Application of moxidectin in preparation of medicine for preventing and treating rotavirus

Abstract

The invention belongs to the technical field of biology, and particularly discloses application of moxidectin in preparation of a medicine for preventing and treating rotavirus. Compared with the prior art, the invention discovers that the moxidectin can significantly inhibit RV replication, and discovers that the moxidectin not only inhibits transcriptional level expression of VP6 protein of rotavirus, but also can reduce the expression level of the VP6 protein. Therefore, moxidectin can be used for preventing or treating rotavirus.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to the application of moxidectin in preparing medicines for preventing and treating rotavirus. Background Art

[0002] Rotavirus (RV) belongs to the genus Rotavirus of the family Reoviridae and is one of the 15 genera of the family Reoviridae. Nearly 50 years ago, it was considered to be the main cause of acute gastroenteritis in infants and young children. Rotavirus is an important pathogen that causes diarrhea in a variety of young animals and infants, causing 130 million children to be infected and more than 200,000 deaths each year, and causing significant losses to animal husbandry production. Currently, the rotavirus vaccines known to have been pre-certified by the World Health Organization (WHO) are: human-bovine rotavirus reassortant pentavalent vaccine RotaTeqTM, human rotavirus attenuated live vaccine RotarixTM, Rotavac vaccine and Rotasil vaccine. However, the above vaccines have problems in terms of cost and effectiveness, resulting in limited protection. There is currently no clinically approved specific anti-rotavirus therapeutic drug. Therefore, the development of a new antiviral drug is of great significance for the control and treatment of rotavirus.

[0003] Moxidectin, chemically named [6R, 23E, 25S(E)]-5-O-demethyl-28-deoxy-25-(1,3-dimethyl-1-butenyl)-6,28-epoxy-23-(methoxyimino)milbemycin. Developed by Wyeth (a subsidiary of Pfizer) and the World Health Organization (WHO), it is a macrolide anthelmintic antibiotic approved for the treatment of human onchocerciasis. Moxidectin is effective against parasites and has been shown to be effective against strongyloidiasis, filariasis, soil-transmitted helminthiasis, trichinosis, and scabies. In addition, studies have shown that moxidectin has antiviral activity against some viruses, such as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and H9 influenza virus. However, it is unclear whether moxidectin has an antiviral effect on rotavirus. Therefore, there is an urgent need to study moxidectin-based drugs for the prevention and treatment of rotavirus. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides the use of moxidectin in preparing a drug for preventing and treating rotavirus.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0006] One of the purposes of the present invention is to provide the use of moxidectin as the sole active ingredient in the preparation of a drug for preventing and treating rotavirus.

[0007] A second object of the present invention is to provide a drug for preventing and treating rotavirus, comprising moxidectin.

[0008] Furthermore, the drug for preventing and treating rotavirus also contains a pharmaceutically acceptable carrier and / or excipient.

[0009] Furthermore, the dosage form of the drug is one of tablets, sprays, granules, capsules, oral liquids, injections, and suspensions.

[0010] Compared with the prior art, the present invention finds that moxidectin can significantly inhibit RV replication, and finds that moxidectin not only inhibits the transcriptional expression of VP6 protein of rotavirus, but also reduces the expression level of VP6 protein. Therefore, moxidectin can be used to prevent or treat rotavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is a graph showing the results of the toxicity test of moxidectin on cells.

[0012] Figure 2 The graph shows the results of different concentrations of moxidectin inhibiting the number of rotavirus copies.

[0013] Figure 3 Moxidectin inhibits the expression of rotavirus VP6 protein.

[0014] Figure 4 This is a graph showing the inhibition of rotavirus immunofluorescence by moxidectin. DETAILED DESCRIPTION

[0015] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0016] The Caco-2 cells used in the following examples are preserved by the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precision Breeding. Caco-2 cells are a cell line derived from human colon adenocarcinoma. The cell line can spontaneously differentiate into polar monolayer cells similar to small intestinal epithelial cells and is the best in vitro model for studying anti-rotavirus drugs. Other related reagents used, unless otherwise specified, are commercially available agents, and the methods involved, unless otherwise specified, are all known methods.

[0017] The compound moxidectin used was purchased from MedChemExpress, and its chemical molecular structure is shown below:

[0018]

[0019] Rotavirus strains used: Rotavirus vaccine strain LLR (G10P

[15] ), maintained by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention, subcultured on MA104 cells; MA104 cells (African green monkey embryonic kidney cells), maintained by the Viral Diarrhea Laboratory of the Chinese Center for Disease Control and Prevention, passage number 23.

[0020] In order to verify whether moxidectin can be used as the only active ingredient to prepare drugs for the prevention and treatment of rotavirus, the following tests were conducted:

[0021] 1. Toxicity of Moxidectin in Caco2 cells

[0022] Caco-2 cells were plated in 96-well plates with 100 μL cell suspension per well (the culture medium was DMEM culture medium containing 10% FBS, 1% amphotericin, and 1% gentamicin, and 0.1 mL of culture medium was added to each well) and cultured to a cell density of about 70%; Moxidectin was dissolved in DMEM culture medium containing 10% FBS, 1% amphotericin, and 1% gentamicin to obtain Moxidectin solutions with concentrations of 1.25 μM, 2.5 μM, 5 μM, 10 μM, and 20 μM, respectively, which were recorded as experimental group drugs, and a control group DMSO was set up at the same time; 10 μL of experimental group drugs of different concentrations and control group DMSO were added to each well, and cultured at 37°C, 5% CO2 for 24 hours. 10 μL of CCK-8 solution was added to each well under light-proof conditions, and the cells were placed in a 37°C incubator with the lights turned off and cultured for 4 hours. The absorbance at 450 nm was measured using an enzyme marker. The cell survival rate was calculated by the formula to determine the optimal drug concentration. Cell survival rate = [(As-Ab] / (Ac-Ab)] × 100%, inhibition rate

[0023] =[(Ac-As] / (Ac-Ab)]×100%.

[0024] The results are as follows Figure 1 As shown, moxidectin solution has no cytotoxicity within the concentration of 10 μM. DMSO has no cytotoxicity to cells.

[0025] 2. Effect of the compound moxidectin on rotavirus replication

[0026] The control group DMSO and three non-toxic concentrations (5 μM, 7.5 μM, 10 μM) of moxidectin solution were added to Caco-2 cells and incubated at 37°C, 5% CO2 for 24 h. Rotavirus was inoculated into Caco2 cells and infected for 2 h. The virus was discarded and maintained overnight and the corresponding concentration of moxidectin solution were added for 24 h.

[0027] (1) Effect on the copy number of rotavirus in cells

[0028] After the samples were collected, RNA was extracted using an RNA extraction kit. Reverse transcriptase was used to reverse transcribe into cDNA. The corresponding primers were used to perform an absolute quantitative experiment by the standard curve method to detect the number of rotavirus genome copies in the cell samples. The reaction system was 25 μL: premix Ex Taq 12.5 μL, upstream primer 1 μL, downstream primer 1 μL, probe 0.5 μL, DEPC water 7.5 μL, cDNA 2 μL. Reaction conditions: 95℃30s, 95℃5s, 40 cycles, 60℃30s. Among them, RV-NSP3 upstream primer: ACCATCTWC ACRTRACCCTCTATGAG; downstream primer: GGTCACATAACGCCCCTATAGC; RV probe primer: FAM-AGTTAAAAGCTAACACTGTCAAA-MGB.

[0029] The experimental results are as follows Figure 2 As shown, the number of viral copies in the experimental group was significantly reduced compared with the control group, indicating that the moxidectin solution significantly inhibited the replication of rotavirus in the concentration range of 5-10 μM.

[0030] (2) Effects on the expression of rotavirus VP6 protein in cells

[0031] The supernatant of the sample was discarded, and the loading buffer containing RIPA was added to lyse the cells for processing. The sample was collected by cell scraping into a 1.5mL centrifuge tube, placed in a 100℃ metal bath for 10 minutes, and centrifuged at 12000r / min for 10 minutes. 10% polyacrylamide gel was prepared in proportion, and 10μL protein sample and 5μL protein Maker were added after solidification. Electrophoresis was performed at 80V voltage for 30 minutes and 120V voltage for 90 minutes. The NC membrane was cut and transferred to the membrane at 100V voltage for 90 minutes in a sandwich structure. It was placed in 5% skim milk powder for blocking at room temperature for 2 hours. The membrane was washed with TBST for 10 minutes each time and washed twice. Incubated with primary antibody overnight at 4℃. The membrane was washed with TBST for 10 minutes each time and washed twice. Incubated with secondary antibody at room temperature for 2 hours. After washing the membrane with TBST, it was placed in ECL chemiluminescent substrate exposure solution and imaged using a high-sensitivity chemiluminescent imager.

[0032] The results are as follows Figure 3 As shown, compared with the control group, as the concentration of moxidectin solution increased, the expression of rotavirus VP6 viral protein decreased, indicating that moxidectin can inhibit rotavirus replication.

[0033] (3) Effects on rotavirus immunofluorescence in cells

[0034] Caco-2 cells were plated (the culture medium used was DMEM culture medium containing 10% FBS, 1% amphotericin, and 1% gentamicin) in a laser confocal microplate and cultured to a cell density of about 60%. The cultured cells were recorded as the MOCK group, and the 7.5μM moxidectin solution was used as the RV group. DMSO and three non-toxic concentrations (5μM, 7.5μM, and 10μM) of moxidectin solution were added to Caco2 cells and incubated at 37°C and 5% CO2 for 24h. Rotavirus was inoculated into the cells for 2h, and recorded as the RV+DMSO group, RV+moxidectin (5μM) group, RV+moxidectin (7.5μM) group, and RV+moxidectin (10μM) group respectively; then the cell culture supernatant was discarded, and the cells were washed with PBS and fixed in 4% methanol at room temperature for 30min, and permeabilized with 0.2% trimethoprim for 10min. After washing with PBS, 5% BSA was used to block at room temperature for 1h. Incubate with primary antibody at 4°C overnight. Rinse with PBST three times and incubate with fluorescent secondary antibody at 37°C for 1 hour. Rinse with PBST three times and add anti-fluorescence attenuation mounting medium to seal the slides. Observe and take fluorescence microscopic images under an inverted fluorescence microscope in the dark.

[0035] The results are as follows Figure 4 As shown in the figure, compared with the control group, as the concentration of moxidectin solution increased, the rotavirus fluorescence decreased significantly. The results show that moxidectin can inhibit the replication of rotavirus.

[0036] In summary, moxidectin can be used as the sole active ingredient to prepare a drug for preventing and treating rotavirus. Of course, the prepared drug contains moxidectin and also contains a pharmaceutically acceptable carrier and / or excipient; the dosage form of the drug is one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0037] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. The use of moxidectin as the sole active ingredient in the preparation of drugs for preventing and treating rotavirus.

2. A drug for preventing and treating rotavirus, characterized in that: Contains moxidectin.

3. The drug for preventing and treating rotavirus according to claim 2, characterized in that: It also contains pharmaceutically acceptable carriers and / or excipients.

4. The drug for preventing and treating rotavirus according to claim 2 or 3, characterized in that: The dosage form of the medicine is one of tablets, sprays, granules, capsules, oral liquids, injections and suspensions.

Images