Construction method and application of pig ybx3 gene knockout cell line

By constructing a porcine YBX3 gene knockout cell line using CRISPR/Cas9 technology, the problem of lacking an effective porcine YBX3 gene knockout cell line in existing technologies was solved, and an efficient YBX3 gene function loss and PEDV disease resistance breeding model was established, significantly affecting PEDV M gene expression.

CN118910163BActive Publication Date: 2026-04-10JIANGSU JIANGQUHAI PIG SEED IND CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411020053.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-29
Publication Date
2026-04-10
Estimated Expiration
2044-07-29

AI Technical Summary

Technical Problem

The lack of effective technology for constructing porcine YBX3 gene knockout cell lines in the current technology results in limited protective effects of vaccines and antiviral drugs against newly evolved highly pathogenic variants of porcine epidemic diarrhea (PED).

Method used

sgRNA sequences were designed using CRISPR/Cas9 technology. sgRNA1, sgRNA2, and sgRNA3 were designed using online software, forming dsDNA which was then ligated into a linearized PGK1.2 vector. Positive clones were selected by PCR sequencing, electroporated into the IPEC-J2 cell line, and subjected to drug screening and PCR amplification sequencing to identify the YBX3 gene knockout cell line. The differential expression of the PEDV M gene was detected by RT-qPCR.

Benefits of technology

A pig YBX3 gene knockout cell line was successfully constructed. The verification method is simple and effective, achieving efficient loss of YBX3 gene function and providing an ideal pig PEDV disease resistance breeding model. The expression of the PEDV M gene was significantly upregulated.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118910163B_ABST
    Figure CN118910163B_ABST
Patent Text Reader

Abstract

The application provides a construction method of a pig YBX3 gene knockout cell line, and is characterized by comprising the following steps: S1, designing sgRNA guide sequences, respectively sgRNA1, sgRNA2 and sgRNA3; S2, adding additional base CACC at the 5' end; S3, positively knocking out the plasmid mixture and performing drug screening by electric transformation, extracting YBX3 knockout cell DNA, using T7Endonuclease I enzyme to cut the PCR product, and simultaneously performing PCR amplification sequencing to verify the sgRNA efficiency; S4, selecting IPEC-J2 with high efficiency sgRNA transfection to perform limited dilution method screening; and S5, detecting the expression difference of PEDV M gene by RT-qPCR. The application successfully establishes the IPEC-J2 cell line with the pig YBX3 gene knockout, and the CRISPR / Cas9 knockout technology is more effective than interference, gene silencing and other technical means, and can help to study the function of YBX3 in pig disease resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene editing, and in particular to a pig YBX3 gene knockout cell line constructed by using CRISPR / Cas9 technology. BACKGROUND

[0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious enteric disease of pigs caused by PEDV. Its main features are watery diarrhea, vomiting, dehydration and anorexia. At present, the global pig industry is still threatened by PED, and PED is still one of the most harmful infectious diseases. The existing vaccines and antiviral drugs have limitations in preventing infection caused by the newly evolved PEDV highly pathogenic variant. This highlights the need to develop new strategies to effectively prevent and control the incidence and prevalence of PEDV.

[0003] The CRISPR / Cas9 system is an adaptive immune defense system formed by archaea and bacteria in the long-term evolution process. As a regular clustered interspaced short palindromic repeat system, CRISPR / Cas9 is a gene editing tool that recognizes and cuts dsDNA by Cas9 nuclease mediated sgRNA, inducing frameshift mutations caused by non-homologous end joining repair mechanism, thereby achieving editing of target genes. Due to its strong operability and high efficiency, in recent years it has become an important genetic means of site-directed editing and one of the most clinically and application-oriented gene therapy technologies.

[0004] YBX3 is a Y-box transcription factor that has selectivity for certain promoter sequences with inverted CCAAT boxes. YBX3 plays an important role in the proliferation and differentiation of epithelial cells. There is no YBX3 gene knockout cell line construction technology scheme related to pig PEDV resistance breeding in the prior art. SUMMARY

[0005] In view of the problems in the prior art, on the one hand, the present application provides a construction method of a pig YBX3 gene knockout cell line, comprising the following steps:

[0006] S1, designing sgRNA guide sequences through an online software website, respectively sgRNA1, sgRNA2, sgRNA3;

[0007] S2, adding additional base CACC at the 5' end, if the sgRNA 5' end has no base G, then additional base G is added, and the reverse complementary sequence adds additional base AAAC, after annealing, dsDNA is formed; the annealed dsDNA is subjected to enzyme digestion and connected to a linearized PGK1.2 vector to obtain a ligation product, and then PCR sequencing is performed to select positive clones and expand culture, and a positive knockout plasmid is obtained by extracting the plasmid;

[0008] S3, the positive knockout plasmid mixed electric transfer into IPEC-J2 cell line and drug screening, extraction YBX3 knockout cell DNA, using T7 Endonuclease I enzyme PCR product enzyme cutting, while amplification sequencing, verify sgRNA efficiency;

[0009] S4, select high efficiency sgRNA transfected IPEC-J2 to carry out limited dilution method screening, select single clone cells, after expansion culture, PCR sequencing and Western blot verification successfully screened YBX3 gene knockout cell line is obtained;

[0010] S5, YBX3 knockout cell line and control group cell extraction RNA, reverse transcription using RT-qPCR detection PEDV M gene expression difference.

[0011] Preferably, the online software website in step S1 is http: / / crispr.mit.edu / .

[0012] Preferably, the sequence of sgRNA1, sgRNA2 and sgRNA3 in step S1 is:

[0013] sgRNA1: CTCTTGGGCGCGGGGTCCTG;

[0014] sgRNA2: GAGATTGGAGAAATGAAGGA;

[0015] sgRNA3: GAAATCCGACTTACCGCCCA.

[0016] In another aspect, the application provides a method for constructing a pig YBX3 gene knockout cell line.

[0017] Compared with the prior art, the application has the following beneficial effects:

[0018] 1. The application successfully establishes a pig YBX3 gene knockout IPEC-J2 cell line, and the CRISPR / Cas9 knockout technology is more effective than interference and gene silencing technology, which can help to study the function of YBX3 in pig disease resistance breeding.

[0019] 2. The knockout technology method of the application is simple, and the verification method is reasonable. The target gene can be efficiently knocked out by designing sgRNA, and the results of PCR sequencing and Western blot effectively confirm the loss of YBX3 gene function, which is a relatively ideal YBX3 gene knockout IPEC-J2 cell model.

[0020] 3.The application provides application of the pig YBX3 knockout cell line to PEDV resistance breeding of pigs. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 YBX3 gene knockout vector sequencing peak chart, A is a sequencing peak chart of sgrna1 connected to the vector, B is a sequencing peak chart of sgrna2 connected to the vector, and C is a sequencing peak chart of sgrna3 connected to the vector;

[0022] Figure 2 YBX3 gene knockout plasmid transfected IPEC-J2 cell fluorescence chart;

[0023] Figure 3 T7 Endonuclease I enzyme digestion screening YBX3 gene knockout cell DNA PCR product gel electrophoresis detection chart;

[0024] Figure 4 YBX3 gene sgRNA knockout efficiency result chart of pool cell sequencing peak chart verification, A is a sequencing peak chart of sgrna2 transfected to the cell drug screen, and B is a sequencing peak chart of sgrna1 transfected to the cell drug screen;

[0025] Figure 5 YBX3 gene knockout monoclonal cell DNA sequence alignment analysis result chart with YBX3 original DNA sequence;

[0026] Figure 6 Western blot verification of YBX3 gene knockout monoclonal cell YBX3 expression;

[0027] Figure 7 RT-qPCR verification of YBX3 knockout cell line on PEDV M gene expression. DETAILED DESCRIPTION

[0028] The technical solutions of the application will be described below in combination with examples, but the application is not limited to the following examples. The experimental methods and detection methods described in the examples are all conventional methods unless otherwise specified. The reagents and materials described are all commercially available unless otherwise specified.

[0029] Example 1: Design and synthesis of sgRNA sequence

[0030] According to the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), the CDS region of YBX3 (XM_003126475.3) is found, and the sequence is as follows:

[0031] YBX3:

[0032]

[0033] Three sgRNA guide sequences were designed using CRISPRDesign (http: / / crispr.mit.edu / ):

[0034] sgRNA1: CTCTTGGGCGCGGGGTCCTG;

[0035] sgRNA2: GAGATTGGAGAAATGAAGGA;

[0036] sgRNA3: GAAATCCGACTTACCGCCCA.

[0037] Additional bases were added to the 5' end of the three sgRNA sequences, and the PAM (NGG) sequence was removed from the 3' end. The forward primer added CACC, and if the first base at the 5' end of the sgRNA sequence was not G, it added CACCG; the 5' end of the reverse complement sequence of the sgRNA added bases AAAC. The three pairs of sgRNA sequences are as follows:

[0038] YBX3-1F: CACCGCTCTTGGGCGCGGGGTCCTG;

[0039] YBX3-1R: AAACCAGGACCCCGCGCCCAAGAGC;

[0040] YBX3-2F: CACCGAGATTGGAGAAATGAAGGA;

[0041] YBX3-2R: AACTCCTTCATTTCTCCAATCTC;

[0042] YBX3-3F: CACCGAAATCCGACTTACCGCCCA;

[0043] YBX3-3R: AACTGGGCGGTAAGTCGGATTTC.

[0044] 2. Construction of YBX3 knockout vector

[0045] (1) The three pairs of sgRNA synthesized above were annealed to form double-stranded sgRNA. The sgRNA, double-distilled water, and annealing buffer were mixed and then placed in a PCR instrument. The annealing was completed using the following program: 95°C, 10 min; 65°C, 60 min. The annealing reaction system is as follows:

[0046]

[0047] (2) BbsI enzyme (NEB) linearizes the PGK1.2 vector (Jiankai Rui Biological) and the enzyme digestion reaction system is as follows:

[0048]

[0049] After 3h incubation at 37℃, the linearized vector is recovered using the gel recovery kit (Vazyme).

[0050] (3) T4 DNA ligase (NEB) connects the PGK1.2 linearized vector with double-stranded sgRNA, and the connection reaction system is as follows:

[0051]

[0052] After overnight incubation at 16℃, the gel recovery kit (Vazyme) is used for gel recovery.

[0053] (4) Take 5μL of the connection product and mix with 50μL of competent cells DH5α (Takara) on ice for 30min, then heat shock at 42℃ for 90s, quickly take out and place on ice for 2-3min, add 500μL of LB liquid medium without antibiotics, shake culture (37℃ / 200rpm) for 1h, centrifuge at 4500rpm for 5min, discard the supernatant, add 200μL of LB liquid medium without antibiotics, blow the precipitate to disperse and mix, use the spreader to evenly spread it on the solid medium plate containing 100μg / mL ampicillin resistance, and culture in a 37℃ incubator for 12-16h until medium-sized single colonies grow.

[0054] Use a pipette to gently dip the single colony and place it in a 1.5mL sterile centrifuge tube, add 1mL of LB liquid medium containing 100μg / mL ampicillin, and shake culture (37℃ / 200rpm) for 6-8h. After the medium is turbid, send it to Shanghai Shengong Biological for sequencing verification, and the sequencing results are shown in Figure 1 , Figure 1 A is the sequencing peak chart corresponding to sgRNA1, Figure 1 B is the sequencing peak chart corresponding to sgRNA2, Figure 1 C is the sequencing peak chart corresponding to sgRNA3, which shows that the sgRNA sequence has been successfully connected with the PGK1.2 vector. The positive colonies are expanded and cultured, and the endotoxin-free plasmid extraction kit (Vazyme) is used to extract the YBX3 knockout plasmid.

[0055] 3. Cell transfection and sgRNA efficiency verification

[0056] IPEC-J2 cells were seeded into 6-well plates for culture, and when the cells grew to about 50% confluence, transfection was performed. 2 μg / well of YBX3 knockout plasmid and 4 μL / well of jetPRIME reagent (Polyplus) were mixed with 200 μL / well of jetPRIME buffer and incubated for 10 minutes at room temperature. Then the mixture was added to the 6-well plate to culture the cells. After 48 hours of culture, drug screening was performed with a final concentration of 10 μg / mL of puromycin, and the medium was changed every day. The cells were observed using a fluorescence microscope, and the results are shown in After the cells were fully changed into fluorescent cells, genomic DNA of the cells was extracted using a DNA extraction kit (Takara) after the cells were fully grown. Figure 2

[0057] The target fragment was amplified using PCR: high-specificity primers were designed near the YBX3 knockout target site, and the primer sequences are as follows:

[0058]

[0059] The PCR amplification system reaction is as follows:

[0060]

[0061] The reaction program is as follows: 95°C for 5 minutes, 95°C for 30 seconds, 55-62°C for 30 seconds, 72°C for 30 seconds, 35 cycles, and 72°C for 10 minutes.

[0062] The PCR product was subjected to T7 Endonuclease I enzyme digestion, and the product was purified after enzyme digestion, and then 2%-3% (M / V) agarose gel electrophoresis was used to detect the enzyme digestion band, Figure 3 which shows the knockout efficiency of sgRNAs 2 and 3. 1 is the control of sgrna1, 2 is the band after T7 enzyme digestion of sgrna1, 3 is the control of sgrna2, 4 is the band after T7 enzyme digestion of sgrna2, 5 is the control of sgrna3, 6 is the band after T7 enzyme digestion of sgrna3, and double bands indicate that the gene has been successfully digested.

[0063] sgRNAs 2 and 3 were subjected to pool cell PCR sequencing, and the results are shown in Figure 4 The sequencing results show that there are nested peaks, which preliminarily prove that sgRNAs 2 and 3 have knockout efficiency.

[0064] 4. Screening and verification of YBX3 gene knockout monoclonal cells

[0065] ​The pool cells selected with No. 2 sgRNA were placed in the first well of a 96-well plate at an amount of 3000 cells, diluted by limiting dilution method, and then placed in a cell incubator for culture. The next day, the single clone cells were labeled, and the growth of the single clones was observed regularly. The culture was continuously expanded until the 6-well plate.

[0066] TA clone verification of YBX3 knockout monoclonal cells: TA clone sequencing was performed on YBX3 gene knockout cells, and the sequencing results were compared with the DNA sequence of YBX3 gene non-knockout cells. The results are shown in Figure 5 , and the DNA mutation of the knockout cells is a mutation of inserting a base A.

[0067] Western blot verification of YBX3 knockout monoclonal cell lines: total protein was extracted from cells using RIPA protein lysis buffer (thermofisher), and cell protein was quantified by BCA protein concentration determination kit (Beyotime Biotechnology). 20 μg of protein was separated by 10% (M / M) SDS-PAGE gel and transferred to a 0.22 μm PVDF membrane (Millipore). The membrane was blocked with 5 (M / V) skim milk powder and incubated with YBX3 antibody (abcam) at 4°C overnight. Then the membrane was incubated with the corresponding secondary antibody, and the ECL detection system (Bio-Rad) was used to detect the protein band. HSP90 (proteintech) as a control. The results are shown in Figure 6 , where NC is the negative control, YBX3-KO is the YBX3 knockout group cells, 50 kDa is the YBX3 protein size, and 90 kDa is the HSP90 protein size. The Western blot detection results show that almost no YBX3 protein can be detected in the knockout cell line, while normal expression of YBX3 protein can be detected in the control group.

[0068] 5. Effect of YBX3 gene knockout monoclonal cells on PEDV replication

[0069] Total RNA was extracted using the Trizol method, and complementary DNA (cDNA) was synthesized using the PrimeScript RT kit (TaKaRa). Real-time quantitative PCR (RT-qPCR) was performed using the qPCR SYBR Green Master Mix (Vazyme), and GAPDH was used as the reference gene for RT-qPCR. The system was placed in a fluorescent quantitative PCR instrument ABI steponeplus, and the reaction program was set as follows: 95°C, 5 min; 95°C, 10 s; 60°C, 30 s (40 cycles), and the default melting curve acquisition program. The comparative 2-ΔΔCt method was used to calculate the relative quantitative results.

[0070] The RT-qPCR primer information is as follows:

[0071]

[0072] The RT-qPCR reaction system is as follows:

[0073]

[0074] The results are shown in Table 1. Figure 7 The KO-NC is a control group of cells transfected with a pGk1.2 blank vector, and the KO-YBX3 is a YBX3 knockout group of cells, and * represents P<0.05 of a single-tailed T test, and there is a significant difference between the two groups. The YBX3 knockout can significantly up-regulate the expression of the PEDVM gene.

[0075] From the above experiment, it can be seen that the pig small intestinal epithelial cell line (IPEC-J2) with the YBX3 gene knocked out is successfully constructed by the above method, and the PEDV disease-resistant breeding is preliminarily applied.

[0076] The embodiments of the present application only introduce the specific implementation manners, and are not limited to the protection scope. The skilled in the art can make certain modifications under the inspiration of the embodiments, and any equivalent changes or modifications made according to the patent scope of the present application shall belong to the patent claim scope of the present application.

Claims

1. A method for constructing a pig YBX3 gene knockout cell line, characterized in that, The method comprises the following steps: S1, designing a sgRNA2 guide sequence through an online software website, wherein the sequence of the sgRNA2 is: sgRNA2: GAGATTGGAGAAATGAAGGA; S2, a primer for the sgRNA2 needs to add an extra base CACC at the 5' end, if the sgRNA 5' end has no base G, an extra base G is added, and the reverse complementary sequence adds an extra base AAAC, wherein the primer sequence of the sgRNA2 is: YBX3-2F: CACCGAGATTGGAGAAATGAAGGA; YBX3-2R: AAACTCCTTCATTTCTCCAATCTC; After annealing, a dsDNA is formed; the dsDNA after annealing is subjected to enzyme cutting and is connected to a linearized PGK1.2 vector to obtain a connection product, and then a positive clone is selected through PCR sequencing and is expanded and cultured, and a positive knockout plasmid is obtained by extracting a plasmid; S3, the positive knockout plasmid is mixed and electroporated into an IPEC-J2 cell line and is subjected to drug screening, YBX3 knockout cell DNA is extracted, a PCR product is subjected to enzyme cutting by using a T7 Endonuclease I enzyme, and meanwhile, amplification sequencing is performed, and sgRNA efficiency is verified; S4, an IPEC-J2 with high efficiency of sgRNA transfection is selected to perform a limited dilution method screening, a single clone cell is selected, and after being expanded and cultured, YBX3 gene knockout cell lines are successfully screened through PCR sequencing and Western blot verification; S5, RNA of YBX3 knockout cell lines and a control group cell is extracted, and after reverse transcription, RT-qPCR is used to detect expression differences of PEDV M genes.

2. Application of the method for constructing a pig YBX3 gene knockout cell line according to claim 1 in the construction of a pig YBX3 gene knockout cell line.