Indel drought resistance molecular marker located in the downstream regulatory region of GhHD16 gene and its application

Abstract

The present invention belongs to the technical field of molecular marker-assisted breeding, and in particular, relates to an Indel drought-resistant molecular marker located in the downstream regulatory region of the GhHD16 gene and its application. The Indel drought-resistant molecular marker is located at the 7606th base of the downstream regulatory region of the GhHD16 gene, and the nucleotide sequence of the GhHD16 gene and its downstream regulatory region is shown in SEQ ID NO.1; in drought-resistant cotton germplasm, the nucleotide sequence of the Indel drought-resistant molecular marker is CCTTCACGCGT, and in drought-sensitive cotton germplasm, the nucleotide sequence of the Indel drought-resistant molecular marker is T. The molecular marker of the present invention is closely linked to the phenotypic value of the drought-resistant membership function value, and its genotype has a high consistency with the comprehensive drought resistance of upland cotton. By detecting the genotype of the molecular marker, it is possible to achieve efficient and accurate prediction of the resistance or tolerance of upland cotton germplasm resources to drought stress at the genotype level.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker-assisted breeding, and in particular to an Indel drought-resistant molecular marker located in a downstream regulatory region of a GhHD16 gene and an application thereof. Background Art

[0002] Drought is one of the most harmful abiotic stresses in agricultural production, and the agricultural production losses caused by it are equivalent to the sum of agricultural production losses caused by other abiotic natural disasters. Cotton is an important cash crop and oil crop. Most of its planting areas are distributed in arid and semi-arid areas. Its growth and production are seriously affected by drought stress. Studies have shown that drought stress in the bud and boll stages of cotton will cause the plant to grow slowly, the leaves to become smaller and the number to decrease, the growth rate of new leaves to decrease, and the number of fruit branches to decrease. In severe cases, the plant will stop growing and a natural capping phenomenon will occur; for the entire growth period, drought will cause a serious reduction in cotton production and a significant reduction in fiber quality. In order to reduce the damage caused by drought stress to the cotton industry, exploring the regulatory mechanism of cotton's response to drought stress and breeding or creating highly drought-resistant cotton varieties have become current research hotspots.

[0003] Traditional research on drought-resistant cotton varieties mainly focuses on the screening of phenotypic traits. By measuring the physiological and biochemical indicators of cotton and agronomic traits during growth, such as germination rate, survival rate, stem weight, main root length, root dry weight, cotton fiber length, etc. under normal water supply and continuous drought stress conditions, a comprehensive evaluation is conducted using methods such as comprehensive drought resistance coefficient, principal component analysis, and correlation analysis to identify the drought resistance of different cotton strains. This method usually requires a long time period, and the evaluation method is relatively complex and the cost is relatively high, which restricts its large-scale application and development.

[0004] Drought resistance in cotton is manifested through certain traits determined by genes. The study of cotton drought resistance genes and their mechanisms of action, the discovery of key drought resistance genes and the development of functional molecular markers based on polymorphic motifs that cause phenotypic trait variation within genes, have brought new directions for screening drought-resistant cotton varieties. Functional molecular markers are developed based on polymorphic sequences in genes and are co-segregated with genes. Once developed, they can be directly applied to gene detection. They are applicable to both natural and artificial populations, and can detect target genes in a timely manner, thereby achieving auxiliary selection of target traits controlled by target genes, providing effective means and ways to promote breeding speed and improve target traits. Cotton is an allotetraploid with a relatively complex genome, and there is little exploration of drought resistance genes. Therefore, finding and mining new genes related to drought resistance and developing specific molecular markers provide genetic resources for directional screening and molecular breeding of cotton drought resistance, which is of great significance to cotton drought resistance breeding and genetic improvement. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides an Indel drought resistance molecular marker located in the downstream regulatory region of the GhHD16 gene of upland cotton, which is closely linked to the phenotypic value of the drought resistance membership function value, and its genotype has a high consistency with the comprehensive drought resistance of upland cotton, and can be independently developed as a functional molecular marker. By detecting the genotype of the molecular marker, it is possible to achieve efficient and accurate prediction of the resistance or tolerance of upland cotton germplasm resources to drought stress at the genotype level. Therefore, the present invention provides a detection primer or kit for detecting the Indel variation, and its application in the identification of cotton drought resistance.

[0006] The present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of the present invention provides a detection primer for detecting an Indel drought-resistant molecular marker, wherein the Indel drought-resistant molecular marker is located at the 7606th base in the downstream regulatory region of the GhHD16 gene, and the nucleotide sequence of the GhHD16 gene and its downstream regulatory region is shown in SEQ ID NO.1; in drought-resistant cotton germplasm, the nucleotide sequence of the Indel drought-resistant molecular marker is CCTTCACGCGT, and in drought-sensitive cotton germplasm, the nucleotide sequence of the Indel drought-resistant molecular marker is T.

[0008] Furthermore, the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3 or SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.4 or SEQ ID NO.7.

[0009] Furthermore, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.4; or, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.7.

[0010] A second aspect of the present invention provides a kit, which comprises the detection primers as described above.

[0011] Furthermore, the kit also includes Taq DNA polymerase, dNTPs and a buffer reagent.

[0012] The third aspect of the present invention provides the use of the detection primers or kit for detecting Indel drought resistance molecular markers as described above in the identification of drought resistance of upland cotton.

[0013] A fourth aspect of the present invention provides a method for identifying drought resistance of cotton, comprising the following steps:

[0014] PCR amplification is performed on genomic DNA of upland cotton to be tested using detection primers to obtain PCR amplification products, and whether the PCR amplification products contain an Indel drought-resistant molecular marker, wherein the Indel drought-resistant molecular marker is located at the 7606th base of the sequence shown in SEQ ID NO.1; when a target band containing the Indel drought-resistant molecular marker can be specifically amplified, the upland cotton to be tested is drought-resistant cotton germplasm, and when the target band containing the Indel drought-resistant molecular marker cannot be specifically amplified, the upland cotton to be tested is drought-sensitive cotton germplasm; wherein the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3 or SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4 or SEQ ID NO.7.

[0015] Furthermore, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; when the target band of 578bp type can be specifically amplified, the upland cotton to be tested is drought-resistant cotton germplasm, and when the target band cannot be specifically amplified or the target band without 578bp band type is amplified, the upland cotton to be tested is drought-sensitive cotton germplasm.

[0016] Furthermore, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7; when the target band of 387bp type can be specifically amplified, the upland cotton to be tested is drought-resistant cotton germplasm, and when the target band cannot be specifically amplified or the target band without 387bp band type is amplified, the upland cotton to be tested is drought-sensitive cotton germplasm.

[0017] Furthermore, genomic DNA was extracted using the CTAB extraction method.

[0018] Furthermore, the PCR amplification reaction system, in 20 μL, includes: 2.0 μL of 10× buffer, 0.4 μL of dNTPmix, 0.2 μL of Taq DNA polymerase, 1 μL of genomic DNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer and 16 μL of sterile water; wherein, in the reaction system, the concentrations of the upstream primer and the downstream primer are 1-2 mM, and the concentration of the genomic DNA is 3.75-5 ng / μL.

[0019] Furthermore, the reaction procedure of the PCR amplification includes: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 52-56°C for 30 s, extension at 70-72°C for 30 s, and 30 cycles; and extension at 72°C for 5 min.

[0020] The advantages and positive effects of the present invention are:

[0021] The present invention performs genome-wide association analysis based on drought resistance membership function values ​​as phenotypic data and resequencing data of 517 natural populations of cotton germplasms and 325 cotton chromosome segment substitution line populations, and finds that the Indel variation located in the downstream regulatory region of the upland cotton GhHD16 gene is closely linked to the phenotypic value of the drought resistance membership function value. The corresponding cotton germplasms are grouped according to the Indel variation haplotype, and statistics show that the drought resistance membership function values ​​of plants in different groups are significantly different; further, it is confirmed in natural populations and substitution line populations that the genotype of the Indel variation site has a high consistency with the comprehensive drought resistance ability of upland cotton, and can be independently developed as a molecular marker for application in the identification and breeding of cotton drought resistance. The present invention provides new reliable molecular markers and valuable gene resources for breeding genetically stable drought-tolerant cotton varieties. By detecting the molecular marker genotype with the provided detection primers, it is possible to efficiently and accurately predict the resistance or tolerance of upland cotton germplasm resources to drought stress at the genotype level, without being restricted by environmental factors and breeding time. This is beneficial to greatly improving selection efficiency and accuracy, shortening breeding years, and improving the innovation efficiency of drought-resistant cotton germplasm, and has important economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0023] Figure 1 This is a graph showing the results of the association analysis between the variable sites on the GhHD16 locus and the drought resistance phenotype in an embodiment of the present invention;

[0024] Figure 2 This is a distribution diagram of variant types at different physical locations on the GhHD16 locus in an embodiment of the present invention;

[0025] Figure 3 This is a statistical graph of the membership function values ​​of drought resistance of 325 cotton populations corresponding to different haplotypes of the Indel mutation in the downstream regulatory region of the GhHD16 gene in the embodiment of the present invention;

[0026] Figure 4 The Indel variation haplotype and sequencing peak diagram of the cotton germplasm Yumian 1 and Xuzhou 514 in the embodiment of the present invention;

[0027] Figure 5The results of the amplification of the Indel variation in the downstream regulatory region of the GhHD16 locus using different primer pairs in the embodiments of the present invention are shown in the figure, wherein the upper figure is a sequencing result diagram of the PCR product amplified using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.4, and the lower figure is a gel electrophoresis diagram of the PCR product amplified using the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4;

[0028] Figure 6 The gel electrophoresis diagram of the PCR product of the chromosome fragment replacement line population amplified by the primer pair shown in SEQ ID NO.6 and SEQ ID NO.7 in the embodiment of the present invention, wherein Figure a is a drought-resistant cotton material, and Figure b is a drought-sensitive cotton material;

[0029] Figure 7 This is a gel electrophoresis diagram of PCR products of amplifying a natural population of cotton germplasm using the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4 in an embodiment of the present invention, wherein Figure a is a drought-resistant cotton material, and Figure b is a drought-sensitive cotton material. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the examples. The equipment and reagents used in each embodiment and test example can be obtained from commercial sources unless otherwise specified. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0031] Based on the information contained in this application, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined process, properties or components, because these embodiments and other descriptions are only for illustrating specific aspects of the present invention. In fact, various changes that the technicians in this field or related fields can obviously make to the embodiments of the present invention are all covered within the scope of the appended claims.

[0032] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers used in this application to express the amount, percentage, and other numerical values ​​should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0033] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0034] The present invention studied the key genes for drought resistance in 517 natural populations of cotton germplasms and 325 populations of cotton chromosome segment substitution lines and their parental germplasm materials, used the drought resistance membership function value as the phenotypic data for evaluating the comprehensive drought resistance performance, combined with the above-mentioned germplasm resource resequencing data, and conducted a genome-wide association analysis (GWAS) to identify the drought quantitative trait locus (QTL) segment associated with the drought resistance membership function value, and screened out the upland cotton GhHD16 gene. The virus-induced gene silencing (VIGS) technology was used to silence the expression of the GhHD16 gene, and it was found that the drought resistance of upland cotton plants was enhanced, revealing the response mechanism of GhHD16 in cotton drought response and negative regulation of drought resistance. At the same time, GWAS analysis showed that the Indel variation in the downstream regulatory region of the GhHD16 gene was significantly correlated and closely linked to the phenotypic value of the drought resistance membership function value. The drought resistance membership function values ​​corresponding to different haplotypes at this site were extremely different. The comprehensive drought resistance of cotton germplasm carrying the "CCTTCACGCGT" haplotype was significantly higher than that of cotton germplasm carrying the "T" haplotype. After that, the authenticity and reliability of molecular markers were verified using cotton chromosome segment substitution line populations and upland cotton natural populations, showing that the genotype and phenotype of the Indel variation in different populations were highly consistent, showing that the haplotype in drought-resistant cotton germplasm was CCTTCACGCGT, and the haplotype in drought-sensitive cotton germplasm was T.

[0035] Therefore, the Indel mutation in the downstream regulatory region of the GhHD16 gene of the present invention can be independently developed as a functional molecular marker, and applied to the identification and breeding of cotton drought stress resistance, providing new reliable molecular markers and valuable gene resources for breeding genetically stable drought-tolerant cotton varieties. By detecting the genotype of the molecular marker, it is possible to efficiently and accurately predict the resistance or tolerance of upland cotton germplasm resources to drought stress at the genotype level. Specifically, when the genotype "CCTTCACGCGT" is detected at this site in the cotton material to be tested, it is determined to be drought-resistant germplasm, and when the genotype "T" is detected, it is determined to be drought-sensitive germplasm. The drought-resistant molecular marker of the present invention is used for the screening and identification of cotton drought stress-resistant germplasm resources, which is not limited by environmental factors and breeding time, and is conducive to greatly improving the selection efficiency and accuracy, shortening the breeding period, and improving the innovation efficiency of drought-resistant cotton germplasm, and has important economic value. In addition, the GhHD16 gene provided by the present invention can be used as a target for genetic engineering breeding. The expression of the GhHD16 gene can be silenced by mutation, editing, etc., which provides a new idea for improving the drought resistance of cotton through genetic engineering, and is of great significance to the innovation of drought-resistant cotton germplasm.

[0036] The Indel mutation (i.e., drought resistance molecular marker) in the downstream regulatory region of the GhHD16 gene mentioned above is located at the 118159518bp (based on the position of haplotype "T") on chromosome A11 of the upland cotton TM-1 reference genome "TM-1_HAU-AD1_v1.0", and compared with the reference genome, a genotype mutation of CCTTCACGCGT>T occurs, specifically located at the 7606th base of the GhHD16 locus (sequence see SEQ ID NO.1).

[0037] Based on the above findings, an embodiment of the present invention provides a detection primer for detecting an Indel drought-resistant molecular marker, wherein the Indel drought-resistant molecular marker is located at the 7606th base in the downstream regulatory region of the GhHD16 gene, and the nucleotide sequence of the GhHD16 gene and its downstream regulatory region is shown in SEQ ID NO.1; in drought-resistant cotton germplasm, the nucleotide sequence of the Indel drought-resistant molecular marker is CCTTCACGCGT, and in drought-sensitive cotton germplasm, the nucleotide sequence of the Indel drought-resistant molecular marker is T.

[0038] The present invention utilizes detection primers to amplify the GhHD16 gene, the target fragment contains the Indel drought resistance molecular marker, and then the genotype of the molecular marker can be obtained by sequencing or observing the size of the electrophoresis band, thereby quickly and accurately distinguishing the drought resistance of the cotton to be tested.

[0039] Optionally, the detection primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3 or SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4 or SEQ ID NO.7.

[0040] Indel is an insertion-deletion mutation. Specific amplification primers are designed using Indel that is closely linked to the target trait for PCR amplification, and the drought resistance phenotype of cotton can be determined based on the different states of the PCR product. The present invention designs the sequence of the Indel resistance molecular marker at the end of the upstream primer. When the haplotype "CCTTCACGCGT" is missing, the binding ability of the upstream primer to the target sequence will be greatly weakened, thereby causing a significant reduction in the amplification efficiency, and then the presence or absence of the PCR amplification product can be used to efficiently distinguish the cotton genotype to be tested, and determine the resistance of cotton germplasm to drought stress. The result presentation method is simple and intuitive, which is conducive to improving the efficiency of molecular marker-assisted breeding, reducing the breeding workload and improving the efficiency of cotton germplasm innovation.

[0041] Optionally, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.4. In this case, the target sequence amplification length is 578bp; when a 578bp band pattern is specifically amplified, the cotton germplasm to be tested is judged to be drought-resistant cotton germplasm; when the band cannot be specifically amplified or the amplified band pattern does not contain 578bp, the cotton germplasm to be tested is judged to be drought-sensitive cotton germplasm.

[0042] Optionally, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7, and the target sequence amplification length is 387 bp. When a 387 bp band pattern is specifically amplified, the cotton germplasm to be tested is judged to be drought-resistant cotton germplasm, and when a band cannot be specifically amplified or the amplified band pattern does not contain 387 bp, the cotton germplasm to be tested is judged to be drought-sensitive cotton germplasm.

[0043] Yet another embodiment of the present invention provides a kit, which includes the detection primers as described above.

[0044] The advantages of the kit over the prior art are the same as the advantages of the detection primers over the prior art as described above, and will not be repeated here.

[0045] Optionally, the kit further comprises a PCR amplification reagent. The present invention has no particular limitation on the source of the PCR amplification reagent, and any conventional commercial product in the art may be used.

[0046] In a typical embodiment, the PCR amplification reagents include Taq DNA polymerase, dNTPs and a buffer reagent.

[0047] The present invention has no special limitation on the total amount of PCR amplification reagents and primers in the kit, and can be set according to the conventional requirements of the kit. Generally speaking, the concentration of the upstream primer and the downstream primer in the kit is preferably 10-20mM, more preferably 10mM, which is usually the mother solution concentration. The buffer reagent is preferably 10×Buffer.

[0048] Another embodiment of the present invention provides the use of the detection primers or kit for detecting Indel drought resistance molecular markers as described above in the identification of drought resistance of upland cotton.

[0049] The application of the detection primers or kit for detecting Indel drought resistance molecular markers in the identification of drought resistance of upland cotton has the same advantages as the detection primers described above over the prior art, and the present invention will not repeat them.

[0050] Based on the same inventive concept as above, another embodiment of the present invention provides a method for identifying drought resistance of upland cotton, comprising the following steps:

[0051] Using detection primers to perform PCR amplification on the genomic DNA of the upland cotton to be tested, to obtain a PCR amplification product, and detecting whether the PCR amplification product contains an Indel drought-resistant molecular marker, wherein the Indel drought-resistant molecular marker is located at the 7606th base of the sequence shown in SEQ ID NO.1; when a target band containing the Indel drought-resistant molecular marker can be specifically amplified, the upland cotton to be tested is a drought-resistant cotton germplasm, and when the target band containing the Indel drought-resistant molecular marker cannot be specifically amplified, the upland cotton to be tested is a drought-sensitive cotton germplasm;

[0052] Wherein, the detection primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.3 or 6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4 or 7.

[0053] The present invention only requires two steps, PCR amplification and gel electrophoresis band type detection, to achieve efficient differentiation of drought-resistant cotton germplasm and drought-sensitive cotton germplasm at the genotype level, and has the advantages of low cost, high throughput, strong specificity, etc.

[0054] Optionally, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.4; when the target band of 578bp type can be specifically amplified, the upland cotton to be tested is drought-resistant cotton germplasm; when the target band cannot be specifically amplified or the target band without 578bp band type is amplified, the upland cotton to be tested is drought-sensitive cotton germplasm.

[0055] Optionally, the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.7; when the target band of 387bp type can be specifically amplified, the upland cotton to be tested is drought-resistant cotton germplasm; when the target band cannot be specifically amplified or the target band without 387bp band type is amplified, the upland cotton to be tested is drought-sensitive cotton germplasm.

[0056] The present invention does not specifically limit the method for extracting genomic DNA from the cotton germplasm to be tested, and any commonly used genomic DNA extraction method or genomic DNA extraction kit in the art may be used, such as the CTAB extraction method used in the embodiment of the present invention.

[0057] Optionally, the PCR amplification reaction system is 20 μL, including: 2.0 μL of 10× buffer, 0.4 μL of dNTP mix, 0.2 μL of Taq DNA polymerase, 1 μL of genomic DNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer and 16 μL of sterile water; wherein, in the reaction system, the concentrations of the upstream primer and the downstream primer are 1-2 mM, and the concentration of the genomic DNA is 3.75-5 ng / μL.

[0058] Optionally, the reaction procedure of the PCR amplification includes: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 52-56°C for 30 s, extension at 70-72°C for 30 s, and 30 cycles; extension at 72°C for 5 min.

[0059] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or usually under the conditions recommended by the manufacturer.

[0060] Germplasm resources: The 517 upland cotton (Gossypium hirsutum, Gh) germplasm resources used in the following examples were selected from natural populations, and the original source was introduced from abroad. Table 1 shows the information of the upland cotton germplasm resources used in the present invention. The relevant research on 517 upland cotton natural population germplasm resources has been published in the literature [1] "Li B, Tian Q, Wang X, Han B, Liu L, Kong X, Si A, Wang J, Lin Z, Zhang X, Yu Y, Yang X. Phenotypic plasticity and genetic variation of cotton yield and its related traits underwater-limited conditions. Crop J, 2020, 8 (6): 966-976" and the literature [2] "Li Baoqi, Analyzing the genetic basis of cotton response to drought based on field phenotypes and phenotypic platform image indicators, 2020".

[0061] Table 1 Information on 517 upland cotton germplasm resources used in this invention

[0062]

[0063] In addition, the 325 chromosome segment substitution lines (CSSLs) used in the following examples are a series of near-isogenic lines covering the plant genome established by combining backcrossing of the F1 generation with the recurrent parent for multiple generations and molecular marker-assisted selection. The use of CSSLs with relatively homozygous genetic backgrounds can improve the accuracy of quantitative trait loci (QTL) positioning. By hybridizing CSSLs with the same genetic background, multiple excellent genes on different segments can be quickly aggregated to cultivate new varieties with more excellent traits. The CSSL preparation process is briefly described as follows: In 2005, a BC1 backcross population (Emian22×Sea Island Cotton 3-79)×Emian22 (Emian 22) was established in Wuhan City. In the following years, BC1 was systematically backcrossed using the parent Emian22. In 2007, the BC4 generation was obtained. In 2009, a high-density genetic linkage map was updated and published in 2011; based on the updated genetic map, a total of 515 SSR markers were selected, with an average interval of 10 cM between adjacent markers. During molecular marker-assisted selection, only plants containing the target fragments were retained (no non-target fragments); the donor fragments covered the entire cotton genome as much as possible. When a plant contained less than 3 donor fragments of G. barbadense 3-79, self-pollination produced homozygous lines. Finally, a total of 325 CSSLs were obtained.Related research on the germplasm resources of 325 chromosome segment substitution line populations has been published in the literature [3] "Zhu D, Li X, Wang Z, You C, Nie X, Sun J, Zhang X, Zhang D, Lin Z. Genetic dissection of anallotetraploid interspecific CSSLs guides interspecific genetics and breeding in cotton. BMC Genomics. 2020 Jun 26; 21(1): 431", literature [4] "Han B, Wang F, Liu Z, Chen L, Yue D, Sun W, Lin Z, Zhang X, Zhou X, Yang X. Transcriptome and metabolome profiling of interspecific CSSLs reveals general and specific mechanisms of drought resistance in cotton. Theor Appl Genet. 2022 Oct; 135(10): 3375-3391" and literature [5] "Han B, Zhang W, Wang F, Yue P, Liu Z, Yue D, Zhang B, Ma Y, Lin Z, Yu Y, WangY, Zhang X, Yang

[0064] The public may obtain the above-mentioned cotton-related germplasm resource materials from the applicant for repeating the experiments of the present invention, but may not use them for any other purpose.

[0065] Germplasm resource phenotype: The Membership Function Value of Drought-resistance (MFVD) was used to evaluate the comprehensive drought resistance of the above cotton germplasm resources. The calculation formula is as follows:

[0066]

[0067] Where, DRC ij represents the drought resistance coefficient of trait (j) to genotype (i); DRC jmax and DRC jmin Respectively represent the maximum and minimum values ​​of the drought resistance coefficient of all cotton materials (j); n represents the number of traits. The DRC value is the ratio of the phenotypic value of drought treatment to the phenotypic value of the control group. There are 16 traits in total, and each trait corresponds to a respective DRC value. Among them, the population average values ​​of lint percentage (LP), lint index (LW), seed cotton yield per hectare (YPH), micronaire value (MV), fruit branch number (FSBN), and empty fruit branch number (EFSBN) increased significantly under water restriction conditions (p<0.001), and the population average values ​​of growth period (GP), seed index (SW), fiber length (FL), fiber strength (FS), fiber elongation (FE), plant height (PH), fruit branch first node height (FFSH), fruit branch first node number (FFSBN), effective boll number per plant (EBN), and peripheral boll number (PBN) decreased significantly under water restriction conditions (p<0.001). Related research was also published in the above article.

[0068] Reference genome: The upland cotton TM-1 genome "TM-1_HAU-AD1_v1.0 (version Ghirsutum_genome_HAU_v1.0) is used as the reference genome, which can be openly obtained from the CottonFGD database, the access link is: http: / / cotton.hzau.edu.cn / EN / Download.htm)".

[0069] 1. Association analysis between natural variation of GhHD16 locus and drought resistance phenotype of cotton

[0070] Based on previous studies, a natural variation map of upland cotton was constructed using the publicly published resequencing data of 517 cotton germplasm resources (the original resequencing data were released in the SRA database of NCBI, with the project number PRJNA556955) and the resequencing data of 325 cotton germplasm resources (the original resequencing data were released in the SRA database of NCBI, with the project numbers PRJNA433615 and PRJNA543759). The drought resistance phenotypes of various germplasm resources were combined, and the drought resistance membership function value was used to evaluate the comprehensive drought resistance performance. The drought quantitative trait locus (QTL) segment associated with the drought resistance membership function value was identified, and the genes on the segment were further retrieved and functionally annotated. The candidate gene GhHD16 was screened, and it was found that 5 variations of the GhHD16 gene were significantly correlated with the size of the drought resistance membership function value.

[0071] The GhHD16 gene is a casein kinase encoding gene that may play a role through phosphorylation. The virus-induced gene silencing (VIGS) technique was used to silence the expression of the HD16 gene in upland cotton, and it was found that the conductivity of upland cotton leaves was reduced and the drought resistance of the plants was enhanced; this gene was confirmed to be a key gene for drought resistance and negatively regulates drought resistance.

[0072] The specific analysis steps of this embodiment are as follows:

[0073] (1) The variation information between 118158350 bp and 118167986 bp on chromosome A11 was extracted from the vcf files of genotypes of 325 and 517 natural populations of cotton germplasm resequencing. The drought resistance membership function value was used as the phenotypic value to perform genome-wide association analysis of candidate genes. Manhattan plots and linkage disequilibrium block (LD Block) plots were drawn for the results of the association analysis.

[0074] like Figure 1 As shown in the figure, from top to bottom are the Manhattan plot and LD block plot between variant sites at different physical locations and drought resistance phenotypes; in the Manhattan plot, the horizontal axis is the physical position of the variant site on the reference genome, and the vertical axis is -log (pvalue); in the LD block plot, the upper bar part shows the relative physical position of the variant site in the reference genome, and the red square below represents the LD value of different variant sites. The darker the square, the higher the LD value. Usually, a group of highly linked gene variants form a linkage disequilibrium block, and the variants in these blocks are usually inherited together. The results show that the variant sites in this region are highly linked.

[0075] Based on the association analysis, the candidate gene GhHD16 and five variants in the GhHD16 locus that were significantly associated with the phenotypic values ​​were obtained (see Tables 2 and Figure 2 ), of which 1 SNP variation was in the upstream regulatory region, 2 SNP variations were located in the gene introns, 1 SNP variation was in the gene exon, and 1 Indel variation was located in the downstream regulatory region.

[0076] Table 2 Five variants at the GhHD16 locus significantly associated with drought resistance phenotype in upland cotton

[0077]

[0078] Note: The meanings of the categories in the table are as follows: Type: variant type; Pos: physical position in the genome; Ref: reference genotype; Alt: variant genotype; Dist to ATG: physical distance from the start codon, negative values ​​indicate the regulatory region upstream of the start codon.

[0079] (2) The cotton resources were grouped according to different haplotypes. For example, the Indel mutation located at position 118159518 of chromosome A11 of the reference genome had two haplotypes, T and CCTTCACGCGT. According to the two haplotype groups mentioned above, the drought resistance membership function values ​​between groups were statistically used as phenotypic values ​​and a group t-test was performed. The p-value indicated the correlation between the mutation and the phenotype after the t-test, with a significance threshold of less than 0.05 and an extremely significant threshold of less than 0.01.

[0080] (3) Since the regulatory region plays an important role in gene expression changes, linkage disequilibrium analysis also shows that the Indel mutation in the downstream regulatory region of the candidate gene GhHD16 (located at position 118159518 of chromosome A11 of the reference genome, with a CCTTCACGCGT>T deletion compared to the reference genome) is significantly correlated with the drought resistance phenotype (p=0.00151). Since other mutations are SNPs, it is difficult to develop them into simple PCR markers for application. Therefore, the present invention selects the Indel mutation CCTTCACGCGT>T as the basis for the development of functional molecular markers.

[0081] Figure 3 The phenotypic data statistics of 325 cotton populations grouped according to different haplotypes of the Indel mutation at position 118159518 of chromosome A11 are shown, wherein the abscissa represents the haplotype and the ordinate represents the drought resistance membership function value. It can be seen from the figure that the different haplotypes of the Indel mutation are highly correlated with the comprehensive drought resistance of cotton, and the drought resistance membership function values ​​corresponding to different haplotypes are extremely different. Carrying the "CCTTCACGCGT" haplotype allele mutation will significantly improve the drought resistance of cotton and enhance its tolerance to drought environments.

[0082] Therefore, this embodiment develops functional molecular markers for the Indel variation in the downstream regulatory region of the GhHD16 gene, which is located at 118159518bp (based on the position of haplotype "T") on chromosome A11 of the upland cotton TM-1 reference genome "TM-1_HAU-AD1_v1.0", and has a genotype variation of CCTTCACGCGT>T compared to the reference genome. Among them, the genotype of drought-resistant cotton germplasm is CCTTCACGCGT, and the genotype of drought-sensitive cotton germplasm is T, that is, the drought-resistant cotton germplasm has an insertion of the "CCTTCACGCG" sequence at the Indel variation site compared to the drought-sensitive cotton germplasm. Since the proportion of heterozygous genotypes in the population is very low, this genotype was not included in the marker development in the analysis, and Figure 3 This result is not shown in , only the homozygous "CCTTCACGCGT" genotype and the homozygous "T" genotype are shown.

[0083] Since the GhHD16 gene is on the negative strand of the reference genome, the base sequence at the 5'-3' end of the upland cotton GhHD16 locus after reverse complementation is exemplarily displayed, as shown in SEQ ID NO.1, the haplotype "T" is located at the 7606th base (shown in bold shading), and the nucleotide sequence of the haplotype "CCTTCACGCGT" is obtained by replacing the 7606th base "T" with "CCTTCACGCGT".

[0084] Table 3 Indel molecular marker information of GhHD16 locus in upland cotton

[0085]

[0086]

[0087]

[0088] 2. Development of molecular marker detection primers based on Indel mutations in the downstream regulatory region of the GhHD16 gene in upland cotton

[0089] 2.1 Molecular marker authenticity verification

[0090] According to the material information and corresponding genotype information in the variation map, molecular marker amplification was performed on one extreme drought-resistant material, among which Yumian 1 (Yumian 1) is a typical drought-resistant germplasm with a genotype of haplotype "CCTTCACGCGT", and Xuzhou 514 (Xuzhou 514) is a drought-sensitive germplasm with a genotype of haplotype "T". The main steps are as follows:

[0091] Primer design: According to the GhHD16 locus sequence and molecular marker position in SEQ ID NO.1, PCR primers were designed, and their nucleotide sequences (5'-3') were as follows:

[0092] Upstream primer-1: CAAATTGCATTCTACCCCTC (see SEQ ID NO. 2);

[0093] Downstream primer-1: TTGGAGTGTGATTTTTGGAGA (see SEQ ID NO. 4).

[0094] Genomic DNA extraction: The genomic DNA of Yumian 1 and Xuzhou 514 materials was extracted by CTAB method. Specifically, 100 mg of fresh cotton leaves were placed in a 2 mL centrifuge tube, clean steel beads and 200 μL of extraction buffer were added, and the samples were ground on a sample grinder (Shanghai Jingxin #Tissuelyser-192) for 60 s at a frequency of 60 Hz; after grinding, 800 μL of CTAB lysis buffer was added, and the samples were lysed in a 65 ° C water bath for 30 min, and 800 μL of chloroform was added to the lysed samples, and the samples were turned over and mixed for 5 min to remove impurities such as pigments. After centrifugation at 12000 rpm for 10 min, the supernatant was transferred and mixed with an equal volume of -20 ° C pre-cooled isopropanol, placed at -20 ° C for precipitation for 2 h, centrifuged at 12000 rpm for 1 min, and the supernatant was discarded. The precipitate was rinsed with 1 mL of 75% ethanol, rinsed twice, each time for 10 min, centrifuged and the supernatant was discarded, the precipitate was naturally dried at room temperature, and DNA was dissolved with ddH2O. The extraction buffer composition is: 0.35M glucose, 0.1M Tris-HCl, 5mmol / LNa2EDTA, 2% (W / V) PVP K-30 and 0.1% (W / V) DIECA, pH 7.5, 0.2% β-mercaptoethanol is added before use. The CTAB lysis buffer composition is: 0.1MTris-HCl, 1.4M NaCl, 0.02MNa2EDTA, 2% CTAB, 2% (W / V) PVP K-30 and 0.1% (W / V) DIECA, pH 8.0.

[0095] PCR amplification: Take 75-100 ng of genomic DNA as a template for PCR amplification, configure the PCR amplification system according to the formula in Table 4, and perform PCR amplification according to the program in Table 5.

[0096] Table 4 PCR amplification system

[0097]

[0098] Table 5 PCR amplification program

[0099]

[0100] Result detection: The above PCR amplification products were sent to the company for Sanger sequencing to confirm the authenticity of the Indel molecular marker in the sequence. The results are as follows Figure 4 As shown, from top to bottom, the genotype information and sequencing peak diagram of Yumian 1 and Xuzhou 514 at 118159518bp are respectively represented.

[0101] The sequencing peaks were compared and confirmed that the genotype of Yumian 1 at the physical position of 118159518bp was "CCTTCACGCGT" (drought-resistant genotype); the genotype of Xuzhou 514 at the physical position of 118159518bp was "T" (drought-sensitive genotype), confirming the existence of Indel variation, which can be used as a drought-resistance molecular marker to distinguish drought-resistant and drought-sensitive cotton germplasm.

[0102] 2.2 PCR detection primer sequence design

[0103] After confirming the authenticity of the marker, the marker primer sequence is designed. The following primers (5'-3') are designed. The upstream primer contains the Indel mutation (underlined) and the upstream of the mutation site. Therefore, the presence or absence of the PCR amplification band can be used to conveniently determine whether the Indel molecular marker is contained. Specifically, when a PCR product band of 578bp band type can be specifically amplified, the cotton germplasm to be tested is drought-resistant cotton germplasm; when the band cannot be specifically amplified or the amplified band type does not contain the 578bp band type, the cotton germplasm to be tested is drought-sensitive cotton germplasm.

[0104] Upstream Primer-2: GC CCTTCACGCGT (see SEQ ID NO.3);

[0105] Downstream primer-1: TTGGAGTGTGATTTTTGGAGA (see SEQ ID NO. 4);

[0106] Four samples of each of the two genotype materials were selected for molecular marker amplification, among which the drought-resistant materials were Lumianyan17, Ningmian7, Yukang1, and Xinlu201; the drought-sensitive materials (drought-sensitive type) were Jimian20, Ejing1, Heishanmian1, and Xinluzao19. The PCR amplification system was the same as in Table 4, and the PCR amplification procedure was the same as in Table 5. The results are shown in Figure 5 , wherein the upper figure shows the sequencing results of the PCR product amplified using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.4, and the lower figure shows the gel electrophoresis image of the PCR product amplified using the primer pair shown in SEQ ID NO.3 and SEQ ID NO.4.

[0107] As can be seen from the figure, the sequencing results amplified using upstream primer-1 and downstream primer-1 are consistent with the banding results amplified using upstream primer-2 and downstream primer-1, and the genotype can be accurately determined based on the presence or absence of the amplified product, thereby effectively distinguishing drought-sensitive and drought-resistant materials. The sequence (5'-3') corresponding to the 578bp banding product amplified by the PCR primer pair composed of upstream primer-2 and downstream primers in this embodiment is as follows:

[0108] GC CCTTCACGCGT (See SEQ ID NO.5), the underlined part is Indel variation.

[0109] 3. Verification of the reliability and universality of molecular markers by chromosome segment substitution line population

[0110] In order to further verify the reliability and universality of molecular markers, the following primers were designed. The upstream primers respectively contained the Indel mutation (underlined) and the upstream of the mutation site. The difference between the upstream primer and the primer shown in SEQ ID NO.3-4 was the length of the upstream primer and the position of the downstream primer. The amplification product size was 387 bp. The primer sequences of this embodiment are as follows:

[0111] Upstream Primer-3: ATTTTAGC CCTTCACGCGT (see SEQ ID NO.6);

[0112] Downstream primer-2: TTTTGATAAACTTTTGTAGTGCTGA (see SEQ ID NO. 7);

[0113] 24 drought-resistant and drought-sensitive materials were selected, DNA was extracted, and amplification was performed on each material at an annealing temperature of 56°C according to the PCR amplification system in Table 4 and the PCR amplification program in Table 5. The gel electrophoresis of the amplified product is shown in Figure 6 Among them, Figure a is the drought-resistant cotton germplasm material, and Figure b is the drought-sensitive cotton germplasm material. The asterisks in the figures indicate materials with unclear or non-specific amplification.

[0114] The results of PCR in chromosome substitution lines showed that 2 materials could amplify bands in drought-sensitive cotton germplasm, and 22 materials did not amplify obvious specific bands; 4 materials did not amplify obvious specific bands in drought-resistant germplasm, and 20 materials amplified target bands. The chi-square test showed that the amplification results between drought-resistant materials and drought-sensitive materials were significantly different, with a p value of 1.85E-07, indicating that the Indel variant genotype in the chromosome substitution line population was significantly correlated with the drought-resistant and drought-sensitive phenotypic traits of cotton.

[0115] 4. Verify the reliability and universality of molecular markers at the natural population level

[0116] The present invention is based on the chromosome replacement line population to obtain molecular markers, and this example further verifies its applicability in natural populations. The primer pair shown in SEQ ID NO.3-4 was used to amplify the molecular marker sequence, 30 drought-resistant materials and 30 drought-sensitive materials were selected, DNA was extracted, and PCR amplification was performed on the above materials at an annealing temperature of 52°C according to the PCR amplification system in Table 4 and the PCR amplification program in Table 5. The gel electrophoresis of the amplified product is shown in Figure 7 Among them, Figure a is the drought-resistant cotton germplasm material, and Figure b is the drought-sensitive cotton germplasm material. In the figure, the asterisk indicates the material with unclear or non-specific amplification.

[0117] The results of PCR in natural populations showed that 4 materials could amplify bands in drought-sensitive germplasm, and 26 materials did not amplify obvious specific bands; 3 materials did not amplify obvious specific bands in drought-resistant germplasm, and 27 materials amplified target bands. The chi-square test showed that the amplification results between drought-resistant materials and drought-sensitive materials were significantly different, with a p value of 2.82E-09, indicating that the Indel variant genotype in natural populations was significantly correlated with the drought-resistant and drought-sensitive phenotypic traits of cotton.

[0118] In summary, the Indel variation provided by the present invention and the PCR detection primers developed based on the Indel variation can be used for the identification of drought resistance of cotton. The molecular marker genotype distinguishes the phenotypic traits of the population with high accuracy, and the genotype and the phenotype have high consistency. When the Indel variation site in the cotton material to be tested is detected to be the haplotype "T", it is drought-sensitive germplasm, and when the Indel variation site in the cotton material to be tested is detected to be the haplotype "CCTTCACGCGT", it is drought-resistant germplasm; thereby, the judgment of the phenotype is converted into the identification of the genotype, and the drought-resistant germplasm can be effectively identified or screened from the genotype level without being affected by the environment and the outside world.

[0119] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A detection primer for detecting Indel mutations related to cotton drought resistance, characterized in that: The Indel mutation is located at the 7606th base of the downstream regulatory region of the GhHD16 gene, and the nucleotide sequence of the downstream regulatory region of the GhHD16 gene is shown in SEQ ID NO.1; in drought-resistant cotton germplasm, the nucleotide sequence of the Indel mutation is CCTTCACGCGT, and in drought-sensitive cotton germplasm, the nucleotide sequence of the Indel mutation is T; Wherein, the detection primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3 or SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.4 or SEQ ID NO.

7.

2. The detection primer for detecting Indel mutations related to cotton drought resistance according to claim 1, characterized in that: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; Alternatively, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

7.

3. A kit, characterized in that: The kit comprises the detection primers for detecting Indel mutations associated with cotton drought resistance as described in any one of claims 1 to 2.

4. The kit according to claim 3, characterized in that The kit also includes Taq DNA polymerase, dNTPs and a buffer reagent.

5. Use of the detection primers for detecting Indel mutations associated with cotton drought resistance as described in any one of claims 1 to 2, or the kit as described in any one of claims 3 to 4 in identifying drought resistance of upland cotton.

6. A method for identifying drought resistance of cotton, characterized in that: The following steps are involved: Using detection primers to perform PCR amplification on the genomic DNA of the upland cotton to be tested, to obtain a PCR amplification product, and detecting whether the PCR amplification product contains an Indel variation, wherein the Indel variation is located at the 7606th base of the sequence shown in SEQ ID NO.1; when a target band containing the Indel variation can be specifically amplified, the upland cotton to be tested is a drought-resistant cotton germplasm, and when a target band containing the Indel variation cannot be specifically amplified, the upland cotton to be tested is a drought-sensitive cotton germplasm; Wherein, the detection primer includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.3 or SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.4 or SEQ ID NO.

7.

7. The method for identifying drought resistance of cotton according to claim 6, characterized in that: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.4; when the target band of 578bp type can be specifically amplified, the upland cotton to be tested is drought-resistant cotton germplasm, and when the target band cannot be specifically amplified or the target band without 578bp band type is amplified, the upland cotton to be tested is drought-sensitive cotton germplasm.

8. The method for identifying drought resistance of cotton according to claim 6, characterized in that: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7; when the target band of 387bp band type can be specifically amplified, the upland cotton to be tested is drought-resistant cotton germplasm, and when the target band cannot be specifically amplified or the target band without 387bp band type is amplified, the upland cotton to be tested is drought-sensitive cotton germplasm.

9. The method for identifying drought resistance of cotton according to claim 6, characterized in that: The PCR amplification reaction system includes: 2.0 μL of 10× buffer, 0.4 μL of dNTP mix, 0.2 μL of Taq DNA polymerase, 1 μL of genomic DNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer and 16 μL of sterile water; in the reaction system, the concentration of the upstream primer and the downstream primer is 1-2 mM, and the concentration of the genomic DNA is 3.75-5 ng / μL; The reaction procedure of the PCR amplification includes: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 52-56°C for 30 seconds, extension at 70-72°C for 30 seconds, 30 cycles; and extension at 72°C for 5 minutes.

Images