Ionizable lipid compound capable of activating STING signal channel and application thereof

Abstract

The invention relates to the field of biological medicine, and provides an ionizable lipid compound capable of activating an STING signal channel and application of the ionizable lipid compound. The invention specifically provides an ionizable lipid compound which has a natural adjuvant effect and can induce generation of I-type interferon gene expression by activating an STING pathway, so that APC activation and antigen presentation are promoted, and the immune response ability of a body is enhanced. And a method for synthesizing the ionizable lipid compound from a ketone compound, an amine compound and an isonitrile compound. The invention also provides an application of the ionizable lipid compound in preparation of lipid nanoparticles, the lipid nanoparticles formed by the ionizable lipid can deliver nucleic acid molecules into cells, the expression level of nucleic acid drugs in vivo can be significantly improved, and the immune response of the organism can be stimulated. Ionizable lipid compound having the structure shown: # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to a class of ionizable lipid compounds that can activate the STING signaling pathway and applications thereof. Background Art

[0002] Lipid nanoparticles (LNPs) are widely used in the field of drug delivery, and among them, ionizable lipids are not only excellent protein / peptide antigen carriers, but also a new type of immune adjuvant that can directly activate antigen presenting cells and enhance vaccine-induced immune responses. Among them, the cGAS-STING pathway, which is widely favored by adjuvant research and development scientists, has a unique role in coordinating innate immunity and adaptive immunity. The stimulator of interferon genes (STING) is a very important regulatory factor in natural immune response and anti-tumor response. After being stimulated by pathogen-associated pattern molecules (PAMPs) or damage-associated pattern molecules (DAMPs), STING activates the transcription of type I interferons (IFNs) and proinflammatory cytokines, initiating natural immune responses. In the anti-tumor response, IFNs stimulate the proliferation of anti-tumor T cells and directly kill tumor tissues, and the interferon gene (CXCL10) plays a very important role in recruiting tumor-reactive T cells. Therefore, activating the STING signaling pathway has been shown to be a promising therapeutic approach to transform the tumor microenvironment, which can transform the "cold" tumor microenvironment in an immunosuppressive state into a "hot" tumor microenvironment in an immune-activated state.

[0003] At the same time, lipid nanoparticles (LNP) can be used to deliver mRNA, which is an important technical route for preparing mRNA vaccines. However, mRNA must be delivered to the cytoplasm and overcome obstacles such as endogenous RNase enzymes and cell membranes to achieve protein expression and produce the effect of the vaccine.

[0004] Therefore, it is of great practical significance to provide an ionizable lipid that has the dual functions of serving as a carrier to promote the translation and expression of mRNA in vivo and serving as an adjuvant to enhance the immune response of mRNA vaccines. In particular, ionizable lipids that have the function of activating the STING pathway have great clinical application value and commercial prospects. Summary of the invention

[0005] In view of this, the present invention provides the following technical solutions:

[0006] The present invention provides a class of ionizable lipid compounds having the structure shown:

[0007]

[0008] or a pharmaceutically acceptable salt or a tautomer thereof;

[0009] Among them, R1 is selected from one of ethyl and tert-butyl groups; R2 and R3 are independently selected from C12-C20 straight-chain hydrocarbon groups, and the straight-chain hydrocarbon group includes one of a straight-chain polyolefin group containing a branch, a straight-chain alkane group containing a disulfide bond, a straight-chain alkane group containing an ester bond, a straight-chain alkane group containing a carbonate chain, a straight-chain alkane group containing an ether bond, and a straight-chain alkane group containing a thioester bond.

[0010] A method for preparing the above-mentioned ionizable lipid compound comprises the following steps: dissolving a ketone compound, an amine compound and an isonitrile compound in an organic solvent, reacting at 10 to 60° C. for 12 to 72 hours, and separating and purifying to obtain an ionizable lipid compound;

[0011] The amine compound is:

[0012] The isonitrile compound is: or

[0013] In the above preparation method, the ketone compound includes any one of the following compounds:

[0014]

[0015]

[0016] The use of the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method in the preparation of lipid nanoparticles.

[0017] A drug combination for preparing lipid nanoparticles, comprising a lipid carrier and a bioactive component;

[0018] The lipid carrier comprises the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method, and the lipid carrier also comprises any one or more of neutral lipids, structural lipids and PEG-lipids.

[0019] In the above-mentioned drug combination, the molar ratio of the ionizable lipid compound: neutral lipid: structural lipid: PEG-lipid is 0-50: 5-50: 10-60: 0.1-10. Preferably, the molar ratio is 10-40: 5-10: 30-50: 0.5-5.

[0020] In the above-mentioned drug combination, the biologically active ingredients include one or more of nucleic acid molecules, proteins, polypeptides and small molecule drugs.

[0021] The use of the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method in the preparation of vaccines.

[0022] The use of the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method in the preparation of drugs for promoting immune effects.

[0023] Beneficial effects:

[0024] The present invention provides a new class of ionizable lipid compounds, which have a natural adjuvant effect. By activating the STING pathway, the compound induces the expression of type I interferon genes, thereby promoting APC activation and antigen presentation, thereby enhancing the body's immune response ability, and can be used in the preparation of clinical vaccines.

[0025] The compounds provided by the present invention can also be used as lipid delivery carriers for nucleic acids, which can significantly increase the expression level of nucleic acid drugs in vivo and have good development prospects and clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : Technical roadmap for synthesis of ST-L01.

[0027] Figure 2 :ST-L01H 1 -NMR spectra and mass spectra.

[0028] Figure 3 :ST-L12H 1 -NMR spectra and mass spectra.

[0029] Figure 4 :ST-L22H 1 -NMR spectra and mass spectra.

[0030] Figure 5 :The results of the particle size and potential investigation of different lipid nanoparticles.

[0031] Figure 6 : In vivo bioluminescence results of mice of LNP formulation of Fluc-mRNA prepared with ionizable lipid ST-L01.

[0032] Figure 7 : In vitro bioluminescence results of various organs of mice of LNP preparations of Fluc-mRNA prepared with ionizable lipid ST-L01.

[0033] Figure 8 : In vivo bioluminescence results of mice of Fluc-mRNA LNP formulation prepared with ionizable lipid ST-L22.

[0034] Fig. 9 : In vitro bioluminescence results of various organs of mice of Fluc-mRNA LNP preparations prepared with ionizable lipid ST-L22.

[0035] Fig.10: qPCR results of STING pathway activation in ST-L01 and ST-L22.

[0036] Fig.11 : The results of ST-L01 promoting DC activation.

[0037] Fig.12 : The results of ST-L22 promoting DC activation. DETAILED DESCRIPTION

[0038] The present invention provides a class of ionizable lipid compounds having the structure shown:

[0039]

[0040] or a pharmaceutically acceptable salt or a tautomer thereof;

[0041] Among them, R1 is selected from any one of ethyl and tert-butyl groups; R2 and R3 are independently selected from any one of branched straight-chain polyolefin groups, disulfide-bonded straight-chain alkane groups, ester-bonded straight-chain alkane groups, and carbonate-chain-containing straight-chain alkane groups.

[0042] Optional,

[0043] The branched linear polyolefin group has the structural formula:

[0044] The structural formula of the disulfide bond-containing straight-chain alkane group is: The structural formula of the straight chain alkane group containing an ester bond is: The linear alkane group containing carbonate chain has the following structural formula: The structural formula of the straight chain alkane group containing an ether bond is: The structural formula of the straight chain alkane group containing thioester bond is: Optionally, the above-mentioned ionizable lipid compound includes:

[0045]

[0046]

[0047]

[0048] A method for preparing the above-mentioned ionizable lipid compound comprises the following steps: dissolving a ketone compound, an amine compound and an isonitrile compound in an organic solvent, reacting at 10 to 60° C. for 12 to 72 hours, and separating and purifying to obtain an ionizable lipid compound;

[0049] The amine compound is:

[0050] The isonitrile compound is: or

[0051] Preferably, the molar ratio of the ketone compound, the amine compound and the isonitrile compound is 0.1-1.5:0.1-1.5:0.1-1.5.

[0052] Optionally, in the above preparation method, the ketone compound includes any one of the following compounds:

[0053]

[0054] A use of the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method in the preparation of lipid nanoparticles.

[0055] A drug combination for preparing lipid nanoparticles, comprising a lipid carrier and a bioactive component; the lipid carrier comprises the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method, and the lipid carrier also comprises any one or more of neutral lipids, structural lipids and PEG-lipids.

[0056] Preferably, in the above drug combination, the molar ratio of the ionizable lipid compound: neutral lipid: structural lipid: PEG-lipid is 0-50: 5-50: 10-60: 0.1-10. More preferably, the molar ratio is 10-40: 5-10: 30-50: 0.5-5.

[0057] Optionally, in the above-mentioned drug combination, the neutral lipids include: 1,2-distearoyl-sn-glyceryl-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glyceryl-3-phosphocholine (DPPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphoethanolamine (DPPE), 1,2-dimyristoyl-sn-glyceryl-3-phosphocholine (DMPC), 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine (DMPE), 1-palmitoyl-2-oleoyl-sn-glyceryl-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glyceryl-3-phosphocholine (DOPC), 2-dioleoyl-sn-glycerol-3-phospho-(1'-rac-glycerol) (DOPG), 1,2-dioleoyl-sn-glyceryl-3-phosphoethanolamine (DOPE) and sphingomyelin (SM) One or more. Preferably, the neutral lipid is DOPE.

[0058] Optionally, in the above-mentioned drug combination, the structural lipid comprises one or more of cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol and brassicasterol. Preferably, the structural lipid is cholesterol.

[0059] Optionally, in the above-mentioned drug combination, the PEG-lipid includes: 2-[(polyethylene glycol)-2000]-N,N-tetracosyl acetamide (ALC-0159), 1,2-dimyristoyl-sn-glyceromethoxy polyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterol glycerol (PEG-DSG), PEG-dipalmitoyl, PEG -dioleyl, PEG-distearyl, PEG-diacylglyceramide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), PEG-phosphatidylethanolamine (PEG-PE), PEG-succinic diacylglycerol (PEG-SDAG), PEG-ceramide (PEG-cer), PEG dialkoxypropyl carbamate and PEG-1,2-dimyristoyloxypropyl-3-amine (PEG-c-DMA) One or more. Preferably, the PEG-lipid is PEG-DMG.

[0060] Optionally, in the above-mentioned drug combination, the bioactive component includes one or more of nucleic acid molecules, proteins, polypeptides and small molecule drugs. Preferably, the bioactive component is negatively charged or hydrophobic. More preferably, the bioactive component is mRNA.

[0061] A use of the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method in the preparation of a vaccine. Preferably, the vaccine is an mRNA vaccine.

[0062] Use of the above-mentioned ionizable lipid compound or the ionizable lipid compound prepared by the above-mentioned method in the preparation of a drug for promoting immune effect. Preferably, the ionizable lipid compound acts as an adjuvant to activate the STING pathway, induce the expression of type I interferon genes, and thus promote APC activation and antigen presentation.

[0063] In the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art.

[0064] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0065] Example 1

[0066] Preparation of ionizable lipid compound (ST-L01), the synthesis process is as follows Figure 1 shown.

[0067] a) Synthesis of Compound I: Dissolve cyclohexanedione (60 mmol) in EtOH (100 mL), then add ethyl acrylate (66 mmol), K2CO3 (66 mmol), water (50 mL), react at 80°C, and monitor by TLC. After the reaction is completed, part of the ethanol is dried, and the pH is adjusted to neutral (pH = 7.0) with dilute hydrochloric acid (3 M), extracted with ethyl acetate, and the organic layers are combined, washed with saturated sodium chloride, and dried over anhydrous sodium sulfate. Remove the solvent under reduced pressure, and purify by column separation (200-300 mesh silica gel column, eluent is V DCM :V MeOH =10:1), 6.0 g of colorless liquid was obtained, with a yield of 47%. The synthesized product was dissolved in CDCl3 and 1 -NMR analysis of the product structure;

[0068] b) Synthesis of Compound II: Compound I (28 mmol) was placed in dilute hydrochloric acid (3 M, 100 mL) and reacted at 110°C with TLC monitoring. After the reaction was completed, the solvent was removed by distillation under reduced pressure. 4 g of brown solid was obtained with a yield of 70%. The synthesized product was dissolved in DMSO-D6 and precipitated by H 1 -NMR analysis of the product structure;

[0069] c) Synthesis of compound III: Compound II (3 mmol) was dissolved in DCM (20 mL), cooled to 0°C, geranylgeraniol (6.2 mmol), DMAP (1.2 mmol), EDCI (12 mmol) were added in sequence, stirred at room temperature, and monitored by TLC. After the reaction was completed, water was added to quench, extracted with ethyl acetate, the organic layers were combined, washed with saturated brine, dried over anhydrous sodium sulfate, the solvent was removed under reduced pressure, and purified by column separation (200-300 mesh silica gel column, eluent was V PE :V EA =10:1), 1.08 g of colorless liquid was obtained, with a yield of 48%. The synthesized product was dissolved in CDCl3 and 1 -NMR analysis of the product structure;

[0070] d) Synthesis of ionizable lipid compounds: tert-butyl isocyanoacetate (1 mmol), 2-(2-ethylpiperidin-1-yl)ethylamine (1 mmol), and compound III (1 mmol) were added in sequence, dissolved in DCM (2 mL), reacted at room temperature, and monitored by TLC. After the reaction was completed, the solvent was removed under reduced pressure, and the product was purified by column separation (200-300 mesh silica gel column, eluent was V DCM :V MeOH=20:1), 267 mg of colorless liquid was obtained, with a yield of 26%. The synthesized product was dissolved in CDCl3 and 1 -NMR was used to analyze the product structure.

[0071] ST-L01H 1 -NMR, HRMS see Figure 2 . 1 HNMR(400MHz,Chloroform-d)δ7.98(s,1H),5.30(q,J=7.0Hz,2H),5.08(s,6H),4.63-4.49(m,5H),3.46-2.80(m,3H) ,2.78-2.23(m,5H),2.13-1.91(m,26H),1.81-1.51(m,46H),1.48(s,10H),0.89-0.83(m,3H).HRMS(ESI)calcd.forC 65 H 107 N3O6[M+H + ]:1026.8233,found:1026.8232.

[0072] Example 2

[0073] The preparation of the ionizable lipid compound (ST-L12) was carried out by referring to the preparation method in Example 1, except that the geranylgeraniol in step c was replaced by the corresponding alcohol ester.

[0074] ST-L12 H 1 -NMR, HRMS see Figure 3 . 1 HNMR(400MHz,Chloroform-d)δ8.03(s,1H),4.55(s,1H),4.09-3.99(m,8H),3.47-3 .33(m,1H),3.11(s,1H),2.94(s,1H),2.62-2.47(m,1H),2.42-2.31(m,2H),2.27(t ,J=7.6Hz,4H),2.22-2.08(m,1H),1.82-1.69(m,4H),1.68-1.55(m,20H),1.49(s,9 H),1.47-1.34(m,8H),1.34-1.16(m,28H),0.92-0.83(m,9H).HRMS(ESI)calcd.for C 55 H 99 N3O 10 [M+H + ]:962.7403,found:962.7408.

[0075] Example 3

[0076] The preparation of the ionizable lipid compound (ST-L22) was carried out by referring to the preparation method in Example 1, except that tert-butyl isocyanoacetate in step d was replaced with ethyl isocyanoacetate.

[0077] ST-L22 H 1 -NMR, HRMS see Figure 4 . 1 HNMR(400MHz,Chloroform-d)δ7.43-7.33(m,1H),5.36-5.29(m,2H),5.10(s,6 H),4.57(dd,J=13.0,7.2Hz,5H),4.25(q,J=7.0Hz,2H),3.28-3.14(m,1H),3.1 2-2.99(m,1H),2.97-2.79(m,2H),2.58-2.44(m,1H),2.40-2.15(m,6H),2.14- 1.93(m,27H),1.74-1.49(m,46H),0.87(t,J=6.6Hz,3H).HRMS(ESI)calcd.forC 63 H 103 N3O6[M+H + ]:998.7920,found:998.7923.

[0078] Example 4

[0079] Preparation of lipid nanoparticles

[0080] Based on the ionizable lipid compounds prepared in Examples 1 to 3, firefly luciferase (Flu, GeneID: 116160065) was selected as the reporter gene marker mRNA, i.e., Fluc mRNA, and LNPs / mFluc (LNP loaded with Fluc mRNA) were prepared, and the formulation properties such as particle size, potential, and encapsulation efficiency were investigated to evaluate its formulation properties.

[0081] The preparation method of LNPs / mFluc is as follows:

[0082] (1) Solution preparation: Ionizable lipids, DOPE, cholesterol (Chol), and DMG-PEG2000 were dissolved in anhydrous ethanol at a molar ratio of 35:16:2.5:46.5 as the ethanol phase. At the same time, Fluc mRNA was dissolved in 50 mM (pH = 4) citric acid buffer solution as the aqueous phase.

[0083] (2) LNP preparation: The ethanol phase obtained in step (1) was mixed with the aqueous phase at a volume ratio of 1:3 using a microfluidic method, so that the mass ratio of ionizable lipid to mRNA was 10, and the initial LNPs / mFluc preparation was obtained. The flow rate of the ethanol phase was 3 mL / min, and the flow rate of the aqueous phase was 9 mL / min.

[0084] (3) Ultrafiltration: The LNPs / mFluc initial preparation obtained in step (2) was placed in a dialysis bag and dialyzed for 8 hours in a PBS buffer solution (prepared with RNase-free water) at pH = 7.4 to obtain an ethanol-free LNPs / mFluc preparation. The dialyzed preparation was ultrafiltered and concentrated through an ultrafiltration tube to obtain the LNPs / mFluc final preparation.

[0085] Investigation of the pharmaceutical properties of LNPs / mFluc:

[0086] Particle size, potential, and PDI determination: The particle size potential of LNPs / mFluc was determined using a Malvern laser particle size analyzer. A certain volume of the newly prepared LNPs / mFluc solution was diluted 10 times with PBS, and its particle size, potential, and PDI were determined using a Malvern laser particle size analyzer. Each sample was measured three times in parallel at a temperature of 25°C.

[0087] Encapsulation efficiency detection: The Quant-iTTM RiboGreenTM kit was used to detect the encapsulation efficiency of each LNPs / mFluc preparation.

[0088] Table 1 Parameters of nanoparticles formed by lipid nanoparticles encapsulating Fluc mRNA

[0089] Lipid Nanoparticles (LNP Formulations) Particle size (nm) PDI (Polydispersity Index) Encapsulation efficiency Potential (mV) ST-L01 101.07 0.01 99.4％ 1.45 ST-L12 223.00 0.09 90.0％ -9.99 ST-L22 103.70 0.14 99.2％ -1.79

[0090] The results are shown in Table 1. Figure 5 As shown, the average particle size of lipid nanoparticles ST-L01, ST-L12 and ST-L22 is 100-230 nm, the PDI is about 0.1, the particle size distribution is uniform, the encapsulation efficiency is above 90%, and the potential is -9.99 to 1.49 mV.

[0091] Example 5

[0092] In vivo expression of LNPs / mFluc

[0093] The LNPs / mFluc prepared in Example 5 was administered by intramuscular injection to investigate the ability of the LNPs / mFluc preparation system to express mRNA in vivo.

[0094] The LNP preparation containing 8 μg Fluc-mRNA was injected intramuscularly into female C57 mice aged 6 to 8 weeks and weighing 18 to 20 g, with 4 mice in each group. 6 hours after administration, 100 μL of substrate solution (30 mg / mL, fluorescein potassium salt) was injected intraperitoneally into the mice, and then the average radiation intensity (corresponding to the fluorescence expression intensity) of the protein expressed by the mRNA carried by the LNP in the mice was detected by IVIS small animal in vivo imaging. The results of mouse in vivo imaging detection are shown in Figure 6 and Figure 8 The mice were euthanized and their organs were precisely isolated: heart, liver, spleen, lung, kidney, leg, and lymph node. The bioluminescence intensity of each organ was detected in an IVIS instrument with an exposure time of 10 seconds. The results are shown in Figure 7 and Fig. 9 .

[0095] The results of the in vivo expression investigation experiment via intramuscular injection showed that the ionizable lipids of the present invention can promote higher intensity expression of mRNA in vivo, judging from the total bioluminescence in vivo after intramuscular injection; in addition, after intramuscular injection, LNP (ST-L01 / mFluc) can deliver mRNA to the inguinal and popliteal lymph nodes; after intramuscular injection, LNP (ST-L22 / mFluc) is mainly expressed locally in the muscle and almost not expressed in the liver; these advantages are conducive to the research and development of mRNA vaccines via intramuscular administration.

[0096] Example 6

[0097] Study on the immunomodulatory effect of ionizable lipids

[0098] When the STING pathway is activated, the expression of type I interferon (IFN-β) and interferon gene (CXCL10) is upregulated. The production of CXCL10 mRNA and IFN-β mRNA downstream of the STING pathway was detected by qPCR (quantitative polymerase chain reaction) to investigate the activation of the STING pathway by LNPs in lymph nodes in vivo.

[0099] (1) RNA extraction

[0100] ST-L01 and ST-L22 prepared in the above examples were used to prepare LNP / mOVA with mRNA encoding ovalbumin (OVA, GeneID: 396058) according to the method in Example 5. The LNP preparation containing 15 μg of OVA-mRNA was injected intramuscularly into female C57 mice aged 6 to 8 weeks and weighing 18 to 20 g, with 3 mice in each group. 24 hours after administration, the lymph nodes of the mice were collected into a six-well plate, and a small amount of RNA extraction reagent was added to prepare a tissue homogenate. 500 μL of RNA extraction reagent was added to each well and collected into a 1.5 mL RNase-free EP tube. Then 200 μL of water was added to it, mixed, and allowed to stand at room temperature for 5 minutes, and then centrifuged at 12000g for 15 minutes. After centrifugation, take 500μL of the upper layer into a new 1.5mL RNase-free EP tube, add an equal volume of isopropanol, mix by inversion, let stand at -20℃ for 20min, and centrifuge at 12000g for 10min. After centrifugation, discard the supernatant, add 75% ethanol, mix well, and centrifuge at 8000g for 5min. After centrifugation, discard the supernatant and wash again with 75% ethanol. After air drying at room temperature, add a certain volume of RNase free water to dissolve.

[0101] (2) Reverse transcription

[0102] The extracted RNA was transcribed into cDNA using the reverse transcription premix kit HiScript IIQ RT SuperMix for qPCR (+gDNAwiper).

[0103] (3) Quantitative polymerase chain reaction (qPCR)

[0104] The cDNA obtained by reverse transcription was mixed with relevant gene primers and SybrGreen for qPCR. The specific primers are shown in Table 2.

[0105] Table 2 Primer list

[0106] name Serial Number Sequence (5`→3`) GapdhF SEQ ID No.1 CGTGTTCCTACCCCCAATGT GapdhR SEQ ID No.2 GTGTAGCCCAAGATGCCCTT Cxcl10F SEQ ID No.3 CCAAGTGCTGCCGTCATTTTC Cxcl10R SEQ ID No.4 GGCTCGCAGGGATGATTTCAA FWf SEQ ID No.5 CTCCAGCTCCAAGAAAGGAC iF SEQ ID No.6 TGGCAAAGGCAGTGTAACTC

[0107] The experimental results are as follows Fig.10 As shown, compared with untreated mice, ST-L01 significantly induced the expression of CXCL10 mRNA, while ST-L22 induced the production of IFN-β mRNA. The results showed that ST-L01 and ST-L22 activated the STING pathway in the lymph nodes of mice in vivo.

[0108] Example 7

[0109] Evaluation of DC activation by ionizable lipids: When the STING pathway is activated, the expression of type I interferon (IFN-β) and interferon gene (CXCL10) is upregulated, thereby promoting DC cell activation and antigen presentation. The activated DC cells highly express CD40 and CD86 co-stimulatory molecules on their surface, so the expression of CD40 and CD86 can be detected by flow cytometry (FCM) to examine DC cell activation.

[0110] The specific process of DC activation detection by flow cytometry is as follows:

[0111] (1) Preparation of single cell suspension

[0112] The LNP / mOVA prepared in Example 7 was used as the experimental sample. The LNP preparation containing 15 μg OVA-mRNA was injected intramuscularly into female C57 mice aged 6 to 8 weeks and weighing 18 to 20 g, with 3 mice in each group. 24 hours after administration, the mouse lymph nodes were collected into a six-well plate, fully chopped, and resuspended in 3 mL DPBS. After the cell suspension was passed through a sieve, it was transferred to a 15 mL BD tube. After centrifugation at 1500 rpm for 3 minutes, the supernatant was discarded, and a certain volume of DPBS was added to prepare a single cell suspension.

[0113] (2) Antibody staining

[0114] Take out 1×10 6 / 100μL into the flow tube. Add 0.4μL zombie and stain at room temperature for 25min. After staining, add 1.5mL DPBS (containing 1% BSA) and mix well. Centrifuge at 1500rpm for 3min and discard the supernatant. Add 2μL Fc blocking agent and stain at 4℃ for 10min. Finally, add CD11c, CD40, and CD86 antibodies and stain at 4℃ for 30min. After staining, add 1.5mL DPBS (containing 1% BSA) and mix well. Centrifuge at 1500rpm for 3min and discard the supernatant.

[0115] (3) Flow cytometry

[0116] 0.5 mL of DPBS (containing 1% BSA) was added to the cell suspension obtained above, mixed well, and then detected using an Agilent flow cytometer.

[0117] The experimental results are as follows Fig.11 , Fig.12 As shown, compared with untreated mice, ST-L01 and ST-L22 increased the proliferation of DC cell surface CD40 and CD86. The results showed that ST-L01 and ST-L22 promoted the activation of DC cells in mice.

[0118] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An ionizable lipid compound, characterized in that: The compound has the structure shown: or a pharmaceutically acceptable salt or a tautomer thereof; Wherein, R1 is selected from any one of ethyl and tert-butyl groups; R2 and R3 are independently selected from C12-C20 straight-chain hydrocarbon groups; The straight-chain hydrocarbon group includes any one of a branched straight-chain polyolefin group, a disulfide-bonded straight-chain alkane group, an ester-bonded straight-chain alkane group, a carbonate-chain-containing straight-chain alkane group, an ether-bonded straight-chain alkane group, and a thioester-bonded straight-chain alkane group.

2. The method for preparing an ionizable lipid compound according to claim 1, wherein: The method comprises the following steps: dissolving a ketone compound, an amine compound and an isonitrile compound in an organic solvent, reacting at 10 to 60° C. for 12 to 72 hours, and separating and purifying to obtain an ionizable lipid compound; The amine compound is: The isonitrile compound is: or 3. The preparation method according to claim 2, characterized in that: The ketone compound includes any one of the following compounds:

4. Use of the ionizable lipid compound as claimed in claim 1 or the ionizable lipid compound prepared as claimed in claim 2 or 3 in the preparation of lipid nanoparticles.

5. A drug combination for preparing lipid nanoparticles, characterized in that: including lipid carriers and bioactive ingredients; The lipid carrier comprises the ionizable lipid compound as claimed in claim 1 or the ionizable lipid compound prepared as claimed in claim 2 or 3, and the lipid carrier further comprises any one or more of neutral lipids, structured lipids and PEG-lipids.

6. The pharmaceutical combination according to claim 5, characterized in that The molar ratio of the ionizable lipid compound: neutral lipid: structural lipid: PEG-lipid is 0-50: 5-50: 10-60: 0.1-10.

7. The pharmaceutical combination according to claim 6, characterized in that The molar ratio of the ionizable lipid compound: neutral lipid: structural lipid: PEG-lipid is 10-40: 5-10: 30-50: 0.5-5.

8. The pharmaceutical combination according to claim 5, characterized in that The bioactive components include one or more of nucleic acid molecules, proteins, polypeptides and small molecule drugs.

9. Use of the ionizable lipid compound according to claim 1 or the ionizable lipid compound prepared according to claims 2 and 3 in the preparation of vaccines.

10. Use of the ionizable lipid compound according to claim 1 or the ionizable lipid compound prepared according to claims 2 and 3 in the preparation of a drug for promoting immune effects.

Images