend and wash twice with sterile double distilled water, centrifuge at 6000 rpm for 5 minutes after each wash to remove the supernatant, then resuspend and dilute with sterile double distilled water to a final concentration of OD600 = 1.

[0055] 3. Dissolve and dilute the antimicrobial peptide PmAMP12 (amino acid sequence as shown in SEQ ID NO.2, synthesized by GenScript Biotech Co., Ltd., with a purity of >98%) with sterile double distilled water to a final concentration of 100 μM, then add it to the bacterial solution in step 2 to a final concentration of 10 μM. Incubate at 28°C for 6 hours.

[0056] 4. Centrifuge at 6000 rpm for 5 minutes, remove the supernatant, add 1 ml of 2.5 v / v% glutaraldehyde, mix well and fix at 4°C overnight.

[0057] 5. The sample preparation, drying and observation under scanning electron microscope are the same as steps 3 and 4 in Example 1. The results are as follows: Figure 2 As shown in A, after incubation with 10 μM PmAMP12, damage and holes appeared on the surface of DC3000 cells, indicating that PmAMP12 has inhibitory and killing activity against the DC3000 strain.

[0058] Example 4 Transmission electron microscopy observation of the phenotype of Pseudomonas syringae treated with exogenous PmAMP12 Transmission electron microscopy observation of the sections:

[0059] 1. First, activate the DC3000 strain (the Pseudomonas syringae strain is the model strain Pseudomonas syringae pv. tomato DC3000) frozen at -80°C on a fresh KB medium plate, and colonies appear after culturing at 28°C for 48 hours.

[0060] 2. Scrape the activated colonies on the culture plate into a 1.5 ml centrifuge tube, suspend and wash twice with sterile double distilled water, centrifuge at 6000 rpm for 5 minutes after each wash to remove the supernatant, then resuspend and dilute with sterile double distilled water to a final concentration of OD600 = 1.

[0061] 3. Dissolve and dilute the antimicrobial peptide PmAMP12 (amino acid sequence as shown in SEQ ID NO.2, synthesized by GenScript Biotech Co., Ltd., with a purity of >98%) with sterile double distilled water to a final concentration of 100 μM, then add it to the bacterial solution in step 2 to a final concentration of 10 μM. Incubate at 28°C for 6 hours.

[0062] 4. Centrifuge at 6000 rpm for 5 minutes, remove the supernatant, add 1 ml of 2.5 v / v% glutaraldehyde, mix well and fix at 4°C overnight.

[0063] 5. Centrifuge at 3000rpm for 5 minutes, remove the supernatant, wash the sample three times with 0.1M PBS buffer (pH 7.0), 15 minutes each time, centrifuge at 3000rpm for 5 minutes after each wash, remove the supernatant; add 1ml of 1v / v% osmium acid to the sample for fixation for 1.5 hours, carefully remove the osmium acid solution (suck it out with a pipette in a fume hood), and then use 0.1M The samples were washed three times with PBS buffer at pH 7.0 (same as above); the samples were gradient dehydrated with alcohol of different concentrations, in the order of 30 v / v%, 50 v / v%, 70 v / v%, and 80 v / v%, and each concentration was treated for 15 minutes. After each concentration was treated, the samples were centrifuged at 3000 rpm for 5 minutes to remove the supernatant; the samples were gradient dehydrated with acetone solutions of different concentrations, in the order of 90 v / v% and 95 v / v%, and each concentration was treated for 15 minutes. After each concentration was treated, the samples were centrifuged at 3000 rpm for 5 minutes to remove the supernatant; the samples were then treated with 100 v / v% ethanol for 20 minutes, and the samples were centrifuged at 3000 rpm for 5 minutes to remove the supernatant. Finally, the samples were treated with pure acetone for 20 minutes, and the samples were centrifuged at 3000 rpm for 5 minutes to remove the supernatant.

[0064] 6. Treat the samples with a mixture of spurr embedding medium and acetone (v / v = 1 / 1) for 1 hour; treat the samples with a mixture of spurr embedding medium and acetone (v / v = 1 / 1) for 3 hours; treat the samples with pure spurr embedding medium overnight.

[0065] 7. Embed the infiltration treated samples and heat them at 70°C overnight to obtain the embedded samples.

[0066] 8. The embedded samples were sliced ​​using a LEICA EMUC7 ultra-thin slicer to obtain slices of 70-90 mm.

[0067] 9. Stain the sections with lead citrate solution (0.265 g lead nitrate, 0.352 g sodium citrate dihydrate plus 10 ml double distilled water) and 50% ethanol saturated solution of uranyl acetate for 5-10 minutes each.

[0068] 10. Finally, observe with a Hitachi H-7650 transmission electron microscope and take photos. The results are as follows: Figure 2 As shown in B, it shows that after being treated with PmAMP12, the cell surface was damaged and holes appeared.

[0069] Negative staining transmission electron microscopy observation:

[0070] 1. First, activate the DC3000 strain (the Pseudomonas syringae strain is the model strain Pseudomonas syringae pv. tomato DC3000) frozen at -80°C on a fresh KB medium plate, and colonies appear after culturing at 28°C for 48 hours.

[0071] 2. Scrape the activated colonies on the culture plate into a 1.5 ml centrifuge tube, suspend and wash twice with sterile double distilled water, centrifuge at 6000 rpm for 5 minutes after each wash to remove the supernatant, then resuspend and dilute with sterile double distilled water to a final concentration of OD600 = 1.

[0072] 3. Dissolve and dilute the antimicrobial peptide PmAMP12 (amino acid sequence as shown in SEQ ID NO.2, synthesized by GenScript Biotech Co., Ltd., with a purity of >98%) with sterile double distilled water to a final concentration of 100 μM, then add it to the bacterial solution in step 2 to a final concentration of 10 μM. Incubate at 28°C for 6 hours.

[0073] 4. Centrifuge at 6000 rpm for 5 minutes to remove the supernatant, leaving a small amount of liquid to suspend the bacteria to obtain the bacterial suspension to be tested.

[0074] 5. Cut a piece of sealing film, remove the wrapping paper, fix it on the laboratory table with the clean side facing up, draw 40ul of double distilled water droplets on the sealing film, use a pipette to draw 5ul of the bacterial suspension to be tested and soak it in the double distilled water droplets, wait for the bacteria to diffuse freely in the droplets and become semi-turbid, and then obtain bacterial suspension droplets;

[0075] 6. Place the hydrophilic treated copper mesh upside down on the bacterial suspension droplets and adsorb for about 1 minute. Use the rough edge of filter paper to absorb excess liquid from the edge of the copper mesh.

[0076] 7. Pipette 40ul of double-distilled water onto the sealing film, rinse the copper mesh with the adsorbed bacterial suspension on the double-distilled water droplet once, and then absorb the excess water with filter paper; Pipette 1wt% uranyl acetate onto the sealing film, stain the rinsed copper mesh with 1wt% uranyl acetate for 1 to 3 seconds, and dry it for a few seconds before observing it under a transmission electron microscope.

[0077] 8. Use JEM-1400flash transmission electron microscope to observe and take photos. The results are as follows: Figure 2 C, indicating that the cell surface morphology changes after PmAMP12 treatment.

[0078] Example 5 Observation of the phenotype of Agrobacterium tumefaciens and Liberibacter crescens treated with exogenous PmAMP12 by scanning electron microscopy and transmission electron microscopy

[0079] Agrobacterium tumefaciens used LBA4404 strain and the culture medium was LB medium; Liberibacter crescens used BT-1 strain and the culture medium was BAK6.5 medium; the rest of the operation process was carried out with reference to Example 3 and Example 4, and the strain was co-incubated with sterile double distilled water as a control. Figure 3As shown, PmAMP12 can cause the surface shrinkage of LBA4404 cells and leakage of cytoplasm, and can form holes on the surface of BT-1 cells, thereby inhibiting and destroying the integrity and survival ability of the cells.

Claims

1. The antimicrobial peptide PmAMP12 from Perilla truncatula, the amino acid sequence of which is shown in SEQ ID NO:

2.

2. The coding gene of the antimicrobial peptide PmAMP12 of the pearl columnar algae according to claim 1, whose nucleotide sequence is shown in SEQ ID NO:

1.

3. A recombinant vector, expression cassette or recombinant microorganism containing the gene encoding the antimicrobial peptide PmAMP12 of the pearl columnar algae according to claim 2.

4. Use of any of the following 1)-3) in the preparation of antibacterial products: 1) The antimicrobial peptide PmAMP12 from the pearl columnar algae according to claim 1; 2) The gene encoding the antimicrobial peptide PmAMP12 of the pearl columnar algae according to claim 2; 3) A recombinant vector, expression cassette or recombinant microorganism containing the gene encoding the antimicrobial peptide PmAMP12 of the pearl columnar drum algae according to claim 2; The antibacterial activity is the inhibition of Gram-negative bacteria, Gram-positive bacteria, and fungi; The Gram-negative bacteria are Agrobacterium tumefaciens, Burkholderia, Pseudomonas syringae, Xanthomonas, Pectobacterium, Erwinia, and Bacillus; the Gram-positive bacteria are Bacillus; and the fungus is Fusarium.

Images