Endophytic fungus of Helminthosporium spp. Strain SZN-1 from schisandra chinensis and its application

Abstract

The present invention discloses a bipolaris sorokiniana strain SZN‑1 and its application, wherein the strain SZN‑1 is preserved in the China Center for Type Culture Collection, and is classified and named as: Bipolaris sorokiniana SZN‑1, with a preservation number of: CCTCC NO: M2024468, and a preservation date of: March 11, 2024. The present invention separates and screens out a strain bipolaris sorokiniana strain SZN‑1 having a strong inhibitory effect on fusarium wilt from materials such as roots, stems, leaves, flowers, and fruits of fusarium wilt, and finds that it has a preventive and therapeutic effect on plant wilt. The present invention provides new possibilities for the green and effective prevention and control of fungal diseases such as fusarium wilt of fusarium wilt, and also lays a foundation for the further development and utilization of endophyte resources of fusarium wilt in biological pesticides, which has important practical significance for the sustainable development of the fusarium wilt industry.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural biological preparations, and particularly relates to an endophytic bacterium of schizonepeta tenuifolia strain SZN-1 and an application thereof. Background Art

[0002] Sauropus androgynus (L.) Merr. is a perennial tropical and subtropical evergreen shrub belonging to the genus Sauropus of the Euphorbiaceae family. Originally known as Sauropus, it is also known as Wuzhishan wild vegetables, Thai wolfberry, Vietnamese vegetables, Tianluxiang, etc. It is native to the tropical rainforests of Southeast Asia and is an important specialty medicinal vegetable in tropical and subtropical regions. It is planted on a large scale in my country. Sauropus androgynus has important medicinal and edible value. In terms of food, its tender stems are rich in vitamins, dietary fiber, Zn, Mn, polyphenols and other trace elements that are beneficial to the human body in addition to conventional nutrients such as protein and carbohydrates; in terms of medicinal use, its fruit, seeds, skin and flowers can be used as medicine, and have multiple activities such as clearing heat and detoxifying, promoting digestion, delaying aging, lowering blood pressure, reducing swelling and relieving pain. my country's Sauropus androgynus production areas are mainly concentrated in Hainan Province. In recent years, the Sauropus androgynus industry has developed rapidly and has become a relatively important specialty vegetable industry in Hainan Province. It is also one of the important poverty alleviation industries in the adjustment of agricultural industrial structure, and its development prospects are very broad. However, with the continuous expansion of the planting area of ​​​​tree cabbage, coupled with the lack of scientific management, the types of tree cabbage diseases in various production areas are increasing day by day, and the occurrence is relatively common, resulting in premature aging of the tree, quality decline, and even plant death, causing serious economic losses to the tree cabbage industry. Among them, tree cabbage wilt is a devastating disease in tree cabbage production. my country first discovered tree cabbage wilt in Nansheng Town, Wuzhishan City, Hainan Province. It has now spread to large areas of tree cabbage plantations in Qiongzhong, Baoting, Haikou, Sanya and other cities and counties in Hainan Province, causing tree cabbage plantations to reduce production or even lose their harvests. Large areas of affected plants have been cut down. Tree cabbage wilt is caused by Fusarium equiseti. There are no disease-resistant varieties and effective prevention and control methods so far, which seriously threatens the sustainable development of the tree cabbage industry in our province.

[0003] At present, domestic and foreign scholars have discovered many metabolites of plant endophytes with different structures and antibacterial activities, including terpenes, alkaloids, isocoumarins, peptides, etc. Strobel et al. isolated an endophytic fungus (Cryptosporiopsis ofquercina) from the stem of Tripterygium wilfordii, which can produce a peptide antibiotic (Cryptocandin), which can inhibit some plant pathogenic fungi such as Botrytis cinerea. A new amide alkaloid (Cryptocin) isolated from the same endophytic fungus has a strong inhibitory effect on Pyticularia oryzae and many other plant pathogenic fungi. A Gliocladium sp. isolated from Eucryphia cordifolia can produce some volatile fungicidal compounds, such as 1-butanol and 3-methyl-phenylethylalcohol, which can kill pathogenic fungi such as Pythium ultimum and Verticillum dahliae. The peptides produced by the endophytic fungus Trichoderma citrinoviride isolated from oak by Maddau et al. have a strong inhibitory effect on 7 oak pathogenic fungi. Zou Wenxin et al. isolated an endophytic fungus from Artemisia mongolica and isolated a new compound anthracnose acid from its liquid fermentation product, which has an inhibitory effect on wheat root rot fungus (Helminthosporiumsativum). Xu Dake et al. screened out a strain of Serratia marcescens from blueberry, which can produce chitinase and has an inhibition rate of 70.5% against bean rust (Uromyces appendiculatus), and 68.6% and 57.7% against two blueberry leaf spot pathogens, Pestalotiopsis sp. and Cylindroeladium colhounii, respectively. Jiang Mulan et al. isolated Bacillus subtilis BY-2 with biological control effect from rapeseed plant tissues, which produces cyclolipeptide antibiotics, subtilis surfactant and lipopeptide antibiotics. Finding and developing endophytic strains with antibacterial activity and secondary metabolites with pesticide activity not only reduces the pollution of chemical pesticides to the environment, but also ensures the quality of plant products. It is an important way to develop new pollution-free pesticides. Therefore, it is urgent to find new endophytes with good control effect on wilt. So far, the research on the tree weeds has mainly focused on its own chemical active ingredients, and there has been no systematic research report on the endophytes of the tree weeds. Summary of the invention

[0004] The purpose of the present invention is to overcome the disadvantages of the prior art and provide a strain SZN-1 of endophytic fungus of Helicoverpa serrata and its application.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] On one hand, the present invention provides a strain SZN-1 of Bipolaris sorokiniana endophyte, which is deposited in China Center for Type Culture Collection, classified and named as Bipolaris sorokiniana SZN-1, with a deposit number of CCTCC NO: M2024468 and a deposit date of March 11, 2024. The deposit address is Wuhan University, Wuhan, China.

[0007] Another aspect of the present invention provides the use of the endophytic fungus Helicoverpa serrata strain SZN-1 in preventing and treating plant wilt disease.

[0008] Furthermore, the plants are vegetables.

[0009] Furthermore, the vegetables are broccoli, melon, bitter melon, tomato, Chinese cabbage or Chinese cabbage.

[0010] Furthermore, the endophytic fungus of Brassica rapa strain SZN-1 has antibacterial activity against Sclerotinia sclerotiorum de Bary, the pathogen of cabbage sclerotinia, Botrytis cinerea, the pathogen of melon gray mold, and Fusarium oxysporum, the pathogen of tomato wilt.

[0011] The present invention also provides a biological microbial agent, comprising the above-mentioned endophytic fungus Helicoverpa serrata strain SZN-1 and an adjuvant acceptable in pesticides.

[0012] The auxiliary agent is selected from one or more of a surfactant, a stabilizer and a carrier.

[0013] As a preferred embodiment of the present invention, the surfactant is selected from one or more of Tween 20, Tween 80, rapeseed oil or lecithin; the stabilizer is selected from an antioxidant or a pH regulator; the antioxidant is preferably gum arabic, gelatin, etc.; the pH regulator is preferably calcium carbonate, phosphoric acid, etc.; the carrier is selected from various plant materials or minerals; the plant material is preferably one or more of rice husk powder, wheat bran, wood sawdust, ryegrass powder, wheat straw, corn straw; the mineral is preferably talcum powder, diatomaceous earth or kaolin.

[0014] Furthermore, the biological agent is in the form of an aerosol, an aqueous solution, a microemulsion, a powder, a microcapsule, a suspension or a granule, preferably in the form of a sprayable agent.

[0015] The invention has the following advantages: 133 strains of endophytic fungi, endophytic bacteria and endophytic actinomycetes are separated from the roots, stems, leaves, flowers, fruits and other materials of the Chinese cabbage, and the strain of the Chinese cabbage endophyte Helminthosporium sZN-1 with strong inhibitory effect on the Chinese cabbage wilt disease is screened out. It is found through experiments that the strain has a preventive effect on plant wilt disease, especially has an inhibitory effect on the pathogenic fungus Sclerotinia sclerotiorum de Bary of cabbage sclerotinia, the pathogenic fungus Botrytis cinerea of ​​melon gray mold and the pathogenic fungus Fusarium oxysporum of tomato wilt disease. The invention provides new possibilities for green and effective prevention and control of fungal diseases such as Chinese cabbage wilt disease, and also lays a foundation for the further development and utilization of the endophytic bacteria resources of Chinese cabbage in biological pesticides, and has important practical significance for the sustainable development of the Chinese cabbage industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 These are the field symptoms of Fusarium wilt disease of Chinese spinach and the morphological observation of the pathogen. A: Field symptoms of suspected diseased plants of Fusarium wilt disease of Chinese spinach; B: Morphological observation of pathogen colonies; C: Conidia.

[0017] Figure 2 This is a phylogenetic tree constructed using the NJ method based on the ITS and EF1α sequences of Fusarium equiseti.

[0018] Figure 3 These are morphological observation pictures of the endophyte SZN-1 in Sciaensis, where A: front view of the morphology of the endophyte SZN-1 in Sciaensis; B: back view of the morphology of the endophyte SZN-1 in Sciaensis; C: hyphae; D: spores.

[0019] Figure 4 The antibacterial effect of endophytic fungi on Fusarium wilt of radish, among which A: strain SZN-12; B: strain SZN-14; C: strain SZN-15; D: strain SZN-1; E: strain NSJ-19; F: CK Fusarium equisetum

[0020] Figure 5 This is the result of strain amplification electrophoresis, where M: DNA Marker DL2000; from top to bottom: 2000, 1000, 750, 500, 250, 100 bp; 1: sterile water; 2: sterile water; 3: strain SZN-1; 4: strain SZN-12; 5: strain SZN-14; 6: strain SZN-15; 7: strain SZN-19.

[0021] Figure 6 This is the evolutionary tree analysis diagram of the endophytic fungus SZN-1 of the tree sedge.

[0022] Figure 7 This is a diagram showing the antibacterial effect of the endophytic fungus SZN-1 on cabbage sclerotinia disease, where A: SZN-1 strain of Helminthosporium sclerotiorum; B: CK sclerotinia of cabbage.

[0023] Figure 8 This is a diagram showing the antibacterial effect of the endophytic fungus SZN-1 on melon black mold, where A: Helminthosporium sp. strain SZN-1; B: Botrytis cinerea CK.

[0024] Fig. 9 This is a diagram showing the antibacterial effect of the endophytic fungus SZN-1 on tomato Fusarium wilt, where A: Helminthosporium sp. strain SZN-1; B: Fusarium oxysporum CK. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with the accompanying drawings and examples, and the protection scope of the present invention is not limited to the following: Example 1: Isolation, identification and antibacterial activity determination of endophytic fungi in schizonepeta

[0026] 1. Materials and Methods

[0027] 1.1 Materials

[0028] In this experiment, healthy choy sum plants were collected from Chengmai County, Hainan Province, and brought back to the laboratory of the Vegetable Research Institute of Hainan Academy of Agricultural Sciences. The leaves, stems and other parts of the plants were separated and purified using tissue separation and purification methods to obtain endophytic fungi, which were identified as Bipolaris sorokiniana. The fungus was confirmed to be Bipolaris sorokiniana, an endophytic fungus.

[0029] Experimental strains:

[0030] The pathogen causing Fusarium wilt of the tree mustard is Fusarium equiseti, which was provided by China Center for Type Culture Collection with the accession number of CCTCC AF 2015029;

[0031] The pathogen of tomato wilt is Fusarium oxysporum, provided by China Center for Type Culture Collection, with the accession number of CCTCC AF 2015033;

[0032] The pathogen of cabbage sclerotinia is Sclerotinia sclerotiorum, which was provided by China Center for Type Culture Collection with the accession number of CCTCC CF 2008700;

[0033] The pathogen of melon gray mold is Botrytis cinerea, which is provided by China Center for Type Culture Collection with the accession number of CCTCC HF 2008148.

[0034] 1.2 Methods:

[0035] 1.2.1 Isolation and purification of endophytes

[0036] Using the conventional tissue separation method, the leaves, stems, and flowers of healthy tree vegetable plants collected from Chengmai County, Hainan Province were washed with running water until there was no dust or other impurities on the surface, and then cut into 1.0 cm × 1.0 cm squares with sterilized scissors. The treated tree vegetable tissues were clamped with sterilized tweezers and soaked in 0.1% mercuric chloride solution for 30 seconds, disinfected in 75% ethanol solution for 30 seconds, and then rinsed with sterile water 2 to 3 times. Place it on a clean filter paper in the clean bench, dry it, and inoculate it on PDA culture medium for 5 to 7 days. All strains of different forms and colors were selected in the culture medium for purification and culture.

[0037] 1.2.2 Indoor antibacterial activity determination

[0038] On PDA medium, the four-point confrontation method was used to test the inhibitory effect of endophytic fungi on Fusarium wilt. The isolated and purified endophytic fungi were used in a confrontation test with Fusarium wilt as treatment, and Fusarium wilt was used as control. The average value of three repetitions was used to calculate the colony growth inhibition rate.

[0039] Colony growth inhibition rate = (control colony diameter - treated colony diameter) / control colony diameter × 100%

[0040] 1.2.3 Morphological identification

[0041] Endophytic fungal strains with antibacterial activity in the confrontation test were selected and cultured on V8 medium for 5 to 7 days. After the colonies grew, they were cultured under light for 1 to 2 days, and then the mycelial characteristics and spore morphology were observed under an optical microscope.

[0042] 1.2.4 Molecular identification and phylogenetic tree construction

[0043] The purified endophytes with antibacterial effects were scraped with a sterilized scalpel to obtain mycelium, ground into powder in liquid nitrogen and placed in a centrifuge tube, and DNA was extracted and purified using a kit. A 1.5% agarose gel was prepared for electrophoresis to detect the size and purity of the extracted DNA fragments. PCR amplification was completed using universal primers for ITS1 / ITS4 fungal genes. The extracted DNA was recovered and sequenced, and the sequencing results were compared with Nucleotide BLAST homology. At the same time, a phylogenetic tree was constructed using MEGA7.0 software to determine its taxonomic status.

[0044] 1.3 Statistical analysis

[0045] The data obtained from the experiment were prepared using Microsoft Excel, and then SPSS software was used to perform significance analysis on the data.

[0046] 2. Results and Analysis

[0047] 2.1 Identification and analysis of endophytic fungi in Echinochloa chinensis

[0048] 2.1.1 Morphological identification of endophytic fungi

[0049] Five endophytic bacteria were isolated and purified from healthy tree broccoli tissues collected from Chengmai County, and were numbered SZN1, SZN-12, SZN-14, SZN-15, and SZN-19. These five strains showed the same morphology on the PDA plate, and it was preliminarily inferred that they were the same species. The front of the bacterial plate was white, the edge of the colony was slightly uneven, the hyphae were abundant, and the overall growth showed concentric ring patterns, such as Figure 3 As shown in A; the back is yellow-brown to black. After 5 to 7 days of cultivation, the mycelium covers the entire plate. Figure 3 As shown in B. Under an optical microscope, endophytic hyphae and conidia are Figure 3 As shown in C and Figure 3 As shown in D in the figure. Under constant temperature in the room, the conidiophores of endophytes on PDA medium are brown or light brown, upright, with nodes near the top. The conidia produced are mostly straight or slightly curved, large in the middle, thin at both ends, long round rods or long spindles, with 6 to 10 septa, most of which have 8, such as Figure 3 As shown in D, there are fewer spores. The morphological characteristics of this endophyte are basically consistent with the morphological description of Helicospora planum.

[0050] 2.2 Inhibitory effect of endophytic fungi on the growth of Fusarium wilt pathogen

[0051] Bipolaris sorokiniana is an endophytic fungus, and five strains, SZN-1, SZN-12, SZN-14-15 and NSJ-19, all have a certain inhibitory effect on Fusarium wilt pathogens in the tree. Figure 4 Among them, SZN-1 and SZN-19 had the best antibacterial effect on Fusarium wilt pathogens, which were significantly different from other strains, with inhibition rates of 67.49% and 67.17% on target strains respectively; SZN-14 and SZN-15 were second; SZN-12 had the lowest inhibition rate, as shown in Table 1.

[0052] Table 1 Inhibitory effect of endophytic strains on Fusarium wilt pathogens

[0053]

[0054] Note: Different lowercase letters indicate significant differences among treatments at the 0.05 level, the same as in the following table.

[0055] 2.1.2 Molecular biological identification of endophytic fungi

[0056] The DNA of the antibacterial strains SZN-1, SZN-12, SZN-14, SZN-15, and SZN-19 was used as a template and PCR amplified using the universal primers ITS1 / ITS4 for fungi. The amplified products were detected by agarose gel electrophoresis, and sterile water was set as a control. The results showed that no bands were amplified in the control group, and the electrophoresis bands of the five PCR amplified products were clear and bright, without any mixed bands, and the bases of the amplified bands were distributed around 500bp, such as Figure 5 shown.

[0057] At the same time, the amplified product was sent to Shanghai Biotech Co., Ltd. for sequencing. The measured strain DNA sequence was analyzed by BLAST on NCBI and found that the sizes of the ITS sequences of the five strains were 565 bp, 567 bp, 567 bp, 565 bp and 565 bp, respectively. Among them, the sequence similarity of SZN-1 and SZN-19 with better antibacterial activity was 100%, and they were the same strain. The ITS sequence similarity of SZN-1 and Bipolaris sorokiniana (accession number: KF494823.2), Bipolaris sorokiniana (accession number: KJ67094.1), and Bipolaris sorokiniana (accession number: KF725816.1) was high, with a consistency of 97.27%. Among them, the ITS sequence of SZN-1 is shown in SEQ ID NO: 1: 5'-GCTTCAACAAATATGAGGCCTTGGCTTCACGGCCGGCTGAAATATTTTTTTTCACCCAT GTCTTTTGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACCTTTTTTTTTTTATGCAGTTGCAATCAGCGTCAGTAAAAACAATGTAATAATTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAAAACGCAGCGAAATGCGATACGTAGGGGGAATTGCAAAATTCAGGGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGC ATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGGGTTGGGGGTTTTTTTGTCTCCCTCTTTCTGGGAAAACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCA CATAATTTGCACTTTGTATCAGGAAAAAAGGACGGTAATCCATCAAAACTCTACAATTTTTAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGAAA-3'

[0058] In the constructed phylogenetic tree, it was also found that SZN-1 and Bipolaris sorokiniana were in the same evolutionary branch, such as Figure 6The sources of the ITS sequences of 20 species of Helicoverpa are shown in Table 2. It is further proved that the endophytic fungus that has an inhibitory effect on Fusarium wilt is Helicoverpa. The obtained strain SZN-1 was deposited in the China Center for Type Culture Collection, and the classification name is: Bipolaris sorokiniana SZN-1, the deposit number is: CCTCCNO: M 2024468, and the deposit date is: March 11, 2024. The deposit address is: Wuhan University, Wuhan, China.

[0059] Table 2 Sources of ITS sequences of 20 species of Helicoverpa

[0060]

[0061] 2.3 Inhibitory effect of endophytic fungi in Serrata edulis on the growth of other pathogens

[0062] The endophytic fungus strain SZN1, which is highly antagonistic to the pathogen of Fusarium wilt of Chinese cabbage, was selected to evaluate its antibacterial effect on the pathogen of cabbage sclerotinia, the pathogen of melon gray mold, Botrytis cinerea, and the pathogen of tomato wilt, Fusarium oxysporum. The results are shown in Table 3 and Figure 7-Figure 9 shown.

[0063] Table 3 Inhibitory effect of endophytic strain SZN1 on Fusarium wilt pathogen

[0064]

[0065] Note: Different lowercase letters indicate significant differences among treatments at the 0.05 level.

[0066] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which are all covered by the protection scope of the present invention.

Claims

1. The endophytic fungus of the tree sapote, Helminthosporium umbilicus strain SZN-1, is characterized by: Deposited in China Center for Type Culture Collection, classified and named as: Bipolaris sorokiniana SZN-1, the deposit number is: CCTCC NO:M 2024468, and the deposit date is: March 11, 2024.

2. The use of the endophytic fungus Helminthosporium spp. strain SZN-1 of the tree sapling according to claim 1 in preventing and treating plant wilt diseases, wherein the plant wilt diseases are respectively Fusarium equisetum ( Fusarium equiseti ) caused by the pathogenic fungus Botrytis cinerea ( Botrytis cinerea ) caused by melon wilt, bitter melon wilt, and tomato wilt pathogen Fusarium oxysporum (Fusarium oxysporum) The pathogenic fungus Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum de Bary) caused by Chinese cabbage wilt and Chinese cabbage wilt.

3. A biological agent, characterized in that: The invention comprises the endophytic fungus of the tree sapote SZN-1 strain and an adjuvant acceptable to pesticides thereof.

4. The biological agent according to claim 3, characterized in that: The prepared biological bacterial agent has the form of aerosol, aqueous solution, microemulsion, powder, microcapsule, suspension or granule.

Images