TsRNA marker for diagnosing and evaluating myocardial aging, kit and application of tsRNA marker

Abstract

The invention discloses a tsRNA marker for diagnosing and evaluating myocardial aging, a kit and application of the tsRNA marker. The application of the tsRNA marker comprises one or more of the following applications: A1) application in preparation of a product for diagnosing myocardial aging; a2) in preparation of products for screening myocardial aging; a3) in preparation of a product for treating myocardial aging; a4) in preparation of myocardial aging condition assessment products; a5) in preparation of products for identifying and distinguishing myocardial aging and other heart diseases; the tsRNA marker is tsRNA-5006c-LysCTT, and the nucleotide sequence of the tsRNA marker is as shown in SEQ ID No. 1. The expression quantity of the tsRNA marker provided by the invention in the plasma of a myocardial aging patient is obviously increased compared with that of a healthy control person, which indicates that tsRNA-5006c-LysCTT has the potential to be used as the myocardial aging biomarker.

Description

Technical Field

[0001] The invention relates to a marker for diagnosing myocardial aging, specifically a tsRNA marker, and also relates to a kit for detecting the tsRNA marker and application thereof, belonging to the field of medical molecular diagnosis. Background Art

[0002] Cardiovascular disease (CVD) is a major threat to the health of the elderly, especially in people over 65 years old, where CVD causes 40% of all deaths. With age, the cost of treatment and hospitalization for cardiovascular disease can increase by more than 200%. Therefore, studying the molecular mechanisms of myocardial aging is crucial to addressing the aging population. Although the molecular biology research fields of cardiovascular disease and aging have traditionally been relatively independent, there has been a recent increase in attention to changes in the cardiovascular system that occur with aging, and improving the ability to diagnose myocardial aging at an early stage has become a key direction in cardiovascular disease research.

[0003] tRNA-derived small RNAs (tsRNAs), including tRNA fragments (tRFs) and stress-induced derivative small RNAs (tiRNAs), are non-coding small RNAs produced by processing and splicing by specific nucleases under adverse conditions such as starvation, oxidative stress, and hypoxia. The development of high-throughput sequencing technology has revealed the important roles of tsRNAs in inhibiting cell apoptosis, epigenetic regulation, intercellular communication, translation, and gene expression regulation. The abnormal expression of tsRNAs in a variety of diseases and their role in pathological processes have been found. Although the research in the field of tsRNA is still in its early stages, its potential in the treatment of non-neoplastic diseases deserves further exploration. In particular, the role of tsRNAs in cardiovascular system diseases and their possibility as potential biomarkers of myocardial aging have not been fully studied.

[0004] At present, there is a lack of clinical examination and testing methods to accurately assess myocardial aging, especially in the early stages of the disease when cardiac function has not yet been significantly weakened, making it difficult to conduct effective intervention. Therefore, there is an urgent need to discover new biomarkers of myocardial aging. Myocardial cells release abnormal metabolites during early changes, and these metabolites, if verified, can be used as biomarkers for disease diagnosis. At present, the biomarkers commonly used in clinical practice are mainly protein markers, such as cardiac troponin (cTn), creatine kinase isoenzyme (BNP), and myoglobin (Myo). Non-coding RNA, especially tsRNA, may reflect changes earlier due to its position upstream of transcription. With the advancement of detection technology, the detection of tsRNA has become more feasible, making it potentially a new biomarker for the diagnosis and evaluation of myocardial aging. Summary of the invention

[0005] The primary technical problem to be solved by the present invention is to provide a new application of tsRNA markers. The tsRNA markers can be used to prepare substances for diagnosis, screening, disease assessment and differentiation of myocardial aging and other heart diseases.

[0006] Another technical problem to be solved by the present invention is to provide a kit for detecting the tsRNA marker. The kit can be used for diagnosis, screening, disease assessment and differentiation of myocardial aging and other heart diseases.

[0007] The third technical problem to be solved by the present invention is to provide a primer for detecting the tsRNA marker. The primer can be used for diagnosis, screening, disease assessment and differentiation of myocardial aging and other heart diseases.

[0008] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0009] According to a first aspect of an embodiment of the present invention, there is provided an application of a substance for detecting a tsRNA marker, comprising one or more of the following applications:

[0010] A1) Application in the preparation of products for diagnosing myocardial aging;

[0011] A2) Application in the preparation of products for screening myocardial aging;

[0012] A3) Application in the preparation of products for treating myocardial aging;

[0013] A4) Application in the preparation of myocardial aging condition assessment products;

[0014] A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases;

[0015] The t sRNA marker is t sRNA-5006c-LysCTT, and the nucleotide sequence is shown in SEQ ID No.1.

[0016] The "product" can be a product for diagnosing myocardial aging by detecting the expression level of tsRNA-5006c-LysCTT through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

[0017] In the above application, the expression of tsRNA-5006c-LysCTT was significantly upregulated in the plasma samples of patients with myocardial aging; the expression level of tsRNA-5006c-LysCTT in healthy people was significantly lower than that in patients with myocardial aging.

[0018] Preferably, the substance is a reagent for detecting the expression level of tsRNA-5006c-LysCTT, or a reagent for specifically recognizing tsRNA-5006c-LysCTT, or a reagent for detecting the content of tsRNA-5006c-LysCTT.

[0019] Preferably, the substance is a substance for detecting tsRNA-5006c-LysCTT, specifically the following a), b) or c)

[0020] a) primers for detecting or specifically recognizing t sRNA-5006c-LysCTT;

[0021] b) a reagent set containing the reagent described in a);

[0022] c) A kit containing a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0024] According to a second aspect of an embodiment of the present invention, a kit for detecting a tsRNA marker is provided, wherein the kit comprises one or more of the following applications:

[0025] A1) Application in the preparation of products for diagnosing myocardial aging;

[0026] A2) Application in the preparation of products for screening myocardial aging;

[0027] A3) Application in the preparation of products for treating myocardial aging;

[0028] A4) Application in the preparation of myocardial aging condition assessment products;

[0029] A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases;

[0030] The t sRNA marker is t sRNA-5006c-LysCTT, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying t sRNA-5006c-LysCTT, or a reagent for detecting the expression amount of t sRNA-5006c-LysCTT.

[0031] The kit provided by the present invention can be used to detect the expression of the tsRNA-5006c-LysCTT characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject, and then the probability of myocardial aging in the subject can be determined based on the information of up-regulation or down-regulation of the gene expression, thereby realizing the diagnosis of myocardial aging.

[0032] The kit provided by the present invention may include appropriate packaging and instructions for use in the method disclosed by the present invention. Preferably, the detection kit provided by the present invention is a nucleic acid detection kit, including reagents required for RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR). The kit may further include appropriate buffer and polymerase, and may also include control primers and / or probes.

[0033] Preferably, the reagent for detecting or specifically identifying t sRNA-5006c-LysCTT is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0034] According to a third aspect of an embodiment of the present invention, a primer for detecting a tsRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0035] A1) Application in the preparation of products for diagnosing myocardial aging;

[0036] A2) Application in the preparation of products for screening myocardial aging;

[0037] A3) Application in the preparation of products for treating myocardial aging;

[0038] A4) Application in the preparation of myocardial aging condition assessment products;

[0039] A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases;

[0040] The primers are primers for detecting the expression amount of t sRNA-5006c-LysCTT or specifically identifying t sRNA-5006c-LysCTT.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The tsRNA-5006c-LysCTT provided by the present invention can be used as a new biomarker for the diagnosis of myocardial aging. In a clinical validation test, the expression level of tsRNA-5006c-LysCTT in the plasma of patients with myocardial aging was significantly increased compared with that in the healthy control group. This finding suggests the potential application value of tsRNA-5006c-LysCTT in the diagnosis of myocardial aging.

[0044] (2) The efficacy of tsRNA-5006c-LysCTT in diagnosing myocardial aging was evaluated through ROC curve analysis, and the results showed that it had good sensitivity and specificity, thus confirming the good diagnostic efficacy of tsRNA-5006c-LysCTT as a marker of myocardial aging.

[0045] (3) There was a positive correlation between the expression levels of β-galactosidase, a marker of cardiomyocyte aging, and tsRNA-5006c-LysCTT, which further supported the close connection between tsRNA-5006c-LysCTT and cell aging and indicated its effectiveness in the diagnosis of cardiomyocyte aging.

[0046] (4) In clinical experiments, BNP in patient plasma was positively correlated with the expression of tsRNA-5006c-LysCTT. Since BNP is a peptide hormone synthesized by the heart when the ventricular wall is dilated or stretched, it can reflect the compensatory function of the heart. Therefore, the positive correlation between tsRNA-5006c-LysCTT and BNP levels indicates that changes in tsRNA-5006c-LysCTT plasma levels can reflect the severity of myocardial aging.

[0047] (5) In in vitro cellular experiments, AC16 cardiomyocytes treated with D-galactose (D-gal) showed an increase in the expression of tsRNA-5006c-LysCTT, indicating that the level of tsRNA-5006c-LysCTT increases during cardiomyocyte aging, providing a cellular and molecular basis for tsRNA-5006c-LysCTT as a biomarker for the diagnosis of cardiomyocyte aging. In the D-gal-induced cell aging model, knocking down tsRNA-5006c-LysCTT alleviated cell aging, which further confirmed the important role of tsRNA-5006c-LysCTT in the diagnosis and potential treatment of cardiomyocyte aging.

[0048] (5) The results of immunofluorescence experiments showed that after knocking down tsRNA-5006c-LysCTT, the expression of β-galactosidase in AC16 cardiomyocytes induced by D-gal was reduced. This result indicates that knocking down tsRNA-5006c-LysCTT can reduce the degree of cell senescence induced by D-gal, thus confirming at the cellular level that tsRNA-5006c-LysCTT may be a target for the treatment of myocardial aging. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The volcano plot of tsRNA expression differences between aged cardiomyocytes AC 16 and normal controls obtained by sequencing;

[0050] Figure 2 To determine the content of tsRNA-5006c-LysCTT in the plasma of patients with myocardial aging and normal controls by qRT-PCR;

[0051] Figure 3 The ROC curve of t sRNA-5006c-LysCTT in diagnosing patients with myocardial aging;

[0052] Figure 4 The relationship between the positive ratio of senescence marker β-galactosidase and the expression level of t sRNA-5006c-LysCTT in cardiomyocytes induced by D-gal;

[0053] Figure 5 is the relationship between plasma BNP level and t sRNA-5006c-LysCTT expression;

[0054] Fig. 6A The relative expression level of tsRNA-5006c-LysCTT after AC16 was transfected with tsRNA-5006c-LysCTT small interfering RNA;

[0055] Figure 6B This is a graph of the relative expression level of mRNA after tsRNA-5006c-LysCTT knockdown;

[0056] Fig. 7A This is a graph showing the expression of P21 mRNA in D-gal-induced cardiomyocytes after siRNA knockdown of tsRNA-5006c-LysCTT in AC16;

[0057] Figure 7B This is a graph showing the expression of D-gal-induced cardiomyocyte IL-1β mRNA after tsRNA-5006c-LysCTT knockdown in AC16;

[0058] Figure 8 The expression of tsRNA-5006c-LysCTT and BNP after tsRNA-5006c-LysCTT knockdown and control group AC16 treated with D-gal;

[0059] Fig. 9 This is a diagram showing the expression of β-gal, a marker of cell senescence, after knocking down tsRNA-5006c-LysCTT, using β-gal staining under a light microscope. DETAILED DESCRIPTION

[0060] The present invention is further described below in conjunction with specific examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described contents can be applied to the method provided by the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0061] The research and development process and ideas of the present invention: First, total RNA was extracted from 3 naturally aged AC16 cardiomyocytes and 3 normal control cells, and sent to Guangzhou Epigenetics Company for tRNA-derived small RNA (tsRNA) sequencing. Through sequencing, tsRNAs with significant differences in expression levels (Fold change ≥ 2.0, P value < 0.05) were screened. Subsequently, the quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology was used to measure the content of the top 10 tsRNAs in the sequencing results in the patient's plasma, and the first tsRNA with a significantly increased expression level, namely tsRNA-5006c-LysCTT, was selected for subsequent experiments. In order to further verify the association between the expression level of tsRNA-5006c-LysCTT and myocardial aging, the inventors once again verified the expression of tsRNA-5006c-LysCTT in in vitro experiments through experiments at the cellular level to evaluate its potential as a biomarker for myocardial aging. The specific experimental data are as follows:

[0062] Example 1 Screening and correlation study of tsRNA markers of myocardial aging

[0063] 1. Sample and Methods:

[0064] 1.1 Clinical samples:

[0065] Venous blood samples were collected from two groups of people of different ages from the General Hospital of the Chinese People's Liberation Army between 2020 and 2023. One group included 50 patients aged between 60 and 90 years old who were excluded from heart disease at admission, and the other group included 50 healthy subjects aged no more than 30 years old. These samples were divided into two groups: a control group (young healthy subjects) and an aging group (older patients) for the purpose of measuring the levels of tRNA-derived small RNA (tsRNA) in plasma in subsequent experiments in order to evaluate the potential of tsRNA as a biomarker of myocardial aging.

[0066] Inclusion criteria:

[0067] (1) Inpatients aged 60 years or younger and younger than 90 years;

[0068] (2) Healthy subjects aged ≤30 years old;

[0069] (3) Complete blood sample information is available.

[0070] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe blood system diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and cardiomyopathy.

[0071] 1.2 Methods:

[0072] 1.2.1 Plasma extraction: Human peripheral blood was collected using EDTA anticoagulant blood collection tubes, centrifuged at 2500 g for 15 min, and the upper plasma was collected into a 2 ml sterile tube and stored in a -80 °C refrigerator.

[0073] 1.2.2 RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR):

[0074] Total RNA was extracted from AC16 using RNA Spectrum Total RNA Kit (DP419, TIANGEN, Beijing, China).

[0075] (1) RNA extraction

[0076] Total RNA extraction from plasma samples followed the instructions for use of TRIZOL Reagent (Invitrogen). The steps were as follows: First, 1 ml of TRIZOL Reagent (Invitrogen) was added to the plasma sample, followed by 200 μl of chloroform, and the sample was thoroughly mixed by shaking for 20 seconds, and then allowed to stand at room temperature for 10 minutes to promote phase separation. Next, the sample was centrifuged at 13,000 revolutions per minute (rpm) at 4°C for 15 minutes, the supernatant was carefully aspirated, 800 μl of isopropanol was added, gently inverted to mix, and allowed to stand at -20°C for 1 hour to precipitate RNA. The precipitated RNA was collected by centrifugation at 13,000 rpm and 4°C for 15 minutes, and the supernatant was discarded. After that, 1 ml of 75% ethanol was added to gently wash the RNA precipitate, and centrifuged again at 13,000 rpm and 4°C for 5 minutes. After removing the supernatant, the RNA precipitate was blown dry. Finally, an appropriate amount of enzyme-free water was added and solubilized at 65°C for 10 minutes to detect the absorbance (OD) value and concentration of RNA. The obtained RNA samples were stored at -80°C for subsequent experiments.

[0077] (2) RNA reverse transcription to cDNA

[0078] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A).

[0079] (3) Reverse transcription of tsRNA:

[0080] Operate on ice, 20 μL per reaction system, as shown in Table 1:

[0081] Table 1

[0082]

[0083]

[0084] (4) Reverse transcription of mRNA:

[0085] Operate on ice, 20 μL per reaction system, as shown in Table 2:

[0086] Table 2

[0087]

[0088] The reaction procedure was: 37°C for 45 min, 85°C for 5 min, and maintain at 4°C.

[0089] (5) qRT-PCR

[0090] Design tsRNA primer sequences according to the tsRNA primer design principles.

[0091] The cDNA obtained by reverse transcription reaction was diluted 1:10 and subjected to the following qRT-PCR reaction.

[0092] Operate on ice, 20 μL per reaction system, as shown in Table 3:

[0093] Table 3

[0094]

[0095] After the reaction solution is mixed, the Real-time PCR instrument reaction program is performed as follows:

[0096] Stage 1: 95°C for 2 minutes;

[0097] Stage 2: 35 cycles, each cycle consisting of 94°C for 5 seconds and 60°C for 1 minute;

[0098] Stage 3: 95℃ for 15 seconds, 60℃ for 1 minute, then back to 95℃ for 5 seconds.

[0099] GAPDH was used as an internal reference gene in the experiment to quantitatively analyze the relative levels of each mRNA, and the expression levels of these mRNAs were expressed by calculating the relative ratios.

[0100] 1.2.3 tsRNA sequencing analysis:

[0101] Total RNA was extracted from three naturally aged AC16 cardiomyocytes and three normal control cells and sent to Guangzhou Epigenetics for tRNA-derived small RNA (tsRNA) sequencing. Through sequencing analysis, tsRNAs with significant differences in expression (Fold change ≥ 2.0, P value < 0.05) were screened. Subsequently, the quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology was used to measure the content of the top 10 tsRNAs in the patient's plasma, and the first tsRNA with significantly increased expression was selected for subsequent experiments. Figure 1 The volcano plot of the difference in tsRNA expression between aged cardiomyocytes AC16 and normal control cells is shown, while the top 10 upregulated tsRNAs are listed in Table 4 , among which the tsRNA with the highest expression level was selected for further study.

[0102] Table 4 Top 10 upregulated tsRNAs obtained from sequencing data

[0103]

[0104] 1.2.4ROC curve drawing:

[0105] The receiver operating characteristic (ROC) curve is a tool for displaying the performance of diagnostic markers by drawing a graph of true positive rate (sensitivity) versus false positive rate (1-specificity). The curve is calculated by a series of cutoff values ​​based on the measurement results of the test group and the control group, and the corresponding sensitivity and specificity are respectively calculated, and these calculated points are connected into a line on the coordinate graph to form a ROC curve. In the present invention, the 9.1.0 version of GraphPad Prism software is used to draw the ROC curve to evaluate the diagnostic ability of a specific biomarker to a disease.

[0106] 1.2.5 Statistical analysis:

[0107] For variables that conformed to normal distribution, t-test and analysis of variance were used; for variables that did not conform to normal distribution, Mann-Whitney U test and Kruskal-Wal lis test were used for analysis. All statistical analyses were performed using R software (version 3.4.2) and GraphPad Prism software (version 8.00). The results of biological replicates of the experiment were presented in the form of single data points on the bar graph. In terms of statistical significance, a P value of less than 0.05 was considered to indicate a significant difference.

[0108] 2. Verification results:

[0109] like Figure 2 As shown in the study, by applying quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology, the researchers measured the content of specific tRNA-derived small RNA (tsRNA-5006c-LysCTT) in the plasma of patients with myocardial aging. The experimental results showed that compared with the healthy control group, the expression level of tsRNA-5006c-LysCTT in the plasma of patients with myocardial aging was significantly increased. This finding indicates that tsRNA-5006c-LysCTT may serve as a potential biomarker for myocardial aging.

[0110] Figure 3 The efficacy of tsRNA-5006c-LysCTT in diagnosing myocardial aging was demonstrated through receiver operating characteristic (ROC) curve analysis. The ROC curve showed that tsRNA-5006c-LysCTT exhibited high sensitivity and specificity in distinguishing myocardial aging patients from healthy controls, thus confirming its potential as a diagnostic marker for myocardial aging with good diagnostic efficacy. Example 2: Further verification of tsRNA-5006c-LysCTT by β-galactosidase staining experiment The relationship between myocardial aging

[0111] 1. Experimental purpose:

[0112] After a limited number of divisions, normal cells enter an irreversible state of growth arrest, a state known as cellular senescence. A characteristic of senescent cells is the increased activity of senescence-associated β-galactosidase (SA-β-Gal). β-galactosidase is usually a lysosomal enzyme, but its activity increases in senescent cells. Taking advantage of this phenomenon, cellular senescence can be detected by β-galactosidase staining experiments, in which senescent cell-specific β-galactosidase can catalyze galactoside substrates to produce blue products. Therefore, when blue deposits appear in the cell cytoplasm, this indicates that the cells express high levels of β-galactosidase, so that these blue cells or tissues can be clearly observed under an optical microscope. The β-galactosidase staining experiment is the gold standard for determining whether cells are senescent in cell molecular experiments.

[0113] 2. Experimental methods:

[0114] AC16 cardiomyocytes cultured in 6-well plates were stained using the galactosidase staining kit (C0602) provided by Beyotime to detect cell senescence. First, the cell culture medium was removed and the cells were gently washed once with phosphate buffered saline (PBS). Next, 1 ml of β-galactosidase staining fixative was added to fix the cells at room temperature for 15 minutes. After the fixation process, the cells were washed three times with PBS again, each wash lasting 3 minutes. After that, the PBS was removed and 1 ml of the pre-prepared staining working solution was added to each well. The staining working solution was mixed with the following components: 10 μl of β-galactosidase staining solution a, 10 μl of β-galactosidase staining solution b, 930 μl of β-galactosidase staining solution c, and 50 μl of X-Gal solution. The 6-well plate was sealed with plastic wrap to prevent the liquid from evaporating and incubated overnight at 37°C. Note that this incubation process is not suitable for incubators containing carbon dioxide. Finally, the cells were observed under ordinary light microscopy to detect β-galactosidase activity and thus assess the senescence state of the cells.

[0115] 3. Statistical analysis methods:

[0116] Cells stained blue under an optical microscope were regarded as positive cells, and the number of positive cells per 100 cells was randomly selected to count and determine the positive cell ratio (%). The positive cell ratio of each sample was correlated with tsRNA-5006c-LysCTT.

[0117] 4. Experimental results:

[0118] like Figure 4 As shown, the senescence markers of cardiomyocytes, β-galactosidase and

[0119] The expression levels of tsRNA-5006c-LysCTT have a good correlation, and the two are positively correlated. This shows that there is a clear relationship between tsRNA-5006c-LysCTT and cell senescence, and it has good diagnostic efficacy.

[0120] Example 3 Experiment on the relationship between BNP and tsRNA-5006c-LysCTT expression

[0121] B-type natriuretic peptide (BNP) and its precursor N-terminal pro-B-type natriuretic peptide (NT-proBNP) are biomarkers for assessing cardiac function and play a key role in the diagnosis, differential diagnosis, severity assessment and prognosis of heart failure. In healthy adults, the normal concentration of BNP should be less than 100 ng / L. With age and decreased cardiac function, BNP levels will gradually increase, and levels above 100 ng / L are usually considered abnormal. According to the expert consensus of the American College of Cardiology (ACC) in 2004, when the BNP level is less than 100 ng / L, the possibility of heart failure is very small, and its negative predictive value is 90%; if the BNP level is higher than 500 ng / L, the possibility of heart failure is very high, and the positive predictive value is also 90%. Therefore, BNP levels within the normal range can help exclude the diagnosis of acute heart failure.

[0122] The distribution of BNP in the heart is mainly concentrated in the left and right atria, and the BNP content in the right atrium is about three times that of the left atrium. In contrast, the BNP content in the ventricles is less. This is because the BNP precursor is not stored in the ventricles, but when the ventricular wall tension increases, it quickly stimulates the expression of the BNP gene, resulting in a large amount of BNP synthesis and secretion into the blood. Therefore, the increase in BNP levels in plasma reflects cardiac systolic or diastolic dysfunction, the heart cannot effectively discharge venous return blood, and BNP is produced when the ventricles are stretched, and this increase shows a dynamic change pattern.

[0123] Myocardial aging is a process in which the function and efficiency of the heart muscle gradually decrease with age. This process may lead to weakened heart pumping function and poor blood circulation, thereby increasing the release of BNP. Therefore, BNP levels are an important indicator for assessing myocardial aging and heart failure risk.

[0124] like Figure 5 As shown, the researchers analyzed the relationship between BNP and tsRNA-5006c-LysCTT expression in patient plasma. The results showed that tsRNA-5006c-LysCTT was positively correlated with BNP levels. This finding suggests that the level of tsRNA-5006c-LysCTT in plasma can reflect the severity of myocardial aging. Therefore, tsRNA-5006c-LysCTT has the potential to be used as a biomarker for assessing the risk of myocardial aging and the severity of the disease.

[0125] Example 4 In vitro experimental cell level verification of the relationship between the expression of tsRNA-5006c-LysCTT and myocardial aging relation

[0126] 1. Materials and Methods

[0127] 1.1 Cell culture:

[0128] Human cardiomyocyte cell line AC16 was obtained from Wuhan Pronocell Biotechnology Co., Ltd. The cell culture conditions were RPMI-1640 medium supplemented with 10% fetal bovine serum, and the culture process was carried out at 37°C and 5% carbon dioxide to simulate the in vivo environment and ensure the normal growth and function of the cells.

[0129] In the siRNA knockdown experiment, the siRNA reagent used was provided by Thermo Fisher Scientific. The experimental operation followed the instructions provided by the manufacturer, and when the cells reached about 70% confluence, siRNA was added to the culture system. After 24 hours of induction treatment, the knockdown effect of siRNA was evaluated by quantitative reverse transcription polymerase chain reaction (qRT-PCR) technology to ensure the efficiency and specificity of gene knockdown.

[0130] 1.2 Cell senescence induction treatment:

[0131] Cardiomyocytes AC16 were exposed to 10 mM D-galactose (D-gal) to induce cellular senescence. D-galactose, as an effective inducer of aging models, has a stronger glycation effect than glucose and can induce oxidative stress response. At specific concentrations, D-galactose can induce cytotoxic reactions and aging-related biological changes, including the promotion of increased levels of B-type natriuretic peptide (BNP) secreted by AC16 cardiomyocytes. After 24 hours of D-galactose treatment, the expression levels of intracellular tsRNA and the concentration of BNP in the culture supernatant were measured by comparing the cardiomyocytes of the experimental group with those of the untreated control group to evaluate the cell senescence effect induced by D-galactose.

[0132] 1.3 qRT-PCR method is the same as in Example 1.

[0133] 1.4 Determination of human plasma BNP:

[0134] The human creatine kinase isozyme (BNP) ELISA assay kit (product number ZC-34224) provided by Zhuocai Biotechnology was used to quantitatively determine the BNP level in the sample. The experimental steps are as follows: First, add 100 μl of the standard or the sample to be tested to each microplate well, and equilibrate the kit at room temperature for 30 minutes. Subsequently, take out the required strips from the aluminum foil bag, and seal the unused strips with a ziplock bag and store them at 4°C. Add 50 μl of different concentrations of standards to the standard wells, add 50 μl of the sample to be tested to the sample wells, and do not add anything to the blank wells. In all wells except the blank wells, add 100 μl of the detection antibody labeled with horseradish peroxidase (HRP), seal the reaction wells with a sealing film, and then incubate in a water bath or incubator at 37°C for 60 minutes. After incubation, discard the liquid in the wells and pat dry with absorbent paper. Then add 350 μl of washing solution to each well, let it stand for 1 minute, shake off the washing solution, pat dry with absorbent paper, repeat this washing step for a total of 5 times, or use a plate washer for washing. After washing, add 50 μl of substrate A and B to each well and incubate at 37°C in the dark for 15 minutes. After incubation, add 50 μl of stop solution to each well and measure the absorbance (OD) value of each well at a wavelength of 450 nm using an ELISA reader within 15 minutes.

[0135] 1.5 Immunofluorescence staining of β-galactosidase experiment:

[0136] First, the cells were incubated with 4% paraformaldehyde at room temperature for 10 minutes, and then washed three times with ice-cold phosphate buffered saline (PBS). Next, the cells were incubated with PBS-Tween20 (PBST) solution containing 1% bovine serum albumin (BSA) for 30 minutes to block nonspecific antibody binding. Subsequently, a specific β-galactosidase antibody (Cat. No. ab 136775) provided by abcam was added and incubated at 4°C for 6 hours. After the incubation, the solution was poured out and the cells were washed three times with PBS for 5 minutes each. At room temperature, the cells were incubated with a fluorescently labeled secondary antibody (Cat. No. ab 150113) provided by abcam for 1 hour. The secondary antibody was pre-dissolved in a solution containing 1% BSA and protected from light throughout the process. After incubation, the secondary antibody solution was poured out and the cells were washed three times with PBS under light-protected conditions for 5 minutes each. Finally, the cell nuclei were stained with DAPI solution, and the fluorescence intensity of β-galactosidase was observed under a fluorescence microscope.

[0137] 2. Experimental results:

[0138] Fig. 6A It can be seen that after AC16 was transfected with tsRNA-5006c-LysCTT small interfering RNA (siRNA), the expression of tsRNA-5006c-LysCTT was reduced. Figure 6BIt is shown that the total amount of mRNA remains unchanged after tsRNA-5006c-LysCTT knockdown, indicating that the transfection was successful and subsequent experiments were completed on this basis.

[0139] Fig. 7A and Figure 7B After AC16 was transfected with tsRNA-5006c-LysCTT small interfering RNA (siRNA), the mRNA expression of two cell senescence markers, P21 and IL-1β, in AC16 cells was detected. P21 is a cell senescence protein marker, and IL-1β is a cell senescence secretion-related phenotype. It can be seen that after knocking down tsRNA-5006c-LysCTT, Fig. 7A P21 and Figure 7B The expression of IL-1β mRNA in the myocardium was reduced, indicating that knocking down tsRNA-5006c-LysCTT can slow down cell senescence, and tsRNA-5006c-LysCTT is expected to be a therapeutic target for myocardial aging.

[0140] Figure 8 The expression of tsRNA-5006c-LysCTT and BNP in AC16 knocked down tsRNA-5006c-LysCTT and the control group was treated with D-gal. The results showed that D-gal induced aging can cause the expression of tsRNA-5006c-LysCTT to increase, while the expression level of BNP decreased after knocking down tsRNA-5006c-LysCTT. This is the cellular and molecular basis for tsRNA-5006c-LysCTT to diagnose the severity of myocardial aging and as a target for the treatment of myocardial aging.

[0141] Fig. 9 Immunofluorescence experiments were used to measure the expression of β-galactosidase (a marker of cell senescence) in the knockdown tsRNA-5006c-LysCTT and control group AC16 after treatment with D-gal. Fig. 9 As can be seen in the control group with D-gal, the blue substrate of β-galactosidase staining increased, and the cell senescence was more serious. After knocking down tsRNA-5006c-LysCTT, the expression of β-galactosidase decreased. This result shows that after knocking down tsRNA-5006c-LysCTT, the degree of cell senescence induced by D-gal was reduced, achieving the effect of antagonizing senescence, which shows that tsRNA-5006c-LysCTT may be used as a therapeutic target for myocardial aging at the cellular level.

[0142] The above experimental results revealed a significant correlation between tsRNA-5006c-LysCTT and myocardial aging, indicating that it can be used as a new biological marker for myocardial aging. In the D-galactose (D-gal)-induced myocardial cell aging model, the expression level of tsRNA-5006c-LysCTT was upregulated, and ROC curve analysis further confirmed that tsRNA-5006c-LysCTT had high accuracy and reliability in diagnosing myocardial aging patients. These findings indicate that tsRNA-5006c-LysCTT may be involved in regulating the D-gal-induced myocardial cell aging process. Therefore, tsRNA-5006c-LysCTT is not only expected to become a diagnostic biomarker for myocardial aging, but also a potential target for future myocardial aging treatment.

[0143] Example 5 The sequence, primer and kit composition involved in the present invention

[0144] The myocardial aging marker tsRNA-5006c-LysCTT provided by the present invention has a nucleotide sequence as shown in SEQ ID No.1.

[0145] SEQ ID No.1: CGGCTAGCTCAGTCGGTAGAGCATGG

[0146] The primer pair for specifically recognizing tsRNA-5006c-LysCTT provided by the present invention comprises an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3:

[0147] SEQ ID No.2: GCCCGGCTAGCTCAGTCGGTAG

[0148] SEQ ID No.3: AGCATGGGACTCTTAATCCCAC

[0149] The kit provided by the present invention comprises:

[0150] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primer, RNase-free pure water, SYBR probe II (Tl i RNaseH Plus) (2x), PCR primer (F+R) (10uM), ROX Reference dye (50x).

Claims

1. Application of a substance for detecting tsRNA markers, Features Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging condition assessment products; A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases; The tsRNA marker is tsRNA-5006c-LysCTT, and the nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, Features: The product is a product for diagnosing myocardial aging by detecting the expression level of tsRNA-5006c-LysCTT through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use according to claim 1, Features: The substance is a reagent for detecting the expression amount of tsRNA-5006c-LysCTT, or a reagent for specifically identifying tsRNA-5006c-LysCTT, or a reagent for detecting the content of tsRNA-5006c-LysCTT.

4. The use according to claim 1, Features: The substance is a substance for detecting tsRNA-5006c-LysCTT, including the following a), b) or c) a) a primer for detecting or specifically recognizing tsRNA-5006c-LysCTT; b) a reagent set containing the reagent described in a); c) A kit containing a) or b).

5. The use according to claim 4, Features: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

6. A kit for detecting tsRNA markers, Features Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging condition assessment products; A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases; The tsRNA marker is tsRNA-5006c-LysCTT, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying tsRNA-5006c-LysCTT, or a reagent for detecting the expression amount of tsRNA-5006c-LysCTT.

7. The kit according to claim 6, Features: The reagent for detecting or specifically identifying tsRNA-5006c-LysCTT is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

8. A primer for detecting a tsRNA marker, Features Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging condition assessment products; A5) Application in the preparation of products for identifying and distinguishing myocardial aging from other heart diseases; The primers are primers for detecting the expression amount of tsRNA-5006c-LysCTT or specifically identifying tsRNA-5006c-LysCTT. The tsRNA marker is tsRNA-5006c-LysCTT, and the nucleotide sequence is shown in SEQ ID No.

1.

9. The primer according to claim 8, Features: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

Images