A rice chitin-eating bacterium with biological control and growth-promoting effects and its application

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a rice chitinophage bacteria with biological control and growth promotion effects and its application. The present invention is the first to screen and isolate a rice chitinophage bacteria ( Chitinophaga oryzae )Cas201. Experiments have shown that this strain has good inhibitory activity against Ralstonia solanacearum, and has the ability to produce siderophore and protease, and can promote tobacco seed germination and tobacco plant growth. It is efficient and safe, does not cause environmental pollution problems, has simple culture conditions, is easy to preserve, and is suitable for industrial production. Therefore, it has good practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a rice chitinophage bacteria with biological control and growth promotion effects and application thereof. Background Art

[0002] Bacterial wilt is caused by Ralstonia solanacearum ( Ralstonia solanacearum ) is a devastating soil-borne bacterial disease, known as "plant cancer". The onset of bacterial wilt is generally caused by high temperature and high humidity. Heavy soil, poor drainage, and continuous tobacco cropping are factors that aggravate bacterial wilt. Bacterial wilt mainly occurs in the middle and late stages of crop growth, seriously affecting crop yield and quality, and in severe cases may lead to crop failure.

[0003] At present, the main prevention and control measures for bacterial wilt are mainly focused on the selection and breeding of resistant varieties, chemical agents, agronomic management measures, biological control, etc. The cultivation of resistant varieties is mostly targeted at a certain type of pathogenic species, which has specific limitations, and the cycle of variety breeding is long, which is difficult to meet agricultural and industrial needs. Chemical control is currently a common method for the prevention and control of bacterial wilt, but excessive chemical agents will lead to the emergence of pathogen resistance, reduce the field control effect, and also threaten the environment and human health and other adverse effects. Biological control generally uses indigenous microorganisms with pathogen antagonism to inhibit the growth of pathogens and reduce the base number of pathogens in the rhizosphere environment. It has the characteristics of high efficiency, safety, and environmental friendliness. Previous researchers have sporadically carried out the screening of biocontrol bacteria and growth-promoting bacteria for bacterial wilt, and the development of more types and more effective disease biocontrol bacteria and growth-promoting bacteria is of great significance to the production of Solanaceae crops. At present, biocontrol agents have been isolated and reported, but they are mostly concentrated on common strains such as Bacillus and Pseudomonas. Therefore, further research is necessary to broaden the resource base of bacterial wilt biocontrol bacteria and plant growth-promoting bacteria. Summary of the invention

[0004] Based on the above-mentioned deficiencies of the prior art, the present invention provides a rice chitinophore with biological control and growth promotion effects and its application. Specifically, the present invention isolates a rice chitinophore ( Chitinophaga rice ), its classification status was determined by 16S rDNA sequencing and construction of a phylogenetic tree, and the bacteriostatic activity and pro-liferative activity showed that the bacterium had good inhibitory activity against Ralstonia solanacearum, and had the ability to produce siderophore and protease, and could promote tobacco seed germination and tobacco plant growth. Based on the above research results, the present invention was completed.

[0005] In order to achieve the above technical objectives, the present invention relates to the following technical solutions:

[0006] In a first aspect of the present invention, a rice chitinophage bacteria ( Chitinophaga oryzae)Cas201, which was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, China) on September 5, 2023, and its biological deposit number is CGMCC No.28361.

[0007] Furthermore, Chitinophaga oryzae Chitinophaga oryzae ) The culture of Cas201 also falls within the scope of protection of the present invention.

[0008] The rice chitinophage bacteria provided by the present invention ( Chitinophaga oryzae )Cas201 culture is a culture of Chitinobacterium oryzae ( Chitinophaga oryzae ) The substances obtained by culturing Cas201 in the culture medium (all the substances in the culture container).

[0009] In the above culture, the substance includes Chitinobacterium oryzae ( Chitinophaga oryzae )Cas201 (the bacteria itself) and Chitinophaga oryzae ( Chitinophaga oryzae ) Metabolites of Cas201.

[0010] The second aspect of the present invention provides a bacterial agent, wherein the bacterial agent provided by the present invention contains oryzae chitinifera ( Chitinophaga oryzae )Cas201 or Chitinophaga oryzae ( Chitinophaga oryzae ) cultures of Cas201.

[0011] The third aspect of the present invention provides the above-mentioned rice chitinophage bacteria ( Chitinophaga oryzae ) Use of Cas201 or bacterial agents in any one or more of the following:

[0012] (a) inhibiting plant pathogens;

[0013] (b) suppressing plant diseases;

[0014] (c) promoting plant seed germination;

[0015] (d) promoting plant growth;

[0016] (e) Production of siderophores and proteases.

[0017] The plant pathogen may be Ralstonia solanacearum;

[0018] The plant disease may be a plant disease mediated by Ralstonia solanacearum, such as tobacco bacterial wilt.

[0019] The promoting of plant growth is specifically manifested in increasing the plant height, leaf length and leaf width.

[0020] The plant may be tobacco.

[0021] A fourth aspect of the present invention provides a method for preventing and controlling tobacco bacterial wilt or promoting tobacco plant growth, the method comprising: applying the above-mentioned chitinifera oryzae ( Chitinophaga oryzae ) Cas201 or the above-mentioned fungal agents are sprayed or irrigated at the roots.

[0022] A fifth aspect of the present invention provides a method for promoting tobacco seed germination, the method comprising applying the above-mentioned chitinophore ( Chitinophaga oryzae ) Cas201 or the above-mentioned bacterial agents for soaking treatment.

[0023] Beneficial technical effects of one or more of the above technical solutions:

[0024] The above technical scheme screened and isolated a rice chitin-eating bacterium ( Chitinophaga oryzae )Cas201. Experiments have shown that this strain has good inhibitory activity against Ralstonia solanacearum, and has the ability to produce siderophore and protease, and can promote tobacco seed germination and tobacco plant growth. It is efficient and safe, does not cause environmental pollution problems, has simple culture conditions, is easy to preserve, and is suitable for industrial production. Therefore, it has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a colony morphology diagram of strain Cas201 in an embodiment of the present invention.

[0026] Figure 2 In the present invention, the Neighbour-Joining method is used to construct the strain Cas201 and the chitinophage ( Chitinophaga ) Phylogenetic trees of other species.

[0027] Figure 3 This is a diagram showing the antibacterial effect of strain Cas201 on Ralstonia solanacearum in an embodiment of the present invention.

[0028] Figure 4 The results of the strain Cas201 producing siderophore (A) and protease (B) in the examples of the present invention are shown.

[0029] Figure 5 This is the effect of the bacterial suspension of strain Cas201 on tobacco seed germination in the examples of the present invention.

[0030] Figure 6 This is the growth-promoting effect of the bacterial suspension of strain Cas201 on tobacco in the examples of the present invention. DETAILED DESCRIPTION

[0031] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0032] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the term "comprising" or "including" is used in this specification, it indicates the presence of features, steps, operations, devices, components or combinations thereof.

[0033] In a typical embodiment of the present invention, a rice chitinophage bacteria ( Chitinophaga rice )Cas201, which was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, China) on September 5, 2023, and its biological deposit number is CGMCC No.28361.

[0034] Chitinophaga oryzae Chitinophaga oryzae ) The culture of Cas201 also falls within the scope of protection of the present invention.

[0035] The rice chitinophage bacteria provided by the present invention ( Chitinophaga oryzae )Cas201 culture is a culture of Chitinobacterium oryzae ( Chitinophaga oryzae ) The substances obtained by culturing Cas201 in the culture medium (all the substances in the culture container).

[0036] In the above culture, the substance includes Chitinobacterium oryzae ( Chitinophaga oryzae )Cas201 (the bacteria itself) and metabolites of Cas201 of Chitinobacterium oryzae.

[0037] In the present invention, the term "culture" refers to a general term for a liquid or solid culture medium with a microbial population after artificial inoculation and culture. That is, the product obtained by growing or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites or other components produced during the culture process. The term "culture" also includes a subculture obtained by subculturing a microorganism, which can be a culture of a certain generation or a mixture of several generations.

[0038] In the present invention, the term "metabolite" refers to the primary metabolites or secondary metabolites produced during the metabolism of microorganisms. Primary metabolism refers to the process in which microorganisms absorb various nutrients from the outside world and generate substances and energy to maintain life activities through catabolism and anabolism. The products of primary metabolism are primary metabolites, such as monomers such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, lipids, etc. Secondary metabolism refers to the process in which microorganisms use primary metabolites as precursors to synthesize some substances that have no clear function on the life activities of microorganisms during a certain growth period. The products of secondary metabolism are secondary metabolites, which are mostly compounds with relatively complex molecular structures.

[0039] In the present invention, the metabolites can be obtained from the rice chitinophage bacteria ( Chitinophaga oryzae ) Cas201 culture. The metabolite can be the rice chitinophore ( Chitinophaga oryzae ) a sterile metabolite of Cas201 or the Chitinophaga oryzae ( Chitinophaga oryzae ) The sterile metabolite of Cas201. The sterile metabolite of the rice chitin-eating bacteria Cas201 can be prepared according to the following method: culturing the rice chitin-eating bacteria Cas201 in a liquid culture medium, filtering and removing the rice chitin-eating bacteria Cas201 in the liquid culture (fermentation liquid) to obtain the sterile metabolite of the rice chitin-eating bacteria Cas201. The rice chitin-eating bacteria ( Chitinophaga oryzae ) The bacterial metabolite containing Cas201 can be prepared specifically according to the following method: culturing the rice chitin-eating bacteria ( Chitinophaga oryzae ) Cas201, collecting the fermentation liquid, which is the rice chitinophore ( Chitinophaga oryzae ) Bacterial metabolites of Cas201.

[0040] In a specific embodiment of the present invention, the culture medium may be NB culture medium, which is not specifically limited herein.

[0041] In another specific embodiment of the present invention, a bacterial agent is provided. The bacterial agent provided by the present invention contains Chitinophora oryzae ( Chitinophaga oryzae )Cas201 or Chitinophaga oryzae ( Chitinophaga oryzae ) cultures of Cas201.

[0042] Among the above-mentioned microbial agents, the microbial agent may be a plant pathogen inhibitor, a plant disease inhibitor, a microbial agent for promoting plant growth, or a microbial agent for promoting plant seed germination.

[0043] In the above-mentioned bacterial agents, the plant pathogen inhibitor can have an inhibitory effect on the tobacco bacterial wilt pathogen (Ralstonia solanacearum); therefore, the plant disease can be tobacco bacterial wilt.

[0044] In the above-mentioned bacterial agent, the active ingredient of the bacterial agent can be Chitinobacterium oryzae ( Chitinophaga oryzae )Cas201 or Chitinophaga oryzae ( Chitinophaga oryzae ) Cas201 culture, the active ingredients of the bacterial agent may also contain other biological components and / or non-biological components. The other active ingredients of the bacterial agent can be determined by those skilled in the art according to the antibacterial effect, disease resistance effect, plant growth promotion effect and plant seed germination promotion effect.

[0045] In the above-mentioned microbial agent, the microbial agent contains a carrier in addition to the active ingredient. The carrier can be a carrier commonly used in the pesticide field and biologically inert, and is not specifically limited here.

[0046] The above-mentioned bacterial agents may be in various dosage forms, such as liquid, emulsion, suspension, powder, granule, wettable powder or water dispersible granule.

[0047] In another specific embodiment of the present invention, the above-mentioned rice chitinophore ( Chitinophaga rice ) Use of Cas201 or bacterial agents in any one or more of the following:

[0048] (a) inhibiting plant pathogens;

[0049] (b) suppressing plant diseases;

[0050] (c) promoting plant seed germination;

[0051] (d) promoting plant growth;

[0052] (e) Production of siderophores and proteases.

[0053] The plant pathogen may be Ralstonia solanacearum;

[0054] The plant disease may be a plant disease mediated by Ralstonia solanacearum, such as tobacco bacterial wilt.

[0055] The promoting of plant growth is specifically manifested in increasing the plant height, leaf length and leaf width.

[0056] The plant may be tobacco.

[0057] In another specific embodiment of the present invention, a method for preventing and controlling tobacco bacterial wilt or promoting tobacco plant growth is provided, the method comprising: applying the above-mentioned chitinophore bacteria ( Chitinophaga oryzae) Cas201 or the above-mentioned fungal agents are sprayed or irrigated at the roots.

[0058] In another specific embodiment of the present invention, a method for promoting tobacco seed germination is provided, the method comprising applying the above-mentioned chitinophore ( Chitinophaga oryzae ) Cas201 or the above-mentioned bacterial agents for soaking treatment.

[0059] The present invention is further explained by the following examples, but they are not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The pathogens tested in the examples are all isolated and stored by the Tobacco Research Institute of the Chinese Academy of Agricultural Sciences.

[0060] Example

[0061] 1. Materials and Methods

[0062] 1.1 Materials

[0063] Experimental samples: rhizosphere soil samples from tobacco in Hubei.

[0064] Required culture medium: NA medium, CAS identification medium.

[0065] Required tobacco variety: K326.

[0066] 1.2 Methods

[0067] 1.2.1 Isolation and culture of strains

[0068] On August 15, 2022, rhizosphere soil samples of tobacco plants with bacterial wilt were collected. 1 g of soil sample was weighed, added to 10 mL of physiological saline (0.85%, NaCl), spread on NA medium, and cultured at 28 ° C for 48-72 h. According to the growth characteristics of the colony, such as color, size, degree of bulge, transparency, hardness, and whether the edge is regular, a single colony was picked, and the picked single colony was three-zoned on the NA medium and purified three times to obtain a pure culture strain.

[0069] 1.2.2 Identification of strains

[0070] (1) Use a 10 μL pipette tip to pick up the purified bacterial moss and place it in a 2 mL centrifuge tube. Add 100 μL of 1 × TEBuffer (10 mmol / L Tris·HCl; 1 mmol / L EDTA; pH 8.0). Boil for 10 min and immediately place in a -20°C refrigerator overnight. Centrifuge at 12,000 rpm for 10 min and take the supernatant, which is the DNA of the strain.

[0071] (2) Using genomic DNA as a template, the bacterial 16S rDNA was amplified. The PCR system and reaction conditions are shown in Table 1. The PCR products were analyzed by agarose gel electrophoresis, and the obtained fragments were sequenced.

[0072] Table 1 PCR reaction system and reaction

[0073]

[0074] Note: Bacterial PCR primers (27F / 1492R: 5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID NO.1; 5'-GGTTACCTTGTTACGACTT-3', SEQ ID NO.2).

[0075] (3) The sequences obtained were compared on the EzBioCloud website (http: / / www.ezbiocloud.net / ), and a phylogenetic tree was constructed using MEGA 11 software to determine the taxonomic status of the strains.

[0076] 1.2.3 Strain preservation

[0077] The purified strain was streaked on a slant, and then 5 mL of sterile glycerol seed solution (20% glycerol) was added. The bacterial moss was vortexed down using a vortex mixer, divided into 2 mL cryovials, stored at -80 °C, and sent to the China General Microbiological Culture Collection Center (CGMCC) with the accession number CGMCC No. 28361.

[0078] 1.2.4 Determination of antibacterial ability

[0079] Pick a single colony, place it in NB medium, and culture it at 28 ℃ for 24 h. Use NB medium to adjust the OD of the bacterial solution 600 to 0.3. Pipette 10 µL of bacterial suspension (OD 600 =0.3), inoculated in the center of a 9 cm diameter NA solid culture medium, and after the bacterial solution was fully absorbed, the culture dish was placed in a 28 ℃ biochemical incubator and incubated upside down for 72 h. Ralstonia solanacearum ) RS10 was prepared into OD 600 = 0.3 bacterial suspension. Then, the pathogen suspension was sprayed onto the NA medium, and the culture dishes were transferred to a 28 ℃ constant temperature incubator. After inverted culture for 24 h, the size of the inhibition zone was measured and the antibacterial ability of the strain was calculated.

[0080] 1.2.5 Determination of siderophore production capacity

[0081] CAS identification medium: 20% sucrose solution 10 mL / L, 10% acid hydrolyzed casein 30 mL / L, 1 mmol / L CaCl2 1 mL / L, 1 mmol / L MgSO4 20 mL / L, agar 15 g / L, slowly add 50 mL of phosphate buffer and CAS dye solution at about 60℃, sterilize at 121℃ high temperature and high pressure for 20 min; CAS dye solution: CAS (chrome azure) 1 mmol / L, FeCl3 0.1 mmol / L, HDTMA (hexadecyltrimethylammonium bromide) 4 mmol / L; phosphate buffer: Na2HPO4·12H2O 24.27 g / L, NaH2PO4·2H2O 5.905 g / L, KH2PO4 0.75 g / L, NH4Cl 2.50 g / L, NaCl 1.25 g / L, pH 6.8, diluted 10 times when used.

[0082] 10 μL of OD 600 Place the bacterial suspension with NA = 0.3 in the center of the CAS identification medium, transfer the plate to a 28°C constant temperature incubator and continue observing. The appearance of a yellow halo indicates that the strain has the ability to produce siderophore.

[0083] 1.2.6 Effects on tobacco seed germination

[0084] Tobacco seeds (K326) were soaked in 15% H2O2 for 10 min, soaked in 75% ethanol for 30 s, and washed three times with sterile water. The strain was inoculated into NB liquid medium, cultured overnight at 28°C and 180 rpm, centrifuged at 8000 rpm for 5 min, the cells were collected, the supernatant was discarded, and the suspension was resuspended in sterile water to adjust the OD value of the bacterial suspension. 600 =0.3; after disinfection, tobacco seeds were soaked in the adjusted bacterial suspension for 30 min, and control tobacco seeds were soaked in sterile water for 30 min; double-layer sterilized filter paper was spread in the culture dish and moistened with 2 mL sterile water; 100 tobacco seeds were evenly dotted on the filter paper, cultured at 28℃, the filter paper was kept moist, and the seed germination was recorded.

[0085] 1.2.7 Greenhouse growth promotion test of strain Cas201

[0086] The strain was inoculated into NB liquid medium, cultured overnight at 28°C and 180 rpm, centrifuged at 8000 rpm for 5 min to collect the bacteria, discarded the supernatant, and resuspended with sterile water to adjust the concentration of the bacterial suspension to OD 600=0.3. 14 and 21 days after transplanting, each tobacco plant was irrigated with 20 mL of bacterial solution, while the control group was irrigated with 20 mL of sterile water. 28 days later, the differences in plant height, leaf length and leaf width between the treatment group and the control group were measured.

[0087] 2. Experimental Results

[0088] 2.1 Morphological identification of strains

[0089] After culturing on NA medium at 28°C for 24 h, the single colony of the strain was yellow, slightly transparent, with a moist surface and smooth edges ( Figure 1 ).

[0090] 2.2 Identification of strains

[0091] The 16s rDNA sequence was determined to obtain a gene sequence fragment of 1402 bp in length (SEQ ID NO.3). The sequence was compared with the EZBioCloud database, and Cas201 was similar to Chitinobacterium escens ( Chitinophaga eiseniae )DSM 22224 T and Chitinophaga oryzae ( Chitinophaga oryzae )1303 T The highest similarity is 99.71%. A phylogenetic tree was constructed based on the 16S rDNA sequences of Cas201 and other standard bacteria of the genus Chitinophaga ( Figure 2 ), Cas201 and Chitinophaga oryzae clustered together, and Cas201 was finally determined to be Chitinophaga oryzae.

[0092] 2.3 Determination of antibacterial ability of strains

[0093] By testing the effect of strain Cas201 on tobacco bacterial wilt ( Ralstonia solanacearum ) RS10's antibacterial ability. The results showed that strain Cas201 had an antibacterial effect on Ralstonia solanacearum, the pathogen of tobacco wilt. Ralstonia solanacearum ) RS10 has a significant antagonistic effect ( Figure 3 ), the inhibition rate against Ralstonia solanacearum was 65.71%.

[0094] 2.4 Strains producing siderophores and proteases

[0095] like Figure 4 As shown in A, a yellow halo was produced on the CAS plate, indicating that strain Cas201 can produce siderophore; Figure 4 As shown in B, a transparent circle appears on the protease plate, indicating that strain Cas201 is able to produce protease and utilize proteins in the environment.

[0096] 2.5 Effects of strains on tobacco seed germination

[0097] like Figure 5 As shown in the figure, after treatment with Cas201 bacterial suspension, the seed germination rate reached 97.22±2.78%, while the germination rate of tobacco seeds treated with sterile water (control) was only 86.11±2.78%. The Cas201 treatment group was significantly higher than the control group, indicating that treatment of tobacco seeds with Cas201 bacterial suspension can significantly promote the germination of tobacco seeds.

[0098] 2.6 Effect of strain Cas201 on tobacco growth promotion

[0099] like Figure 6 As shown in Table 2, the physiological indicators of strain Cas201 such as plant height, leaf length, and leaf width after root irrigation were significantly improved compared with the control group (p<0.01), with plant height increasing by about 0.91 cm, leaf length increasing by about 3.02 cm, and leaf width increasing by about 2.18 cm. This indicates that root irrigation with strain Cas201 suspension can promote tobacco plant growth and has a good growth-promoting effect.

[0100] Table 2 Growth-promoting effect of strain Cas201 on tobacco

[0101]

[0102] Note: "**" in the table indicates extremely significant difference ( p <0.01); “***” indicates extremely significant difference ( p <0.001).

[0103] In summary, this example uses 16S rDNA sequencing and phylogenetic tree construction to determine that strain Cas201 is a chitinophilous bacterium of rice ( Chitinophaga oryzae ), and the antibacterial ability test showed that strain Cas201 had an antibacterial effect on Ralstonia solanacearum ( Ralstonia solanacearum ) has a significant antagonistic effect, with an inhibition rate of 65.71%. At the same time, strain Cas201 has the ability to produce siderophores and proteases. Through tobacco seed germination experiments, it was found that strain Cas201 can promote the germination of Solanaceae crop seeds after treatment, and the seed germination rate can reach 97.22%; through growth promotion experiments, it was found that strain Cas201 can significantly promote plant growth after treatment, and significantly improve physiological indicators such as plant height, leaf length, and leaf width.

[0104] Strain Cas201 16S rDNA sequence

[0105] TACATGCAGTCGAGGGGCAGCATGGGTAGCAATACCGGATGGCGACCGGCAAACGGGTGCGGAACACGTACGCAACCTTCCTTCAAGCGGGGAATAGCCCAGAGAAATTTGGATTAATACCCCATAGGAATGTAGTCTCGCATGAGACAGCATTTAAAGATTTATCACTTGAAGATGGGCGTGCGTCTGATTAGGTAGTTGGTGAGGTAACGGCTCACCAAGCCGACGATCAGTAACTGGCGTGAGAGCGCGACCAGTCACACGGGCACTGAGACACGGG

[0106] CCCGACTCCTACGGGAGGCAGCAGTAAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCATGCCGCGTGGAGGATGAAGGCCCTCTGGGTTGTAAACTTCTTTTATTTGGGACGAAACACTTTCTTTCTAGAGAGCTTGACGGTACCAGATGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGACTTGTAAGTCCGTGGTGAAATCTCCGAGC

[0107] (SEQ ID NO.3)

[0108] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. A strain of Chitinobacterium oryzae ( Chitinophaga oryzae )Cas201, the strain was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on September 5, 2023, and its biological deposit number is CGMCC No.28361.

2. A bacterial agent, characterized in that: The bacterial agent contains the rice chitinophore as claimed in claim 1 ( Chitinophaga oryzae )Cas201.

3. The bacterial agent according to claim 2, characterized in that The bacterial agent contains a carrier.

4. The rice chitinophage bacteria according to claim 1 ( Chitinophaga oryzae ) Application of Cas201 in any one or more of the following: (a) inhibiting plant pathogens; (b) suppressing plant diseases; (c) promoting plant seed germination; (d) promoting plant growth; (e) production of siderophores and proteases; The plant pathogen is Ralstonia solanacearum; the plant disease is tobacco bacterial wilt; and the plant is tobacco.

5. The use according to claim 4, characterized in that The promoting of plant growth is specifically manifested in increasing the plant height, leaf length and leaf width.

6. Use of the bacterial agent according to any one of claims 2 to 3 in any one or more of the following: (a) inhibiting plant pathogens; (b) suppressing plant diseases; (c) promoting plant seed germination; (d) promoting plant growth; (e) production of siderophores and proteases; The plant pathogen is Ralstonia solanacearum; the plant disease is tobacco bacterial wilt; and the plant is tobacco.

7. The use according to claim 6, characterized in that The promoting of plant growth is specifically manifested in increasing the plant height, leaf length and leaf width.

8. A method for preventing and controlling tobacco bacterial wilt, characterized in that: The method comprises treating tobacco plants with the chitinophore bacteria ( Chitinophaga oryzae ) Cas201 or the bacterial agent described in any one of claims 2-3 is sprayed or root irrigated.

9. A method for promoting the growth of tobacco plants, characterized in that: The method comprises treating tobacco plants with the chitinophore bacteria ( Chitinophaga oryzae ) Cas201 or the bacterial agent described in any one of claims 2-3 is sprayed or root irrigated.

10. A method for promoting tobacco seed germination, characterized in that: The method comprises treating tobacco seeds with the chitinophore of claim 1 ( Chitinophaga oryzae ) Cas201 or the bacterial agent described in any one of claims 2-3 is soaked.

Images