Cyclic nucleotide-gated ion channel oscngc10 gene for regulating drought resistance and lodging resistance of rice and application thereof

By cloning and genetically transforming the rice OsCNGC10 gene, the technical challenges of drought resistance and lodging resistance in rice have been solved, achieving high yield and improved mechanical strength of rice under drought conditions.

CN118910119BActive Publication Date: 2026-06-26HUBEI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUBEI UNIV
Filing Date
2024-01-15
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing technologies have not effectively utilized the OsCNGC10 gene, a cyclic nucleotide-gated ion channel, to regulate the drought resistance and lodging resistance of rice, resulting in reduced yield and quality of rice under drought conditions and hindering mechanical harvesting.

Method used

By cloning the OsCNGC10 gene in rice and performing genetic transformation, overexpressing or knocking out the gene, gene editing can be carried out in rice using Agrobacterium-mediated methods to regulate the drought resistance and lodging resistance of rice.

Benefits of technology

Overexpression of OsCNGC10 enhances drought resistance in rice, while knockout of OsCNGC10 enhances lodging resistance, providing a new marker gene for rice breeding and improving rice's resistance and mechanical strength under drought conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to a cyclic nucleotide-gated ion channel OsCNGC10 gene for regulating rice lodging resistance and drought resistance and application. A cyclic nucleotide-gated ion channel OsCNGC10 gene induced by drought is screened, and the nucleotide sequence is shown as SEQ ID NO:1; the protein sequence coded by the gene is shown as SEQ ID NO:2. An OsCNGC10 overexpression strain and a CRISPR / Cas9 mutant strain are obtained by using an agrobacterium-mediated transformation. Stem characteristics and lodging resistance analysis of the transgenic plants show that the mutant oscngc10-2 has enhanced stem strength and lodging resistance; overexpression of OsCNGC10 reduces the stem wall thickness and lignin content, and knockout of OsCNGC10 increases the stem lignin content, which preliminarily indicates that OsCNGC10 negatively regulates the rice lodging resistance. The results of the drought stress experiment in the seedling stage show that the MDA accumulation speed in the OsCNGC10 gene-deficient plants is accelerated, and the plants cannot form sufficient free proline; the free Pro content in the overexpression OsCNGC10 plants is greatly increased, and the MDA accumulation speed is relatively slow, which indicates that OsCNGC10 positively regulates the rice seedling drought resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the functional identification and application of the OsCNGC10 gene, a cyclic nucleotide-gated ion channel that regulates lodging resistance and drought stress tolerance in rice. Background Technology

[0002] Rice is widely distributed throughout the world. In recent years, with the promotion of high-yield rice varieties with large panicles and the widespread application of simplified cultivation techniques such as direct seeding and transplanting, the potential risk of rice lodging has become increasingly greater (Lang YZ, Yang XD, Wang ME, et al. Effects of Lodging at Different Filling Stages on Rice Yield and Grain Quality[J]. Rice Science, 2012, 19(004):315-319.). When lodging occurs in the field, the yield and quality of rice will decrease, and mechanical harvesting will be severely hindered.

[0003] Cyclic nucleotide-gated channels (CNGCs) are ligand-gated cation channels mainly distributed on the plasma membrane (Chin, Kimberley, Moeder, et al. Biologicalroles of cyclic-nucleotide-gated ion channels in plants: What we know and don't know about this 20 member ion channel family.[J]. Botany, 2009, 77.MaW, Qi Z, Smigel A, et al. Ca 2+, cAMP, and transduction of non-self perception during plant immune responses[J]. PNAS, 2009,106(49):20995-21000), exist in animals and plants and are an important component of the eukaryotic signal cascade. The discovery of cyclic adenosine monophosphate (cAMP) stemmed from studies on the effects of epinephrine and glucagon on the activity of glycogen phosphorylase in canine liver (Rall TW, Sutherland EW, Berthet J . THE RELATIONSHIP OF EPINEPHRINE AND GLUCAGON TOLIVER PHOSPHORYLASE[J]. Journal of Biological Chemistry, 1957, 224( ​​1):463-475). CNGCs are a group of ion transport proteins found in many plants, including Arabidopsis thaliana, barley, rice, and tobacco.

[0004] They are only active when bound to cyclic nucleotides (Schuurink R C, Shartzer S F, Fath A, et al. Characterization of a calmodulin-binding transporter from the plasma membrane of barley aleurone[J]. Proceedings of the National Academy of Sciences of the United States of America, 1998,95(4):1944-1949, Köhler C and Merkle T and Neuhaus G. Characterisation of a novel gene family of putative cyclic nucleotide- and calmodulin-regulated ion channels in Arabidopsis thaliana.[J]. The Plant journal : for cell and molecular biology, 1999, 18(1): 97-104, Arazi T, Kaplan B, Fromm H. A high-affinity calmodulin-binding site in a tobacco plasma-membrane channel protein coincides with a characteristic element of cyclic nucleotide-binding domains[J]. Plant Molecular Biology, 2000, 42(4):591-601, Arazi T, Kaplan B, Fromm H. A high-affinity calmodulin-binding site in a tobacco plasma-membrane channel protein coincides with a characteristic element of cyclic nucleotide-binding domains[J].(PlantMolecular Biology, 2000, 42(4):591-601), which makes them potential targets for second messenger cyclic nucleotides.

[0005] In recent years, researchers have successively verified the function of CNGCs by overexpression or mutation in plants. Kaplan et al. identified and analyzed the CNGC family of the model plant Arabidopsis thaliana and found that there are 20 members in the Arabidopsis CNGC family, which are distributed in various tissues and organs of Arabidopsis thaliana and participate in the growth and development of Arabidopsis thaliana as well as perform certain functions in response to external environmental stimuli (Arazi T, Kaplan B, Fromm H. A high-affinity calmodulin-binding site in a tobacco plasma-membrane channel protein coincides with a characteristic element of cyclic nucleotide-binding domains[J]. PlantMolecular Biology, 2000, 42(4):591-601, Arazi T, Sunkar R, Kaplan B, et al. Atobacco plasma membrane calmodulin‐binding transporter confers Ni2+ tolerance and Pb2+ hypersensitivity in transgenic plants[J]. The Plant Journal, 1999,20(2): (171-182) Finka et al. found that after mutating GNGCb, which is homologous to the Arabidopsis gene AtCNGC2, in *Phyllostachys nigra*, it exhibited a phenotype similar to the AtCNGC2 deletion mutant; the loss of function of GNGCb led to a significant increase in Ca2+ influx under high temperature stress, resulting in an increase in intracellular calcium ion concentration and thus producing a hyperthermia response (Finka A, Cuendet AFH, Maathuis FJM, et al. Plasma membrane cyclic nucleotide gated calcium channels control land plant thermal sensing and acquired thermotolerance[J].The Plant Cell, 2012, 24(8): 3333-3348). In his study on the heat tolerance and disease resistance of AtCNGC2 and AtCNGC4, Zhu believed that compared with wild-type Arabidopsis, cngc2 and cngc4 had a severe dwarfing phenotype in the seedling stage and a delayed flowering period in the reproductive stage (Zhu Tianquan).Functional study of Arabidopsis CNGC2 and CNGC4 genes in heat tolerance and disease resistance [D]. Nanjing Agricultural University, 2020) Zhou et al. believe that apple MdCNGC2 is a negative regulator of powdery mildew resistance in apple callus (Zhou H, Bai S, Wang N, et al. CRISPR / Cas9-mediated mutagenesis of MdCNGC2 in applecallus and VIGS-mediated silencing of MdCNGC2 in fruits improve resistance to Botryosphaeria dothidea[J]. Frontiers in plant science, 2020: 11) Wang et al. found that OsCNGC9 mediates PAMP-induced Ca2+ influx, and this event plays a key role in PAMP-triggered ROS burst and induction of PTI-related defense gene expression (Gao QF, Gu LL, Wang HQ, et al. Cyclicnucleotide-gated channel 18 is an essential Ca2+ channel in pollen tube tipsfor pollen tube guidance to ovules in Arabidopsis[J]. Proc Natl Acad Sci U SA, 2016, 113(11):3096-3101) Jin et al. believed that AtCNGC10 may be involved in Na+ transport and negatively regulates the salt tolerance of Arabidopsis (Jin Y, Jing W, Zhang Q, et al. Cyclic nucleotide gated channel10 negatively regulates salt tolerance by mediating Na+ transport in Arabidopsis[J]. Journal of Plant Research, 2015, 128(1):211-220) Cui et al. believed that CNGC genes play a key role in the cold and heat tolerance of plants. OsCNGC14 and OsCNGC16 are important genes for coping with high temperature and resisting low temperature stress, and are regulators of the Ca2+ signaling pathway in the corresponding temperature change pathway. Furthermore, their tolerance to low-temperature stress was correspondingly reduced when the homologous genes AtCNGC2 and AtCNGC4 were missing in Arabidopsis thaliana (Cui Y, Lu S, Li Z, et al.).CYCLIC NUCLEOTIDE-GATED ION CHANNELs 14 and 16 Promote Tolerance to Heat and Chilling in Rice[J]. Plant Physiology, 2020, 183(4):pp.00591.2020) Therefore, the above results also lay the foundation for the study of OsCNGC10 regulating rice's resistance to lodging and drought stress.

[0006] To date, OsCNGC10 has not been seen used in regulating drought resistance and lodging resistance in rice. Summary of the Invention

[0007] The purpose of this invention is to provide a cyclic nucleotide-gated ion channel gene, OsCNGC10, which regulates drought resistance and lodging resistance in rice. This gene was cloned from the rice genome based on Arabidopsis homology sequence alignment and differential expression analysis of rice drought stress genes. The nucleotide sequence of the OsCNGC10 gene is shown in SEQ ID NO: 1, or a sequence with at least 50% homology, and the protein encoded by the above DNA fragment or a modified protein with the same function.

[0008] Another objective of this invention is to provide the application of the cyclic nucleotide-gated ion channel gene OsCNGC10 in the participation of rice drought resistance and lodging resistance. Through genetic transformation, the sequence shown in SEQ ID NO: 1 or its functionally equivalent homolog is overexpressed or knocked out in rice plants. The protein sequence encoded by the gene of this invention is shown in SEQ ID NO: 2. This protein is used to regulate rice drought resistance and lodging resistance, thereby enabling its application in the breeding of drought-resistant and lodging-resistant rice varieties, and can also serve as a marker gene for drought-resistant and lodging-resistant rice.

[0009] This invention analyzes the drought stress-induced expression patterns of the rice CNGC gene family and screens for a gene, OsCNGC10, which is significantly upregulated under drought stress. Using Agrobacterium-mediated genetic transformation, overexpression or knockout of this gene in rice revealed that transgenic materials with overexpression of this gene exhibited enhanced drought resistance but weakened lodging resistance, while mutant materials were more sensitive to drought but showed enhanced lodging resistance. This indicates that the OsCNGC10 gene is a positive regulator of rice's drought resistance response and a negative regulator of its lodging resistance response. Furthermore, this invention also relates to vectors containing this gene or its homologous gene fragments, and to the application of this gene or its functional analogs in enhancing plant drought resistance and lodging resistance in agricultural breeding.

[0010] The technical solution of the present invention is as follows:

[0011] The applicant cloned the OsCNGC10 gene, a rice cyclic nucleotide-gated ion channel that regulates lodging resistance and drought resistance in rice, and its nucleotide sequence is shown in SEQ ID NO:1.

[0012] The protein sequence encoded by the rice cyclic nucleotide-gated ion channel OsCNGC10 gene, which regulates lodging resistance and drought resistance in rice, is shown in SEQ ID NO:2.

[0013] The present invention relates to the application of the OsCNGC10 gene in regulating lodging resistance and drought resistance in rice.

[0014] The more detailed technical solution is as follows:

[0015] The applicant's previous research used RT-qPCR to analyze the expression patterns of the rice CNGC gene family induced by PEG drought stress. Based on the gene expression induction, the target gene OsCNGC10 was ultimately identified (see...). Figure 1 ).

[0016] RNA was extracted from leaves of the japonica rice variety Nipponbare and reverse transcribed into cDNA using Superscript III (purchased from Invitrogen, USA). Reaction conditions: 65 ℃ for 5 min, 50 ℃ for 60 min, 70 ℃ for 10 min. Using rice genome information, amplification primers OsCNGC10-F (5'ATGTTTGGGGCGGGGAAGGTGGACG 3') and OsCNGC10-R (5'TTACTCACAGGGTTCAGCTGAAAAAT 3') were synthesized to amplify the cDNA of the OsCNGC10 gene. PCR reaction conditions: 94 ℃ pre-denaturation for 3 min; 94 ℃ for 30 sec, 59 ℃ for 30 sec, 72 ℃ for 2 min 50 sec, 34 cycles; extension at 72 ℃ for 5 min. The PCR product obtained by amplification was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced to obtain the required gene ORF, the nucleotide sequence shown in SEQ ID NO:1, which encodes a 692-amino acid sequence (the sequence shown in SEQ ID NO:2).

[0017] This invention constructed an overexpression vector pU1301-CNGC10-Flag (see Figure 2A) and a CRISPR / Cas9-OsCNGC10 gene knockout vector (see Figure 2B). The applicant used Agrobacterium-mediated transformation to transform these two vectors into the japonica rice variety Nipponbare, obtaining positive lines for gene overexpression and CRISPR / Cas9 positive lines. The expression levels were detected, and the T1 generation overexpression line (numbered OE-CNGC10-6, see Figure 3A) and the CRISPR / Cas9 transformed line (detection primers were designed upstream and downstream of the target site, the corresponding fragments were amplified and sequenced, and materials with gene editing at the target site, resulting in large fragment deletions or premature translation termination, were screened for subsequent experiments. Finally, the line numbered oscngc10-2 was selected as the experimental material).

[0018] This invention analyzed the lodging resistance and drought resistance of OsCNGC10 transgenic materials (overexpression lines and CRISPR / Cas9 mutant lines) (the cultivation method and selection criteria for CRISPR / Cas9 mutant lines are well-known methods and are one of the methods of transgenics. This mutant was not obtained by chance, but was created using CRISPR / Cas9 technology. CRISPR / Cas9 is a commonly used technology for gene editing and is actually a biological material obtained through transgenics). It was found that compared with the control material, the lodging resistance of the mutant oscngc10-2 material was significantly improved, while the overexpression material OE-CNGC10-6 showed improved resistance to drought stress (Figure 4). Analysis of stem characteristics and lodging resistance in transgenic plants showed that the mutant oscngc10-2 exhibited enhanced stem strength and lodging resistance. Analysis of stem cell wall tissue sections and tissue components indicated that the enhanced lodging resistance of the mutant oscngc10-2 was due to increased stem cell wall thickness, parenchyma cell abundance, and lignin content. Overexpression of OsCNGC10 decreased stem wall thickness, stem lignin content, and stem cell wall cell abundance, while knockout of OsCNGC10 increased stem lignin content and stem cell wall parenchyma cell abundance, preliminarily demonstrating that OsCNGC10 is associated with the synthesis of rice stem cell wall components and negatively regulates rice lodging resistance (Figure 5). Seedling drought stress experiments showed that under drought stress, the accumulation rate of MDA in OsCNGC10 gene-deficient plants accelerated, and insufficient free proline was formed. In contrast, OsCNGC10 overexpressing plants exhibited increased free proline content under drought stress. The content increased significantly, and the accumulation rate of MDA slowed down relatively, indicating that OsCNGC10 positively regulates drought resistance in rice seedlings (Figure 6). The results of this study suggest that rice OsCNGC10 may have potential functions in drought resistance and lodging resistance, providing a theoretical basis and new germplasm resources for breeding new drought-resistant and lodging-resistant rice varieties.

[0019] Advantages of this invention:

[0020] (1) This invention analyzes the drought-induced expression patterns of the rice CNGC gene family, screens and identifies the OsCNGC10 gene. Subsequent studies have found that OsCNGC10 is a positive regulator of drought resistance in rice and a negative regulator of lodging resistance. Through genetic transformation, overexpression of this gene yields new drought-resistant rice lines, while knockout of this gene yields new lodging-resistant rice lines. It can also be used as a marker gene for screening rice resistance materials.

[0021] (2) There are very few research reports on CNGC genes in rice, and few documents support that CNGC genes in rice can participate in regulating drought resistance and lodging resistance. The OsCNGC10 gene cloned in this invention enriches the research on this type of functional gene in rice.

[0022] (3) Rice overexpressing OsCNGC10 showed significantly enhanced resistance to drought stress, while the oscngc10 mutant exhibited enhanced lodging resistance. This indicates that the OsCNGC10 gene is involved in and plays an important role in rice's resistance response to drought and lodging resistance. Increasing the expression level of the OsCNGC10 gene can regulate the accumulation of resistance factors in rice, thereby enhancing rice's resistance to drought. Knocking out the OsCNGC10 gene may act as a negative regulator of lodging resistance by affecting structural synthesis pathways related to rice stem cell walls.

[0023] (4) The selection of drought-resistant and lodging-resistant rice materials has always been valued by rice breeders. Due to the huge loss of rice yield caused by drought and lodging in current production, it is particularly important to select drought-resistant and lodging-resistant varieties. The application of the OsCNGC10 gene will help to cultivate new rice varieties that combine drought resistance and lodging resistance. Attached Figure Description

[0024] Figure 1 : OsCNGC10 induced expression pattern and phylogenetic tree analysis diagram. Figure label explanation: Figure 1 Figure A shows that OsCNGC10 was significantly induced to express in wild-type (i.e., non-transgenic) "Nipponbare" rice after drought stress, compared with the control.

[0025] Figure 2: Construction of OsCNGC10 overexpression vector and CRISPR / Cas9 gene knockout vector. Figure label explanation: Figure A in Figure 2 is... pU1301-CNGC10-Flag A map of the overexpression vector. Figure B in Figure 2 is... pRGEB32-CRISPR / cas9-cngc10 Gene knockout vector map.

[0026] Figure 3: Detection results of transgenic offspring. (Note: Figure A in Figure 3 is...) OsCNGC10 Results of expression level detection in overexpression material (T2 generation). Figure labeling: The OE-CNGC10-6-1 transgenic rice line was selected for subsequent research. Figure B in Figure 2 is... OsCNGC10 Mutant gene editing type detection. (Select) oscngc10-2 Further research will be conducted on the single-base deletion mutant lines.

[0027] Figure 4: Identification of drought resistance in control and transgenic materials. Figure labeling: Figure A in Figure 4 shows the plant morphology of wild-type (i.e., non-transgenic) and transgenic rice materials before treatment. Figure B in Figure 4 shows the phenotypic observation of control and transgenic materials after 10 days of drought stress. The results indicate that, compared with the control material, OsCNGC10 overexpression is more drought-resistant, while the cngc10 mutant is more sensitive to drought.

[0028] Figure 5: Proline and malondialdehyde (MDA) content in leaves of control and transgenic materials after 10 days of drought stress treatment. Figure label explanation: Figure 5A After 10 days of drought stress, the number of leaves knocked out per 1 g was [missing information]. oscngc10 The proline content of the material was significantly lower than that of the wild type, and the overexpression material OE-6 The proline content was significantly higher than that of the wild type. (Figure 5, B, per 1 g) OE- CNGC10-6 The content of malondialdehyde in rice leaves was significantly reduced, while oscngc10 The MDA content in leaves was significantly increased compared to the wild type. The results indicate that under drought stress, OsCNGC10 gene-deficient plants cannot form sufficient free proline, and the accumulation rate of MDA in these plants is accelerated under drought stress. In contrast, OsCNGC10 overexpressing plants showed a significant increase in free proline content and a relatively slower MDA accumulation rate under drought stress, suggesting that OsCNGC10 positively regulates drought resistance in rice seedlings.

[0029] Figure 6: Stalk strength measurement and stalk characteristic analysis of control and transgenic materials. Figure label explanation: Figure 6A Lodging resistance was tested on transgenic materials around 15 days after heading. The internode spacing at the base of stems from different materials at this stage was measured, and differences in root growth were observed. Results showed that compared to the wild-type Nipponbare WT, the internode spacing of the aboveground three nodes in oscngc10-2 was shorter (…). Figure 6A ), root length increased significantly, and root cap increased significantly ( Figure 6B Furthermore, the stem wall thickness increased significantly, and the stem strength was significantly enhanced, while OE-CNGC10-6 showed no significant difference compared to WT (Table 1).

[0030] Figure 7: Observation and tissue composition analysis of stem cell wall tissue sections of control material and transgenic material. Figure 7A The results are obtained by hand-slicing the second-to-last node of the control material and the transgenic material during the heading stage, staining them with safranin-green dye, and then imaging them under a microscope. Figure 7BThe results are from the analysis of cell wall tissue composition of the second-to-last node of the stems of the control and transgenic materials at the heading stage. The results indicate that the increased stem strength in plants with the oscngc10 gene knockout may be due to the knockout affecting pathways controlling lignin synthesis, leading to a significant increase in lignin synthesis and resulting in thicker stems and enhanced lodging resistance. Detailed Implementation

[0031] Description of the sequences in the sequence list:

[0032] SEQ ID NO: 1 is the nucleotide sequence of the OsCNGC10 gene cloned in this invention.

[0033] SEQ ID NO: 2 is the protein sequence encoded by the OsCNGC10 gene.

[0034] The following embodiments define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the OsCNGC10 gene, and for verifying the function of the OsCNGC10 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from its spirit and scope.

[0035] OsCNGC10 Gene isolation and cloning

[0036] (1) Rice RNA extraction and reverse transcription

[0037] Total RNA was extracted from fresh leaves of the wild-type japonica rice variety Nipponbare (a publicly used rice material). The MiniBEST Plant RNA Extraction Kit was used, following the instructions for the TaKaRa PrimeScript TMRT reagent Kit with gDNA Eraser. The obtained RNA samples were first subjected to a genomic DNA removal reaction. The DNA removal reaction solution consisted of: 2.0 μL 5×gDNA Eraser Buffer, 1.0 μL gDNA Eraser, 1.0 μg RNA, and 6.0 μL RNase-free ddH2O. After mixing, the mixture was incubated in a dry bath at 42°C for 2 min. The digested mixture was then used for reverse transcription. The reaction solution consisted of: 1.0 μL PrimeScript RTEnzyme Mix I, 4.0 μL RT Primer Mix, 4.0 μL 5×Prime Script Buffer 2, 1.0 μL RNase-Free ddH2O, and 10.0 μL of the digested mixture. Reverse transcription reaction conditions: 37℃, 15 min; 85℃, 5 sec, 4℃ storage.

[0038] (2) Analysis of the expression pattern of OsCNGC10 gene induced by PEG-simulated drought stress

[0039] To investigate whether the OsCNGC10 gene is involved in the drought resistance process of rice, this invention used RT-qPCR to detect the relative expression level of the OsCNGC10 gene transcription in wild-type rice after drought stress. The results showed that the OsCNGC10 gene was significantly upregulated under PEG drought stress. Wild-type 'Nipponbare' rice is a conventional japonica rice variety. Drought stress experiments were conducted on it when it reached the 4-leaf stage. After the stress experiment, total RNA was extracted from leaves of the treated lines and reverse transcribed into cDNA as a template. OsCNGC10-specific primers were designed: forward primer qOsCNGC10-F (5'GCAGTCTGTATTTTTGGGAGTC3') and reverse primer qOsCNGC10-R (5'GCACAACGTATGCACAGTATAG 3'). Using rice endogenous actin Actin (gene accession number AK101613) as an internal reference gene, forward primer Actin-F (5'GAGACCTTCAACACCCCTGCTA 3') and reverse primer Actin-R (5'ATCACCAGAGTCCAACACATTACCT3') were designed. Real-time quantitative RT-qPCR analysis was performed using a Geeen PCR MasterMix kit (following the kit instructions) on a BIO-Rad-CFX Connect (manufactured by BIO-Rad). Results showed that OsCNGC10 expression was significantly upregulated inducible by drought, suggesting that OsCNGC10 may be involved in rice's drought resistance response.

[0040] (3) Obtaining the OsCNGC10 gene sequence

[0041] The full-length sequence of OsCNGC10 was cloned using cDNA from the japonica rice variety 'Nipponbare' as a template, with forward primer CNGC10-Full-F (5' ATGTTTGGGGCGGGGAAGGTGGACG 3') and reverse primer CNGC10-Full-R (5' TTACTCACAGGGTTCAGCTGAAAAAT 3'). PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 28 cycles of 94℃ for 30 sec, 59℃ for 30 sec, and 72℃ for 50 sec; extension at 72℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced, and positive strains were stored at -80℃. The open reading frame (ORF) of the desired OsCNGC10 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The open reading frame (ORF) of the OsCNGC10 gene was determined using BlastX (http: / / www.ncbi.nlm.nih.gov), which contains 692 amino acids. Based on this, the protein sequence encoded by the OsCNGC10 gene is inferred as shown in the sequence listing SEQ ID NO: 2.

[0042] Example 2: Construction of OsCNGC10 gene overexpression and dual-target knockout vector

[0043] (1) Construction of OsCNGC10 gene overexpression vector

[0044] The relevant sequence of the OsCNGC10 gene was downloaded from the Rice Genome Database (RGAP). Primers for PCR amplification (OsCNGC10-R: 5' ATGTTTGGGGCGGGAAGGTGGACG 3' / OsCNGC10-F: 5' TTACTCACAGGGTTCAGCTGAAAAAT 3') were designed using Primer Premier 5 software. The amplified fragments of the correct size were ligated into the PGEM-Teasy vector. The ligation product was transformed into *E. coli* DH5α, positive clones were selected, plasmids were extracted, and sequencing was performed. Primers for the OsCNGC10 gene with the final vector adapter (OsCNGC10-Flag-R: 5' GAACGATAGCCGGTACCATGTTTGGGGCGGGAAGGT 3' / OsCNGC10-Flag-F: 5' CTTTGTAATCGGATCCCTCACAGGGTTCAGCTGAAA) were designed using Primer Premier 5 software. 3') Using the plasmid obtained in the previous step as a template, PCR amplification was performed to obtain the OsCNGC10 gene with the final vector adapter. The pU1301-3×Flag vector was double-digested with restriction endonucleases (KpnI, BamHI), and in-fusion ligation was performed using homologous recombinase to obtain the recombinant final vector pU1301-CNGC10-Flag. The ligation product was transformed into *E. coli*, single colonies were picked and cultured, and after agarose gel electrophoresis to confirm the correct bands, the bacterial culture was sequenced. The plasmid with correct sequencing results was transformed into *Agrobacterium*, single colonies were picked and cultured, and colony PCR was performed. Bacterial cultures with correct band sizes in the colony PCR results were stored at -80℃.

[0045] (2) Construction of OsCNGC10 gene knockout vector

[0046] The construction method of the dual-target knockout vector used in this invention is based on the tRNA tandem method pioneered by Professor Xie Kabin's research team at Huazhong Agricultural University, with modifications (http: / / crispr.hzau.edu.cn / CRISPR / ). According to... OsCNGC10Based on the DNA sequence and gene structure, two gRNA synthesis adapter primers (CNGC10-gRNA1-U3F, CNGC10-gRNA1-U3R, CNGC10-gRNA2-U3F, CNGC10-gRNA2-U3R) and adapter primers S5AD5-F, S5AD5-R and L5AD5-F, L5AD5-R required for gRNA ligation into the expression vector pRGEB32 were designed. Using the pGTR plasmid as a template, three primer pairs were used: L5AD5-F / CNGC10-gRNA1-U3R, CNGC10-gRNA1-U3F / CNGC10-gRNA2-U3R, CNGC10-gRNA2-U3F / L5AD5-R, and gRNA2-U3F / L5AD5-R. PCR amplification was performed. The three obtained RCR products were diluted 20-50 times and mixed in equal volumes. 1 μL of the mixture was used as a template for amplification using the S5AD5-F / S5AD5-R primer pair. The resulting product was purified and its concentration determined. The CRISPR / Cas9 expression vector pRGEB32 was digested with (KpnI, BamHI), and the digestion product was purified and recovered to obtain the linearized pRGEB32 vector. The purified PCR product was ligated into the linearized pRGEB32 vector using infusion recombination. The above reaction product was heat-shocked and transformed into *E. coli* DH5α. Single clones were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmid was transformed into *Agrobacterium tumefaciens* EHA105 competent cells.

[0047] Example 3: Genetic transformation of rice

[0048] (1) Induction of callus: Select plump, uniform wild-type Nipponbare seeds and peel off the glumes by hand to ensure the integrity of the seeds. Place the seeds in a sterile conical flask, soak the rice seeds in 75% ethanol for 1 min, then pour off the ethanol, and then soak them in 0.15% HgCl2 solution for 15-20 min. Pour the HgCl2 solution into a mercuric chloride recovery bottle, and finally wash the seeds 7-8 times with sterile ddH2O. After absorbing the moisture on filter paper, the seeds are evenly inoculated onto the surface of the induction medium that has been sterilized and placed for 3 days. The incubator is placed at 28℃ in the dark and cultured for 45-50 days.

[0049] (2) Subculture: Prepare the subculture medium 2-3 days in advance. The subculture medium formula uses fresh callus induction medium. Sterilize the medium according to the conventional method to make the medium moderately dry (the medium with too much moisture is not conducive to the growth of callus). From the induced callus, select callus that is light yellow in appearance, granular, dry and vigorous, and transfer it into the subculture medium. Incubate in the dark at 28℃ for 20 days.

[0050] (3) Pre-culture: Dispense sterile pre-culture medium into 500mL Erlenmeyer flasks in advance. Before the experiment, add 300μL of 100Mm acetylsalicylic acid and 5mL of 40% glucose to each 250mL medium. Mix well and fill 8-10 plates of medium into each flask. Pick out pale yellow, granular, dry and viable callus from the subcultured callus and transfer it into the culture plates of pre-culture medium. Inoculate about 60-80 pieces of callus the size of mung beans into each plate. If the callus is too large, it can be crushed with sterile forceps. Incubate in the dark at 8℃ for 3 days.

[0051] (4) Infection and Co-culture: Two days before the experiment, Agrobacterium strains containing the target gene (e.g., OsCNGC10) were streaked onto Petri dishes containing antibiotics (30 mg / L rifampin and 50 mg / L kanamycin) to activate the bacteria. Suspension medium (100 mL / strain), co-culture medium (250 mL / strain), large Petri dishes, small Petri dishes (lined with absorbent paper and filter paper, sterilized and dried before use), and several 250 mL sterile Erlenmeyer flasks were prepared. The streaked Agrobacterium was scraped into 1 / 2 N6 suspension medium (N6 medium is a commonly used plant tissue culture medium, containing 100 μL AS + 2 mL 50% glucose), and incubated at 28℃ and 200 rpm for 30 min. Simultaneously, the pre-cultured callus was collected into 250 mL sterile Erlenmeyer flasks. The Agrobacterium culture was poured into the callus and soaked for 30 min. Discard the bacterial solution. First, invert the Erlenmeyer flask containing the callus tissue onto a sterile dish to absorb the bacterial solution. Then, spread the callus tissue onto filter paper in a sterile dish, cover it with another sheet of filter paper, and gently press the callus tissue with sterile forceps to absorb the surface bacterial solution. Allow it to air dry for 3-4 hours. Use a sterile spoon to evenly spread the fully dried callus tissue onto the co-culture medium (it's best not to move it after spreading to reduce contact between the medium and the callus surface and prevent excessive growth of Agrobacterium). Incubate in the dark at 19°C for 3 days.

[0052] (5) Washing and First Screening (S1): Prepare sterile water, large and small dishes (containing absorbent paper and filter paper), several 250mL Erlenmeyer flasks, and prepare the screening medium. Transfer the co-cultured callus to a washing cup, pour in sterile distilled water until the callus is completely submerged, cover and shake for 20-30 seconds, then discard the sterile distilled water. Repeat this process 2-3 times. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, let stand for 5 minutes, then discard the sterile distilled water. Add sterile distilled water until the callus is completely submerged, cover and shake to mix, shake for 20-30 seconds, let stand for 10 minutes. Finally, discard the sterile distilled water, add sterile distilled water containing 500mg / L carbenicillin, and shake at 200rpm for 30 minutes. Discard the distilled water and allow the callus to air dry. The treated callus tissue was transferred to screening medium and cultured in the dark at 28°C for 20 days.

[0053] (6) Second screening (S2): Prepare screening medium. Add 300 μL carbenicillin, 250 μL hygromycin, and 5 mL 50% glucose to each 250 mL medium. After pouring, open the lid on a clean bench and blow with sterile air for 1.5-2 hours. The surface of the screening medium should not be too wet, otherwise it will not be conducive to the inhibition of Agrobacterium and the growth of resistant callus during screening. Select dry callus that is not contaminated with Agrobacterium from the S1 screening medium and place it on the S2 medium (inoculate 25 to 30 callus pieces per plate). Incubate in the dark at 28°C for 20 days.

[0054] (7) Differentiation of callus: Prepare differentiation medium 3-4 days in advance. Select small pieces of pale yellow, dense, and dry resistant callus, inoculate them into differentiation medium, and culture them at 28℃ under light (light intensity 3000 Lux) for 40 days. Seedlings will differentiate in the later stage of culture.

[0055] (8) Rooting culture: Prepare the rooting culture medium 2-3 days in advance. Prepare 4-5 sterile empty dishes; remove the differentiated seedlings from the differentiation culture medium, take only one seedling from each piece of callus, cut off the excessively long leaves and roots with scissors, and put them into rooting tubes, with 1-2 seedlings in each tube; culture in a light culture room (light intensity 3000 Lux) for 15-20 days, and after the roots have grown fully, harden the seedlings for 4-7 days, and then transplant them to the greenhouse.

[0056] Mother liquor formula:

[0057] (1) MSmax stock solution (10X)

[0058] NH4NO3 16.5 g;

[0059] KH2PO4 1.7 g;

[0060] KNO3 19.0 g;

[0061] MgSO4·7H2O 3.7 g;

[0062] 3.32 g of CaCl2;

[0063] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0064] (2) MSmin stock solution (100X)

[0065] MnSO4·4H2O 2.23 g;

[0066] ZnSO4·7H2O 0.86 g;

[0067] KI 0.083 g;

[0068] H3BO3 0.62 g;

[0069] Na2MoO4·2H2O 0.025 g;

[0070] CoCl2·6H2O 0.0025 g;

[0071] CuSO4·5H2O 0.0025 g;

[0072] Note: Na2MoO4 must be dissolved separately before mixing with other components, and then diluted with distilled water to a final volume of 1000 mL. Store at room temperature.

[0073] (3) N6max stock solution (10X)

[0074] KNO3 28.3 g;

[0075] (NH4)2SO4 4.63 g;

[0076] KH2PO4 4.0 g;

[0077] MgSO4·7H2O 1.85 g;

[0078] CaCl2 1.25 g;

[0079] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL.

[0080] (4) N6min stock solution (100X)

[0081] KI 0.08 g;

[0082] H3BO3 0.16 g;

[0083] ZnSO4·7H2O 0.15 g;

[0084] MnSO4·4H2O 0.44 g;

[0085] Dilute to 1000 mL with distilled water and store at room temperature.

[0086] (5)Fe 2+ -EDTA stock solution (100X)

[0087] Add 300 mL of distilled water and 2.78 g of FeSO4·7H2O to a reagent bottle;

[0088] Add 300 mL of distilled water to another reagent bottle and heat to 70°C. Then add 3.73 g of Na2EDTA·2H2O. After dissolving, mix the solutions from the two reagent bottles and keep them at 70°C for 2 hours. Then add distilled water to bring the volume to 1000 mL and store at 4°C protected from light.

[0089] (6) Vitamin stock solution (100X)

[0090] Nicotinic acid 0.1 g;

[0091] Thiamine HCl (VB1) 0.1 g;

[0092] Pyridoxine HCl (VB6) 0.1 g;

[0093] Inositol 10 g;

[0094] Glycine 0.2 g;

[0095] Add distilled water to a final volume of 1000 mL and store at 4°C.

[0096] (7) AAmax stock solution (10X)

[0097] KCl 29.50 g;

[0098] MgSO4·7H2O 2.50 g;

[0099] NaH2PO4 1.50 g;

[0100] CaCl2·2H2O 1.50 g;

[0101] Add distilled water to a final volume of 1000 mL and store at room temperature away from light.

[0102] (8) AAmin stock solution (100X)

[0103] MnSO4·H2O 1.0 g;

[0104] ZnSO4·7H2O 0.2 g;

[0105] CuSO4·5H2O 0.0025 g;

[0106] H3BO3 0.3 g;

[0107] KI 0.075 g;

[0108] CoCl2·6H2O 0.0025 g;

[0109] NaMoO4·2H2O 0.025 g;

[0110] Dissolve Na2MoO4 separately, then mix it with other components and add distilled water to bring the volume to 1000 mL. Store at room temperature away from light.

[0111] (9) 6-BA stock solution (1 mg / mL)

[0112] Add 100 mg of 6-BA to 1.0 mL of 1M KOH and shake until 6-BA is dissolved. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0113] (10) KT stock solution (1 mg / mL)

[0114] Add 100 mg of KT to 1.0 ml of 1M KOH and shake until KT dissolves. Then add distilled water to bring the volume to 100 mL and store at room temperature.

[0115] (11) 2,4-D stock solution (1 mg / mL)

[0116] Add 100 mg of 2,4-D to 1.0 ml of 1M KOH and shake for 5 min. Then add 10 mL of distilled water and shake until 2,4-D is dissolved. Make up to 100 mL with distilled water and store at room temperature.

[0117] (12) 100 μM AS stock solution

[0118] AS 0.196 g;

[0119] 10 mL of DMSO;

[0120] Aliquot into 1.5 mL centrifuge tubes and store at 4°C.

[0121] (13) IAA stock solution (1 mg / mL)

[0122] Add 100 mg of IAA to 1.0 ml of 1N KOH and shake until the IAA dissolves. Then, bring the volume up to 100 ml with dH2O and store at room temperature away from light.

[0123] (14) NAA stock solution (1 mg / mL)

[0124] Add 100 mg of NAA to 1.0 mL of 1M KOH and shake until NAA dissolves. Then, bring the volume to 100 mL with distilled water and store at room temperature away from light.

[0125] Culture medium formulation:

[0126] (1) Induction medium

[0127] N6max stock solution (10X) 100 mL;

[0128] N6min stock solution (100X) 10 mL;

[0129] Vitamin (100X) 10 mL;

[0130] Fe 2+ -EDTA stock solution (100X) 10 mL;

[0131] 2,4-D stock solution (1 mg / mL) 2.5 mL;

[0132] Casein hydrolase 0.6 g;

[0133] Proline 0.3 g;

[0134] Sucrose 30 g;

[0135] Phytagel 3g

[0136] pH value: 5.9

[0137] Add distilled water to bring the volume to 1000 mL.

[0138] (2) Subculture medium

[0139] N6max stock solution (10X) 100 mL;

[0140] N6min stock solution (100X) 10 mL;

[0141] Vitamin (100X) 10 mL;

[0142] Fe 2+-EDTA stock solution (100X) 10 mL;

[0143] 2,4-D stock solution (1 mg / mL) 2.0 mL;

[0144] 0.6 g of aged proteolytic enzyme;

[0145] Proline 0.5 g;

[0146] Sucrose 30 g;

[0147] Phytagel 3 g;

[0148] pH value: 5.9

[0149] Add distilled water to bring the volume to 1000 mL.

[0150] (3) Pre-culture medium

[0151] N6max stock solution (10X) 12.5 mL;

[0152] N6min stock solution (100X) 1.25 mL;

[0153] Vitamin (100X) 2.5 mL;

[0154] Fe 2+ -EDTA stock solution (100X) 2.5 mL;

[0155] 2,4-D stock solution (1 mg / mL) 0.75 mL;

[0156] Casein hydrolase 0.15 g;

[0157] Sucrose 5 g;

[0158] Phytagel 1.75 g

[0159] pH value: 5.6

[0160] Add distilled water to bring the volume to 250 mL.

[0161] (4) Co-culture medium

[0162] N6max stock solution (10X) 12.5 mL;

[0163] N6min stock solution (100X) 1.25 mL;

[0164] Vitamin (100X) 2.5 mL;

[0165] Fe 2+ -EDTA stock solution (100X) 2.5 mL;

[0166] 2,4-D stock solution (1 mg / mL) 0.75 mL;

[0167] Casein hydrolase 0.2 g;

[0168] Sucrose 5 g;

[0169] Agarose 1.75 g;

[0170] pH value: 5.6

[0171] Add distilled water to bring the volume to 250 mL.

[0172] (5) Suspension culture medium

[0173] N6max stock solution (10X) 5 mL;

[0174] N6min stock solution (100X) 0.5 mL;

[0175] Vitamin (100X) 1 mL;

[0176] Fe 2+ -EDTA stock solution (100X) 0.5 mL;

[0177] 2,4-D stock solution (1 mg / mL) 0.2 mL

[0178] Casein hydrolase 0.08 g

[0179] Sucrose 2 g;

[0180] pH value: 5.4

[0181] Add distilled water to bring the volume to 100 mL.

[0182] Screening culture medium

[0183] N6max stock solution (10X) 25 mL;

[0184] N6min stock solution (100X) 2.5 mL;

[0185] Vitamin (100X) 2.5 mL;

[0186] Fe 2+ -EDTA stock solution (100X) 2.5 mL;

[0187] 2,4-D stock solution (1 mg / mL) 0.625 mL;

[0188] Casein hydrolase 0.15 g;

[0189] Sucrose 7.5 g;

[0190] Phytagel 1.75 g;

[0191] pH value: 6.0

[0192] Add distilled water to a final volume of 250 ml.

[0193] Differentiation culture medium

[0194] MSmax stock solution (10X) 100 mL;

[0195] MSmin stock solution (100X) 10 mL;

[0196] Vitamin (100X) 10mL

[0197] Fe 2+ -EDTA stock solution (100X) 10 mL;

[0198] 6-BA 2.0 mL;

[0199] KT 2.0 mL;

[0200] IAA 0.2 mL;

[0201] 0.2 mL of NAA;

[0202] Sucrose 30 g;

[0203] 1 g of casein hydrolase;

[0204] Phytagel 3 g;

[0205] pH value: 6.0

[0206] Add distilled water to bring the volume to 1000 mL.

[0207] Rooting medium

[0208] MSmax stock solution (10X) 50 mL;

[0209] MSmin stock solution (100X) 5 mL;

[0210] Vitamin (100X) 10 mL;

[0211] Fe2+ -EDTA stock solution (100X) 10 mL;

[0212] Sucrose 20 g;

[0213] Phytagel 3 g;

[0214] pH value: 5.8

[0215] Add distilled water to bring the volume to 1000 mL.

[0216] Example 4: Identification of drought resistance in transgenic materials

[0217] (1) Cultivation of transgenic rice materials: Seeds from three lines—T1 overexpression line, knockout line, and wild-type "Nipponbare"—with plump grains and consistent morphology were selected. The husks were removed by hand to ensure grain integrity. The seeds were placed in sterile conical flasks and soaked in 75% ethanol for 1 minute. After discarding the 75% ethanol, the seeds were soaked in 0.15% HgCl2 solution for 15–20 minutes. The HgCl2 solution was poured into a mercuric chloride recovery bottle. Finally, the seeds were washed 7–8 times with sterile ddH2O. After absorbing the moisture on filter paper, the seeds were evenly spread on MS medium prepared 3 days in advance and placed in a constant temperature and light incubator. The cultivation conditions were set at 28℃, light intensity of 300 μmol·m⁻²·s⁻¹, 14h light / 10h dark, and relative humidity of 70%. When the first true leaf of the rice seedling unfolded, the seedlings were transferred to rice nutrient solution and cultivated until the three-leaf stage, while other conditions remained unchanged.

[0218] (2) Identification of drought resistance in seedlings of transgenic materials: Prepare several nutrient pots filled with vermiculite, ensuring that the vermiculite does not leak out without affecting the water absorption and drainage of the nutrient pots. Germinate the seeds of three lines simultaneously on MS medium: the T1 generation overexpression line, the knockout line, and the wild-type "Nipponbare". After the radicle and plumule have emerged, remove them with tweezers. Transplant seeds with radicles and plumules of similar size into nutrient pots filled with pure vermiculite. Place the nutrient pots in a basin and culture them with rice nutrient solution. When watering with nutrient solution, pour the nutrient solution into a water basin to allow the vermiculite to absorb it naturally. When the seedlings reach the 4-leaf stage in the greenhouse, withhold water for 7-10 days and observe the phenotype.

[0219] Example 5: Lodging resistance identification of control materials and transgenic materials

[0220] (1) Measurement of internode diameter and stem wall thickness of N3 (CWT): The stem of N3 internode was cut off at the middle. The major axis and minor axis of the outer diameter of the internode (excluding leaf sheath) were measured with digital vernier calipers, and the average value was taken as the internode diameter. The thickness at the intersection of the major axis and minor axis with the stem wall was measured, and the average of the four values ​​was taken as the stem wall thickness. Finally, the N3 internode (including leaf sheath) was blanched at 105℃ for 30 min and dried at 75℃ to constant weight.

[0221] (2) Stalk strength determination: Based on the method of identifying wheat stalk strength by Xiao Shihe et al. (Xiao Shihe, Zhang Xiuying, Yan Changsheng, et al. Research on the method of identifying wheat stalk strength [J]. Chinese Agricultural Science, 2002(01):7-11), the following modifications were made: When rice grows to about 10-15 days after heading, select the entire stalk of a single rice plant and tie it in the middle of the stalk. When measuring, keep the stalk strength measuring instrument perpendicular to the tying point in the middle of the stalk. Apply force slowly and evenly until the stalk is at a 45-degree angle to the ground, and record the peak value of the instrument (unit: Newton N). Each variety was measured 3 times in duplicate.

[0222] Example 6: Observation of stem cell wall tissue sections of control material and transgenic material

[0223] Cut the third segment from the base of the rice stem into a 1-2 mm thin slice, place it on a glass slide, add one drop of plant safranin staining solution, and stain for 1 min; remove the plant safranin, wash three times with distilled water, and remove excess water; add one drop of plant fast green staining solution, and stain for 30 s; remove the plant fast green, wash three times with distilled water, and remove excess water; mount with water, remove excess water, and observe under a biological microscope.

[0224] Example 7: Analysis of stem cell wall tissue composition of control and transgenic materials

[0225] With slight modifications to the method of Van Soest et al. (VAN SOEST PJ, ROBERTSON JB, LEWIS BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. Journal of Dairy Science, 1991, 74(10): 3583-3597.), cell wall components and contents were determined using a bioreactor kit. Rice materials at the heading stage were selected, and the stems and leaf sheaths were separated. The main stems of each plant were taken and blanched in an electric hot air drying oven at 105 ℃ for 15 min, dried at 80 ℃ for 2 hours, and dried at 50 ℃ to constant weight. The dried rice stems were cut into small pieces, ground into powder using a sample grinder, passed through a 40-mesh sieve, and placed into 2.0 mL EP tubes. The dried tubes were then stored under drying conditions for later use.

Claims

1. The application of overexpression of the cyclic nucleotide-gated ion channel OsCNGC10 gene in improving drought resistance in rice, characterized by: The nucleotide sequence of the rice OsCNGC10 gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:

2.

2. The application of knockout of the cyclic nucleotide-gated ion channel OsCNGC10 gene in improving lodging resistance in rice, characterized by: The nucleotide sequence of the rice OsCNGC10 gene is shown in SEQ ID NO:1, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:2.

Citation Information

Patent Citations

  • Application of NtCNGC1 gene in bacterial wilt resistance of tobaccos

    CN108660141A