Application of OsBI-1 gene in improving resistance to rice bacterial blight

Abstract

The present invention provides an application of a rice OsBI-1 gene, or a protein encoded by the rice OsBI-1 gene, or a recombinant vector or host bacteria or an expression cassette containing the coding region of the rice OsBI-1 gene in regulating the heading period of rice, and / or regulating plant tillering, and / or regulating rice leaf senescence, and / or regulating rice resistance to bacterial blight pathogen. The present invention first discovered that overexpression and knockout of the OsBI-1 gene in rice both enhance the resistance of transgenic strains to bacterial blight pathogens, and that overexpression and knockout of the OsBI-1 gene can both delay the heading period of rice, that overexpression of the rice OsBI-1 gene increases rice tillering, and that knockout reduces rice tillering, and that overexpression of the rice OsBI-1 gene delays rice leaf senescence, and has important application prospects in the future in terms of transgenic improvement of plant resistance to bacterial blight pathogens, and regulation of plant growth, etc.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to application of OsBI-1 gene in improving resistance to rice bacterial blight. Background Art

[0002] rice( Oryza sativa L.), commonly known as rice, is a herbaceous plant of the Gramineae family and one of the important food crops. In the process of rice cultivation, the prevention and control of various diseases and pests is an important link. There are many types of rice diseases, among which rice blast, sheath blight and bacterial leaf blight have a large occurrence area, strong epidemicity and serious harm, and are important diseases in the process of rice cultivation. Among them, bacterial leaf blight mainly infects leaves, and yellow-green spots appear at the tip and edge of the leaves, and then develop into pale and yellow-brown stripes along the veins, and finally turn gray and die. Diseased plants are prone to lodging, and the rate of unfruitful rice ears increases. The pathogen spreads over the winter on seeds and diseased rice straw. The disease begins to develop during the tillering stage. It is easy to break out when it is hot and humid, stormy, waterlogged in rice fields and too much nitrogen fertilizer. Therefore, it is of great significance to cultivate highly disease-resistant rice varieties. Overexpression or inhibition of specific genes can make transgenic plants resistant to diseases, which is an important way to cultivate disease-resistant varieties. Our study found that overexpression and knockout of the OsBI-1 gene in rice Zhonghua 11 could enhance the resistance of transgenic lines to bacterial blight. Summary of the invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide an application of an OsBI-1 gene in improving resistance to rice bacterial blight.

[0004] The present invention provides the use of rice OsBI-1 gene, or protein encoded by rice OsBI-1 gene, or recombinant vector or host bacteria or expression box containing the coding region of rice OsBI-1 gene in regulating rice heading period, and / or regulating plant tillering, and / or regulating rice leaf senescence, and / or regulating rice resistance to bacterial blight pathogen.

[0005] Among them, the coding region sequence of rice OsBI-1 gene is shown as SEQ ID No.1.

[0006] Wherein, the original vector of the recombinant vector can adopt the vector commonly used in the field of gene recombination, such as virus, plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector adopts pCAMBIA1300s vector, etc., but it should be understood that the present invention can also adopt other plasmids, or viruses, etc.

[0007] Preferably, the original vector of the recombinant vector is the pCAMBIA1300s expression vector, and the rice OsBI-1 gene coding region is located between the KpnI and XbaI restriction endonuclease sites of the pCAMBIA1300s expression vector.

[0008] Among them, overexpression of rice OsBI-1 gene delayed the heading period of rice, and knockout of rice OsBI-1 gene delayed the heading period of rice.

[0009] Among them, overexpression of rice OsBI-1 gene increased rice tillering, while knockout of rice OsBI-1 gene reduced rice tillering.

[0010] Among them, overexpression of rice OsBI-1 gene delayed rice leaf senescence.

[0011] Among them, overexpression of the OsBI-1 gene increased the resistance of rice to bacterial blight, and knockout of the OsBI-1 gene increased the resistance of rice to bacterial blight.

[0012] The present invention discovers for the first time that both overexpression and knockout of the OsBI-1 gene in rice enhance the resistance of transgenic strains to bacterial blight pathogens, and both overexpression and knockout of the OsBI-1 gene can delay the heading period of rice. Overexpression of the rice OsBI-1 gene increases rice tillering, while knockout reduces rice tillering. Furthermore, overexpression of the rice OsBI-1 gene delays rice leaf senescence. The invention has important application prospects in the future in improving the resistance of transgenic plants to bacterial blight pathogens, regulating plant growth, and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 is the positive monoclonal colony PCR test result, M is the marker, No. 3 is the negative control, and the rest are samples to be tested.

[0014] Figure 2 The results of hygromycin positive test for overexpressed transgenic plants. Using the hygromycin gene, a resistance marker of transgenic materials, as a template, positive detection PCR primers were designed, and the product size was 750bp. After PCR amplification, the presence of bands was transgenic positive, and the absence of bands was transgenic negative.

[0015] Figure 3 The phenotype of transgenic rice.

[0016] Figure 4 The bar graph shows the phenotype and lesion length of transgenic rice in disease resistance testing. WT is the wild type Zhonghua 11, and OE-1 and OE-2 are transgenic rice.

[0017] Figure 5The results of sequencing of gene knockout transgenic plants are shown in Figure 2. The gene knockout plants have a 308 bp deletion, with partial bases of the first intron and the second exon knocked out.

[0018] Figure 6 The bar graph shows the phenotype and lesion length of OsBI-1 knockout rice in disease resistance testing. WT is the wild type Zhonghua 11, and Mutant is the OsBI-1 knockout rice. DETAILED DESCRIPTION

[0019] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0020] Example 1: Cloning of Rice OsBI-1 Gene

[0021] PCR amplification was performed using reverse transcribed cDNA from rice leaves as a template and primers OsBI-1-F: GGTACCATGGACGCCTTCTACTCGA and OsBI-1-R: TCTAGAAGACCTCTTCTTCCTCTTCTTCTCC. The PCR reaction system is shown in Table 1. The amplification procedure is:

[0022]

[0023] The PCR products were recovered by running gel and sequenced to obtain the rice OsBI-1 gene. The coding region sequence of the rice OsBI-1 gene is shown in SEQ ID No. 1 (excluding the stop codon tga).

[0024] Table 1 PCR reaction system for amplifying OsBI-1 gene

[0025] Reagents volume PrimeSTAR Max Premix (2×) 25 μL Upstream primer (10 μM) 1 μL Downstream primer (10 μM) 1 μL Template (100ng / ul) 1 μL <![CDATA[ddH2O]]> Up to 50 μL

[0026] Example 2: OsBI-1 gene overexpression function detection

[0027] 1. Overexpression vector construction

[0028] pCAMBIA1300s overexpression vector digestion

[0029] Vector: 5 μg, KpnI + XbaI: 1 μL each, incubate at 37°C for 4 h, run on gel and perform gel recovery.

[0030] Ligation of PCR product and vector (5 μL system) PCR product: 1.5 μL, pCAMBIA1300s vector: 2.5 μL, T4 ligase: 1 μL, T4 ligase Buffer: 1 μL.

[0031] Ligation was carried out at 16°C overnight.

[0032] The ligation product was transformed into Escherichia coli, cultured overnight in LA medium containing kanamycin resistance, and single clones were selected for colony PCR positive detection ( Figure 1 ). Except for the negative control No. 3, which showed the target band at 750bp, the other samples to be tested can show the target band of 750bp. The positively identified monoclonal bacteria were selected and the plasmid (pCAMBIA1300s-OsBI-1 plasmid) was extracted.

[0033] 2. Infection of rice

[0034] The pCAMBIA1300s- OsBI-1 plasmid was transformed into Agrobacterium competent cells EHA105 and the infection engineered bacteria were obtained by bacterial liquid PCR. The infection operation was as follows:

[0035] (1) Use rice Zhonghua 11 callus as receptor and soak for 30 min.

[0036] (2) Remove the Agrobacterium bacterial solution, absorb excess water from the callus with sterile absorbent paper, and air dry it on a clean bench for 3-4 hours.

[0037] (3) Place the dried callus on co-cultivation medium and culture in the dark at 19°C for 3 days.

[0038] (4) Wash the co-cultured callus in a large triangular flask with sterile ddH2O2 for 2-3 times, leaving it to stand for 5-10 minutes until it becomes clear. Finally, pour out the sterile distilled water, add sterile distilled water containing 500 mg / L Cn, and shake at 200 rpm for 30 minutes.

[0039] (5) Place the callus on sterile absorbent paper, absorb the surface moisture, and dry it naturally on a clean bench for 3-4 hours. Use S1 medium, add 400μl CN+250μl Hn+5ml 50% glucose, and culture in a dark culture room for 20 days. The composition of S1 medium is as follows:

[0040] N 6max Stock solution (10X) 25ml

[0041] N 6min Stock solution (100X) 2.5ml

[0042] Vitamin (100X) 2.5ml

[0043] Fe 2+ -EDTA stock solution (100X) 2.5ml

[0044] 2,4-D stock solution (1 mg / ml) 0.625 ml

[0045] CH 0.15g

[0046] Sucrose 7.5g

[0047] Agarose 1.75g

[0048] pH: 6.0

[0049] Make up to 250 ml of water.

[0050] (6) Select dry calli that are not contaminated by Agrobacterium from the S1 medium and place them sparsely on the S2 medium. Add 300μl CN + 250μl Hn + 5ml 50% glucose (inoculate 25 to 30 calli per plate). Culture in the dark for 20 days. The composition of the S2 medium is as follows:

[0051] N 6max Stock solution (10X) 25ml

[0052] N 6min Stock solution (100X) 2.5ml

[0053] Vitamin (100X) 2.5ml

[0054] Fe 2+ -EDTA stock solution (100X) 2.5ml

[0055] 2,4-D stock solution (1 mg / ml) 0.625 ml

[0056] CH 0.15g

[0057] Sucrose 7.5g

[0058] Agarose 1.75g

[0059] pH: 6.0

[0060] Make up to 250 ml of water.

[0061] (7) Pick up small pieces of resistant callus that are light yellow, dense, dry, and attached to the culture medium. Pick only one resistant callus from each group, and put only three resistant callus in each bottle of differentiation medium. The composition of the differentiation medium is:

[0062] MSmax stock solution (10X) 100ml

[0063] MSmin stock solution (100X) 10ml

[0064] Vitamin (100X) 10ml

[0065] Fe2+-EDTA stock solution (100X) 10ml

[0066] 6-BA 2.0ml

[0067] KT 2.0ml

[0068] IAA 0.2ml

[0069] NAA 0.2ml

[0070] Sucrose 30g

[0071] CH 1g

[0072] Phytagel 3g

[0073] pH: 6.0

[0074] Refill to 1000ml.

[0075] (8) After 40 days of light culture, when seedlings (about 5-10 cm in height) have differentiated, proceed to the next step. During this period, any bacteria that have grown must be removed in a timely manner.

[0076] (9) Pull out the differentiated seedlings from the differentiation medium, take only one seedling from a piece of callus, cut off the excessive leaves and roots with scissors, and transplant them into rooting tubes, with 1 to 2 seedlings in each rooting tube.

[0077] (10) Cultivate in a light culture room for 15 to 20 days.

[0078] (11) After the transformed seedlings have grown vigorously, remove the sealing film of the rooting tube, add a certain amount of tap water, and harden the seedlings under light for 4-7 days.

[0079] 3. DNA extraction and PCR detection of transgenic plants

[0080] The leaves of the transgenic seedlings with good growth were collected and the leaf DNA was extracted. With this as a template, hygromycin primers (F: 5'-ATTTGTGTACGCCCGACAGT-3', R: 5'-GGATATGTCCTGCGGGTAAA-3') were designed for PCR detection. The product size was 750bp. After PCR amplification, the ones with bands were transgenic positive, and the ones without bands were transgenic negative. Transgenic positive plants were obtained ( Figure 2 ).

[0081] The transgenic rice plants were observed and their phenotypes were recorded with a camera. The results showed that the heading period of transgenic rice was delayed and the tillering of the plants increased, but the increase was not significant compared with the wild type ( Figure 3 and Table 2 ), and leaf senescence was delayed.

[0082] Table 2 Plant tillering statistics

[0083] wild type Knockout Overexpression 7 4 10 10 5 9 8 4 11 7 6 8 8 5 10 9 5 11 7 6 10 8 4 9 8 5 11 9 6 10 Mean 8.1 5 9.9

[0084] 4. Disease resistance testing of genetically modified rice

[0085] The bacterial blight pathogen PXO99 was cultured on potato culture medium. The bacterial spots were scraped off during the logarithmic growth period and dispersed and shaken in a triangular flask filled with tap water. The OD value was adjusted to 0.6. Immediately inoculated in the field. Inoculation method: At about 6 o'clock in the afternoon, dip the scissors into the bacterial solution in the triangular flask and cut the leaves 1.5-2cm from the top of the rice sword leaf. Cut one leaf from each plant and inoculate ten plants in total. After about 10-14 days, the length of the lesions was counted, and the difference in the length of the lesions indicated the resistance of different materials to the bacterial blight pathogen. The results are as follows Figure 4 As shown in Table 3, the lesion length of the control group was significantly longer than that of the transgenic rice, and there was a significant difference between the two, indicating that overexpression of the OsBI-1 gene improved the resistance of rice to bacterial blight.

[0086] Table 3 Results of disease resistance test of transgenic rice (spot length, unit: cm)

[0087] WT OE-1 OE-2 9.1 2.3 2.5 8.9 3.6 2.7 10.3 3.1 2.4 11.2 2.9 2.5 9.8 2.5 3.6 8.5 2.4 3.4 8.1 3.2 3.3 9.9 3.1 2.3 8.4 3.5 2.8 Mean 9.355555556 2.955555556 2.833333333 Error value 1.017486009 0.469337595 0.479583152

[0088] Example 3: Functional detection after OsBI-1 gene knockout

[0089] 1. Obtaining OsBI-1 gene knockout rice plants

[0090] According to the cDNA sequence of the OsBI-1 gene, select the first intron and the second exon part of the bases for CRISPR knockout. And carry out the construction of CRISPR knockout vector and genetic transformation, construct the gene knockout vector to obtain the rice plant with OsBI-1 gene knockout. You can use the Cas9 vector for monocot gene knockout in the paper "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants" (2015), refer to the experimental method of the paper, construct the gene knockout vector to obtain the rice plant with OsBI-1 gene knockout. The Crispr primers are:

[0091] U3 promoter primer pair: 5′-ggcACGTCGCCTTGAACATCGGC-3′ and 3′-GCCGATGTTCAAGGCGACGCAAA-5′;

[0092] U6 promoter primer pair: 5′-gccGATTCGTAGCTGTCTATGAA-3′ and 3′-TTCATAGACAGCTACGAATCAAA-5′.

[0093] 2. DNA extraction and sequencing of OsBI-1 gene knockout rice plants

[0094] The leaves of the tissue culture seedlings with good growth were collected and the leaf DNA was extracted. Using this as a template, the genome sequencing primers (F: 5'-TCCACGCACACTTTGCGTGC-3', R: 5'-CCACGAGCATCATGTCACAC-3') were designed for PCR amplification. The PCR products were recovered and sequenced. The gene knockout plants had a 308 bp deletion, and the first intron and the second exon were partially deleted ( Figure 5 ).

[0095] The OsBI-1 knockout rice plants were observed and the phenotypes of the transgenic rice plants were recorded with a camera. The results showed that the heading period of OsBI-1 knockout rice was delayed and the tillering of the plants was reduced ( Figure 3 and Table 2).

[0096] 3. Disease resistance detection of rice plants with OsBI-1 gene knockout

[0097] The bacterial blight pathogen PXO99 was cultured on potato culture medium. The bacterial spots were scraped off during the logarithmic growth period and dispersed and shaken in a triangular flask filled with tap water. The OD value was adjusted to 0.6. Inoculation was immediately carried out in the field. Inoculation method: At about 6 o'clock in the afternoon, the scissors were dipped into the bacterial solution in the triangular flask and the leaves were cut 1.5-2cm from the top of the rice sword leaf. One leaf was cut for each plant, and a total of 10-12 plants were inoculated. After about 10-14 days, the length of the lesions was counted, and the difference in the length of the lesions indicated the resistance of different materials to the bacterial blight pathogen. The results are shown in Figure 6 As shown in Table 4 (BI-1CR is a rice plant with OsBI-1 gene knockout), the lesion length of the rice plant with OsBI-1 gene knockout was significantly lower than that of the control group, and there was a significant difference between the two, indicating that knockout of OsBI-1 gene improved the resistance of rice to bacterial blight.

[0098] Table 4 Disease resistance test results of rice plants with OsBI-1 gene knockout (spot length, unit: cm)

[0099] BI-1CR WT 1.6 11.2 3.3 7.1 4.2 13.2 4.5 13.4 2.1 4.2 3.1 7.3 3.2 10.6 4.9 9.5 4.1 15.2 5.2 11.8 3.7 5.3 Mean 3.766667 10.35 Error value 1.167229 3.370542

[0100] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Use of rice OsBI-1 gene, or protein encoded by rice OsBI-1 gene, or recombinant vector or host bacteria or expression cassette containing rice OsBI-1 gene coding region in regulating tillering of rice plants and / or regulating resistance of rice to bacterial blight pathogen, wherein: Overexpression of the rice OsBI-1 gene increases rice tillering, while knocking out the rice OsBI-1 gene reduces rice tillering. Overexpression of the OsBI-1 gene increases rice resistance to bacterial blight, while knocking out the OsBI-1 gene increases rice resistance to bacterial blight. The coding region sequence of the rice OsBI-1 gene is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The original vector of the recombinant vector is the pCAMBIA1300s expression vector, and the rice OsBI-1 gene coding region is located between the two restriction endonuclease sites of KpnI and XbaI of the pCAMBIA1300s expression vector.

Images