Application of the maize BRI1a gene in regulating plant cold tolerance
By knocking out the BRI1a gene in maize using CRISPR/Cas9 technology, cold-resistant mutant lines were screened out, solving the problem of maize growth inhibition in low-temperature environments, enhancing the stability and applicability of cold-resistant genes, and providing new gene resources.
Patent Information
- Application Number
- CN202410879998.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-02
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2044-07-02
AI Technical Summary
In existing technologies, maize is easily affected by low temperatures when grown in high-latitude and high-altitude areas, resulting in uneven emergence and hindered plant growth and development. Furthermore, existing genes that improve maize's cold tolerance have issues of instability and limited application.
By knocking out the maize BRI1a gene using CRISPR/Cas9 technology, mutant lines with cold-resistant phenotypes were screened out. Using the maize BRI1a gene sequence and its encoded protein, transgenic plants were constructed to improve their cold resistance.
It significantly improved the cold resistance of maize, provided new genetic resources, laid a theoretical foundation for breeding new cold-resistant plant varieties, and enhanced the survival rate and growth capacity of maize in low-temperature environments.
Smart Images

Figure CN118853735B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to the application of the maize BRI1a gene in regulating plant cold tolerance. Background Technology
[0002] Due to scarce land resources and increasing food demand, people are placing higher and higher demands on crop yield and quality. Maize (Zea mays L.) is one of my country's major food crops, originating in tropical low-latitude regions. Under the influence of species migration and artificial domestication, maize cultivation has expanded to temperate regions at high latitudes and altitudes. Maize is a relatively temperature-sensitive crop. In these areas, maize is easily affected by low temperatures in the early stages of planting, especially during germination and seedling stages, resulting in uneven emergence, stunted plant growth, and other problems that affect crop survival and yield. Therefore, studying the mechanisms of maize's tolerance to low-temperature stress is of great significance for maize production.
[0003] With the development of molecular biology techniques, genetic engineering methods such as transgenics can be used to introduce exogenous genes that enhance stress resistance into plants or regulate the expression of endogenous genes, thereby improving plant stress resistance. Currently, most cloned genes that improve cold tolerance in maize are positively modulating factors, requiring the construction of transgenic overexpression materials to enhance plant cold tolerance, which presents problems such as instability and limited application. Therefore, identifying negatively modulating factors for maize cold tolerance and obtaining cold-tolerant maize plants through gene knockout has significant application value. Summary of the Invention
[0004] To address the shortcomings of existing technologies, the present invention aims to provide an application of the maize BRI1a gene in regulating plant cold tolerance. This invention significantly improves the cold tolerance of plants by knocking out the aforementioned maize BRI1a gene, providing a new gene resource for breeding new cold-tolerant plant varieties.
[0005] To discover genes related to cold resistance in maize, this invention screened a maize library of CRISPR / Cas9 mutants and observed their phenotypes at low temperatures. It was found that several lines with the BRI1a gene knocked out all exhibited obvious cold-resistant phenotypes.
[0006] Specifically, this invention screened a maize library of CRISPR / Cas9 mutants, using the relative leaf injury area as an indicator for preliminary screening of low-temperature phenotypes. Mutant lines showing the initial phenotype were then rescreened to determine their low-temperature-related phenotypes. By consulting gene knockout information tables, the gene number of the knocked-out gene in this line was found to be GRMZM2G048294. Further analysis using gene annotations on the MaizeGDB website identified it as maize kinase BRI1a. A unified comparison revealed that BRI1a is a leucine-rich receptor-like kinase, but its function at low temperatures has not been reported. This invention confirms that the BRI1a gene may be a key gene for cold tolerance in maize. Furthermore, by knocking out the BRI1a gene in maize, this invention obtained cold-resistant transgenic plants.
[0007] The maize BRI1a gene sequence involved in this invention is: i) the nucleotide sequence shown in SEQ ID NO.1; or ii) a nucleotide sequence of the nucleotide sequence shown in SEQ ID NO.1 that has been substituted, deleted and / or added with one or more nucleotides and expresses a protein with the same function; or iii) a nucleotide sequence that is completely complementary to the nucleotide sequence shown in SEQ ID NO.1.
[0008] The maize BRI1a gene (cDNA) consists of 4255 bases, and its sequence is shown in SEQ ID NO.3. The reading frame of this gene consists of one exon. The amino acid sequence encoded by the maize BRI1a gene is shown in SEQ ID NO.2.
[0009] The corn BRI1a protein of this invention has any one of the following amino acid sequences:
[0010] 1) The amino acid sequence shown in SEQ ID NO.2;
[0011] 2) The amino acid sequence of a protein with the same function obtained by substituting, deleting or inserting one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.2.
[0012] It should be understood that those skilled in the art can, based on the amino acid sequence disclosed in this invention, substitute, delete, and / or add one or more amino acids to obtain the mutant sequence of the protein without affecting its activity.
[0013] The present invention provides the use of the maize BRI1a gene, or the protein encoded by the maize BRI1a gene, or the repressor of the maize BRI1a gene, or biological material containing the repressor of the maize BRI1a gene in any of the following aspects:
[0014] (1) Modify the cold tolerance of plants;
[0015] (2) Improve the survival rate of plants under low temperature conditions;
[0016] (3) Select and breed transgenic plants with improved cold tolerance;
[0017] (4) Improve cold-resistant plant germplasm resources.
[0018] Preferably, the goal is to improve the plant's cold tolerance.
[0019] The biological material is an expression cassette, vector, host cell, or recombinant bacteria.
[0020] The present invention also provides cloning vectors or various expression vectors containing the BRI1a gene sequence or fragments thereof for plant cold tolerance, host cells containing the vector, transformed plant cells containing the gene sequence or its repressor, and transgenic plants.
[0021] The present invention also provides a method for preparing transgenic plants, wherein the transgenic process includes knocking out the maize BRI1a gene, or using DNA homologous recombination technology, Cre / Loxp technology or Crispr / Gas9 technology to silence or reduce the expression level of the maize BRI1a gene, thereby obtaining transgenic maize lines with improved cold resistance.
[0022] The specific method for preparing the transgenic plant includes the following steps:
[0023] (1) Using primers as shown in SEQ ID NO.4, gRNA targets were designed and further linked to the pBUE411 vector to obtain the CRISPR / Cas9 recombinant vector pBUE4-bri1a;
[0024] (2) Transform the recombinant vector constructed in step (1) into Agrobacterium to construct recombinant Agrobacterium;
[0025] (3) Use the recombinant Agrobacterium obtained in step (2) to infect maize callus tissue and obtain cold-resistant maize seedlings.
[0026] Using the above method, the present invention obtained homozygous stable knockout lines of the maize BRI1a gene, and obtained homozygous knockout maize lines with CRISPR / Cas9 background removed through self-pollination.
[0027] The plant described in this invention is a monocotyledonous or dicotyledonous plant, preferably a grass such as rice, wheat, soybean, sorghum, millet, cotton, barley or corn, and more preferably corn.
[0028] The present invention also provides a method for altering the low-temperature resistance of plants, which controls the expression of the maize BRI1a gene in plants through transgenic, hybrid, backcross, self-pollination or asexual reproduction methods.
[0029] To achieve the above objectives, the specific technical solution adopted by the present invention is as follows:
[0030] The use of the maize BRI1a gene, or the protein encoded by the maize BRI1a gene, or a repressor of the maize BRI1a gene, or biological material containing a repressor of the maize BRI1a gene, in any of the following aspects:
[0031] (1) Modify the cold resistance of corn;
[0032] (2) Improve the survival rate of corn under low temperature conditions;
[0033] (3) Selecting and breeding transgenic corn with improved cold resistance;
[0034] (4) Improve cold-resistant maize germplasm resources.
[0035] Based on the above scheme, changes to the cold resistance of corn include improving its cold resistance.
[0036] Based on the above scheme, the amino acid sequence of the protein encoded by the maize BRI1a gene is shown in SEQ ID NO.2.
[0037] Based on the above scheme, the nucleotide sequence of the maize BRI1a gene cDNA is as follows:
[0038] (1) The nucleotide sequence shown in SEQ ID NO.1;
[0039] Or (2) a nucleotide sequence that is completely complementary to the nucleotide sequence shown in SEQ ID NO.1.
[0040] Based on the above scheme, the biological material is an expression cassette, a vector (e.g., pBUE411 vector), a host cell, or a recombinant bacterium (e.g., Agrobacterium GV3101).
[0041] Based on the above scheme, the repressor of the maize BRI1a encoding gene includes gRNA or interfering RNA that can inhibit the expression of maize BRI1a protein; the target sequence of the gRNA is shown in SEQ ID NO.4.
[0042] The primer pair for amplifying the maize BRI1a gene according to claim 1 is characterized in that the sequence of the primer pair is shown in SEQ ID NO.7-8.
[0043] A method for altering the low-temperature resistance of plants is characterized by controlling the expression of the BRI1a gene in maize through transgenic, hybrid, backcross, self-pollination, or asexual reproduction methods.
[0044] Based on the above scheme, the transgenic method includes knocking out the maize BRI1a gene, or using DNA homologous recombination technology, Cre / Loxp technology or Crispr / Gas9 technology to silence or reduce the expression level of the maize BRI1a gene, thereby obtaining transgenic maize lines.
[0045] Based on the above scheme, the transgenic process involves introducing a recombinant expression vector containing the maize BRI1a gene into maize using methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electrical conductivity, or Agrobacterium-mediated transformation to obtain transgenic maize lines.
[0046] The beneficial effects of the application of the maize BRI1a gene in regulating plant cold tolerance as described in this invention are as follows:
[0047] This invention, through the study of CRISPR / Cas9 mutant materials of the maize BRI1a gene, verified that the maize BRI1a gene is involved in the regulation of maize cold tolerance, and that knocking out the maize BRI1a gene increases maize's cold tolerance. This invention provides new gene resources for breeding new cold-tolerant plant varieties and lays a theoretical foundation for studying the mechanisms by which maize responds to low-temperature stress. Attached Figure Description
[0048] The present invention includes the following figures:
[0049] Figure 1 This is a schematic diagram of two types of BRI1a gene knockout in Example 2 of the present invention;
[0050] Figure 2 These are photos of the plant growth of the WT group and the maize BRI1a gene knockout lines after low-temperature treatment recovery in Example 2 of this invention.
[0051] Figure 3 This is a statistical chart showing the ion leakage rate of the WT group and the maize BRI1a gene knockout lines after low-temperature treatment and recovery in Example 2 of the present invention. Detailed Implementation
[0052] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0053] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 21), or as recommended by the manufacturer's instructions.
[0054] The main reagents used in the following examples were: various restriction endonucleases, Taq DNA polymerase, T4 ligase, Pyrobest Taq enzyme, and KOD were purchased from NEB, Toyobo, and other biotechnology companies; dNTPs were purchased from Genestar; plasmid miniprep kits and agarose gel extraction kits were purchased from Shanghai Jierui Biotechnology Co., Ltd.; agar powder, agarose, ampicillin (Amp), kanamycin (Kan), gentamicin sulfate (Gen), rifampin (Rif), and other antibiotics, as well as glucose, BSA, LBMedium, etc., were purchased from Sigma, Bio-Rad, and other companies; reagents used for real-time quantitative PCR were purchased from TaKaRa; and all other chemical reagents used in the examples were imported or domestically produced analytical grade reagents. Primers used in the examples were synthesized by Huada Biotechnology Co., Ltd., and related sequencing was performed.
[0055] Example 1: Construction and detection of BRI1a gene knockout vector
[0056] The BRI1a gene involved in this embodiment is derived from the maize inbred line LH244. Its sequence in the maize genome is shown in SEQ ID NO.1, consisting of 4256 nucleotides and without intron sequences; its cDNA sequence is shown in SEQ ID NO.3, and the amino acid sequence encoding the protein is shown in SEQ ID NO.2. This embodiment utilizes CRISPR / Cas9 technology to knock out the BRI1a gene in maize, constructing a homozygous knockout mutant of the BRI1a gene.
[0057] 1. Construction of the recombinant vector pBUE411
[0058] The gRNA sequence is as follows:
[0059] bri1a-gRNA: TTGATAGCCGGTCACATTC (SEQ ID NO.4)
[0060] The designed target was synthesized from single-stranded to double-stranded form using touch-down PCR, and this linker fragment was then ligated into the pBUE411 vector.
[0061] The primer sequences are as follows:
[0062] F:GGATTTGATAGCCGGTCACATTC(SEQ ID NO.5)
[0063] R:AAACGAATGTGACCGGCTATCAA(SEQ ID NO.6)
[0064] The obtained pBUE411 vector was digested with the restriction endonuclease BsaI, and then ligated using Solution I ligase to obtain recombinant plasmids. The recombinant plasmids were then sequenced. Plasmids showing the insertion of the target fragment between the BsaI restriction sites in the pBUE411 vector were named pBUE-gbri1a.
[0065] 2. Obtaining and Preliminary Identification of BRI1a Gene Knockout Maize
[0066] (1) The recombinant expression vector pBUE-gbri1a constructed in step 1 and the empty vector pBUE411 were introduced into Agrobacterium GV3101 competent cells via freeze-thaw method. The recombinant Agrobacterium pBUE-gbri1a was transformed into callus tissue of wild-type maize (LH244 ecotype) using the Agrobacterium inflorescence infection method (SJ Clough et al., Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsisthaliana. The Plant Journal, 1998, 16(6):735-743.), and bar resistance was used for screening.
[0067] (2) Identification of CRISPR / Cas9 knockout lines of BRI1a
[0068] The screened maize lines were identified, and the results showed that homozygous stable knockout lines could be obtained using the pBUE411 vector at generation T0. Then, through self-pollination in F2 generations, total DNA from CRISPR / Cas9 knockout plants (bri1a-1 and bri1a-2) was obtained. PCR was used to detect differences in the BRI1a gene DNA sequence in the materials. The PCR amplification method is as follows:
[0069] The primer sequences for amplifying the BRI1a gene are as follows:
[0070] BRI1aRT-F1:ATGGAATCTCCGGGGCTG (SEQ ID NO.7)
[0071] BRI1aRT-R1:GTCCTTTCCTCCTTGTCTTCTTTC(SEQ ID NO.8)
[0072] The PCR reaction system is shown in Table 1:
[0073] Table 1 PCR reaction system
[0074] reagents Dosage KOD enzyme 1μL KOD 10Xbuffer 5μL dNTPs (2.5mM) 5μL <![CDATA[MgSO4]]> 4μL Forward primer (10 μm) 1.5μL Reverse primer (10 μm) 1.5μL DNA template 1μL <![CDATA[ddH2O]]> Add to 50 μL
[0075] Each sample was prepared in triplicate, and the mixture was gently shaken to mix. The experiment was performed using a Bio-Rad PCR instrument. The PCR reaction program is shown in Table 2.
[0076] Table 2 PCR reaction procedures
[0077]
[0078]
[0079] The amplified product band size was detected by 1% agarose gel electrophoresis (voltage: 157V) and found to be approximately 500bp. The product was then sent to a sequencing company for sequencing.
[0080] A schematic diagram of the sequencing results of the BRI1a amplification products is shown below. Figure 1 As shown, the BRI1a gene exists in two different knockout forms:
[0081] The knockout form bri1a-1 is a deletion of 52 bp, consisting of nucleotides 2279-2330 in the sequence shown in SEQ ID NO.3, within the target site.
[0082] The knockout form bri1a-2 is a deletion of 2 bp in total, consisting of nucleotides 2294-2295 of the sequence shown in SEQ ID NO.3 within the target site;
[0083] Both knockout forms result in frameshift mutations, leading to the loss of biological function of the BRI1a gene.
[0084] Example 2: Detection of low-temperature resistance in plants with BRI1a gene knockout
[0085] To further investigate the regulatory role of BRI1a in cold tolerance of maize, the BRI1a gene in wild-type maize LH244 was knocked out using CRISPR / Cas9 technology. Two mutant lines were obtained: bri1a-1 and bri1a-2. See the diagram for the knockout illustration. Figure 1 Among them, the bri1a-1 strain has a 52bp deletion at positions 2279 to 2330 of the BRI1a gene exon, while the bri1a-2 strain has a 2bp deletion at positions 2294 to 2295 of the BRI1a gene exon.
[0086] First, seeds from the WT group (wild-type maize) and the mutant obtained in Example 2 were sown in small pots (10cm long, 10cm wide, and 10cm high) containing black soil, imported soil, and vermiculite (mass ratio 1:1:1). Twelve seeds were placed in each line, covered with 2cm of soil, and placed on a tray. Water was applied until the soil was completely moist, and the pots were placed in a 23°C incubation room with 16 hours of light and 8 hours of darkness. After 11 days of growth, the plants were treated at 4°C for 4 days until the second leaf withered and shriveled. They were then removed and placed in a 23°C incubation room for two days to recover before photographing and collecting samples for ion leakage rate analysis. Three seedlings from each mutant line (CR) and wild-type (WT) were taken for testing, and three biological replicates were performed.
[0087] The plant growth of the WT group and the BRI1a gene knockout lines after low-temperature treatment recovery is as follows: Figure 2 As shown (the left image is the control group without low-temperature treatment, and the right image is the experimental group after low-temperature treatment and recovery). The results showed that the wild-type WT leaves were severely wilted, dried out, and even unable to stand upright, while the mutant lines only had slight damage to the leaf tips and remained upright, showing a low-temperature resistant phenotype.
[0088] In this embodiment, the ion leakage rate was statistically analyzed by measuring the relative conductivity of the leaves, L = (S1-S0) / (S2-S0)*100%. After low-temperature treatment, an entire corn plant was placed in a 15ml centrifuge tube containing 10ml of distilled water. The tube was evacuated using a vacuum pump for 30 minutes, then placed on a shaker at room temperature for 1 hour. The initial conductivity value, S1, was then measured using a conductivity meter. The sample was then placed in a boiling water bath for 15 minutes, removed, and placed on a shaker for 2 hours. The conductivity was measured again and recorded as S2. S0 represents the conductivity of the blank control distilled water.
[0089] Ion leakage rate reflects cell membrane integrity; test results are as follows: Figure 3 As shown in Table 3, compared with the WT group, the ion leakage rates of the knockout lines bri1a-1 and bri1a-2 were reduced by 44.26% and 39.25% respectively (the average difference in ion leakage rates between wild-type WT plants and knockout lines in three trials), reaching a statistically significant difference (p<0.05). This indicates that the degree of cell damage was significantly higher in the WT group, and knocking out the maize BRI1a gene can enhance its cold tolerance. This further demonstrates that the BRI1a knockout lines (bri1a-1 and bri1a-2) possess a certain degree of cold tolerance.
[0090] Table 3. Ion leakage rate values (%) from three independent experiments.
[0091] WT bri1a-1 bri1a-2 63.7 35.4 40.5 61.9 32.6 38.1 64.2 37.8 36.7
[0092] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
[0093] The contents not described in detail in this specification are existing technologies known to those skilled in the art.
Claims
1. Application of the maize BRI1a gene in improving the cold tolerance of maize; characterized in that, Knocking out this gene improves the cold tolerance of maize; The nucleotide sequence of the cDNA of the maize BRI1a gene is shown in SEQ ID NO.3; the amino acid sequence of the protein encoded by the maize BRI1a gene is shown in SEQ ID NO.2.