Bacillus velezensis SFT4 with antibacterial function and application thereof

Abstract

The invention provides bacillus velezensis SFT4 with an antibacterial function and application thereof, and belongs to the technical field of microbe application, the bacillus velezensis SFT4 has a good inhibition effect on Erpex lacteus, Aspergillus pallidum, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus and the like, has a certain inhibition effect on salmonella, and can be used for preparing the bacillus velezensis SFT4. The invention provides a bacillus velezensis SFT4 and a metabolite thereof, provides a microecological preparation containing the bacillus velezensis SFT4 and the metabolite thereof, and provides a use method of the microecological preparation, the microecological preparation is composed of the bacillus velezensis SFT4, lactobacillus reuteri, lactobacillus casei and lactobacillus plantarum, and the microecological preparation is applied to the livestock and poultry industry. The microecological preparation can effectively prevent and treat clostridium perfringens and escherichia coli, can be prepared into a feed additive for use, can be directly fed through a drinking water line, and is not easy to block the drinking water feeding line.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial application, and specifically refers to Bacillus Velezii SFT4 with antibacterial function and application thereof. Background Art

[0002] Clostridium perfringens (CP), also known as Clostridium welchii, belongs to the Bacillaceae family and the genus Clostridium. It is a conditional pathogenic bacterium widely distributed in water sources, soil and other natural environments as well as in the intestines of animals. Clostridium perfringens has strong environmental tolerance and produces bioactive proteins or toxins, causing diseases with different clinical symptoms in humans and a variety of livestock. Escherichia coli belongs to the genus Escherichia of the Enterobacteriaceae family. Escherichia coli is a Gram-negative, facultative anaerobic, rod-shaped bacterium with blunt ends, motile and no spores. Escherichia coli mainly parasitizes in the large intestine of humans and animals, accounting for about 1% of intestinal bacteria. Escherichia coli is a conditional pathogen that can cause gastrointestinal infections or urinary tract infections in humans and a variety of animals under certain conditions.

[0003] For the prevention and control of Clostridium perfringens and Escherichia coli, in addition to using chemical methods to disinfect the environment and using antibiotics for prevention and control, the use of probiotics is a green and effective method. Generally speaking, large-scale farms add probiotics to nutrient solution for activation and feed them to animals through drinking water lines. Taojiang County Jinyuan Animal Husbandry Co., Ltd., a subsidiary of our company, applies probiotics to the feeding of Hy-Line brown laying hens. In the actual application of feeding probiotics to laying hens through drinking water lines, it was found that probiotics are easily contaminated by fungi in the environment during the activation process. Lactic acid bacteria can inhibit the contamination of many bacteria by producing acid, but many fungi in the environment are acid-resistant. The proliferation of fungi in the propagation solution of probiotics will not only bring potential unforeseen harm to animals, but the more direct disadvantage is that the continuous proliferation of fungal mycelium can easily block the drinking water pipeline, which brings great inconvenience to the application of probiotics. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a Bacillus Velez SFT4 with antibacterial function and its application. The fungi in the activated microecological bacterial agent in the farm are separated, the susceptible fungi are analyzed, and the probiotics with antibacterial effect on the fungi are screened as the strains for preventing and controlling the infection of the microecological bacterial agent. Based on the screened probiotics, the probiotics with antibacterial function on Clostridium perfringens and Escherichia coli are screened as composite bacteria to protect the intestinal health of animals.

[0005] To achieve the above objectives, the present scheme first provides a Bacillus Velez subtilis SFT4 with antibacterial function. The Bacillus Velez subtilis is a new strain SFT4 of the genus Bacillus, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on August 22, 2024, with a deposit number of CGMCC No.31720.

[0006] Preferably, the 16SrDNA sequence of the Bacillus Velezii SFT4 is as shown in SEQ ID NO.1

[0007] Based on a general inventive concept, the present invention also provides an application of Bacillus Velezii SFT4 in inhibiting Albugo spp., Aspergillus pallidum, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus and Salmonella.

[0008] Based on a general inventive concept, the present invention also provides a microecological preparation containing Bacillus Velez subtilis SFT4, wherein the microbial preparation comprises Bacillus Velez subtilis SFT4, Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei.

[0009] Preferably, the method for preparing the microecological preparation comprises the following steps:

[0010] S1. Preparation of slant seeds: Activate Bacillus Velezii SFT4 on the slant of a nutrient agar test tube, and activate Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei on the slant of an MRS agar test tube, respectively;

[0011] S2, preparation of seed liquid: 2-3 loops of the Velez SFT4 activated in step S1 are inoculated into a seed liquid culture medium to obtain Velez SFT4 seed liquid; 2-3 loops of the Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei activated in step S1 are inoculated into MRS broth culture medium respectively, and the mixture is sealed and fermented at 37° C. for 16 hours to obtain lactic acid bacteria seed liquid;

[0012] S3. Propagation of microecological preparations: The seed solution of Bacillus Velez subtilis SFT4 prepared in S2 is inoculated into the Bacillus Velez subtilis propagation medium at an inoculation rate of 1%-5% by volume, and the culture medium is closed and fermented for 24 hours. Then, the seed solutions of Lactobacillus reuteri, Lactobacillus casei, and Lactobacillus plantarum prepared in S2 are inoculated. The total inoculation rate of the lactic acid bacteria seed solution is 1.5%-5% by volume. 1%-5% brown sugar is added at the same time of inoculation. The microecological preparations are obtained after 24 hours of closed fermentation. The volume ratio of the three lactic acid bacteria seed solutions in the total inoculation rate of the lactic acid bacteria seed solution is 1:1:1.

[0013] Preferably, the culture conditions of the Bacillus Velez seed solution in step S2 are: culture temperature 37° C., rotation speed 200 r / min, ventilation volume 15 L / min, and culture time 16-20 h.

[0014] Preferably, the seed liquid culture medium in step S2 is LB or NB or YPD culture medium.

[0015] Preferably, the Bacillus Velez subtilis expansion medium in step S3 comprises 1-5% brown sugar, 0.5%-2% ammonium sulfate, and 1% sodium chloride, and the fermentation temperature is 30-37°C.

[0016] Based on a general inventive concept, the present invention also provides an application of a probiotic preparation in the preparation of an antibacterial preparation in aquaculture, characterized in that the bacterial species include white sac spores, Aspergillus pallidum, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus, Salmonella and Escherichia coli.

[0017] Preferably, the microecological preparation can be made into a feed additive or fed directly through the drinking water line.

[0018] The antibacterial mechanism of the antibacterial preparation in this scheme is as follows:

[0019] This scheme separates the fungi in the activated microecological agents in the farms, analyzes the susceptible fungi, and screens the probiotics that have antibacterial effects on fungi as strains to prevent and control microecological agents from contaminating bacteria. Based on the screened probiotics, probiotics with antibacterial functions against Clostridium perfringens and Escherichia coli are screened as composite bacteria to protect the intestinal health of animals.

[0020] Bacillus Velezii can effectively prevent and control Clostridium perfringens, white capsule rake tooth fungus, and pale Aspergillus, and Lactobacillus plantarum ACCC 10171, Lactobacillus reuteri ACCC 03959, and Lactobacillus casei ACCC 03965 (all preserved in the China Agricultural Microbiological Culture Collection Management Center) can effectively prevent and control Escherichia coli. After the composite microecological preparation is activated by the process of the present invention, the microecological preparation expansion liquid has a longer shelf life, is not easy to be contaminated, and has a good function of preventing and controlling Escherichia coli and Clostridium perfringens.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] (1) In this scheme, Bacillus Velez SFT4 was screened out from laying hen manure. The Bacillus Velez SFT4 was sent to the General Microbiology Center of China National Microbiological Culture Collection Administration on August 22, 2024, with a deposit number of CGMCC No. 31720. The Bacillus Velez SFT4 has multiple functional properties: (1) It has inhibitory activity against fungi such as Albugo sphaeroides and Aspergillus pallidum; (2) It has inhibitory activity against bacteria such as Clostridium perfringens, Micrococcus luteus, Staphylococcus aureus and Salmonella. The above functional properties enable Bacillus Velez SFT4 to have a variety of application forms, such as preventing and controlling livestock and poultry diseases, preparing drugs for preventing and controlling fungal or bacterial diseases, microecological preparations, etc., and has broad application prospects.

[0023] (2) Bacillus Velezii SFT4 can effectively prevent and treat white capsule rake tooth fungus, Aspergillus pallidum, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus, and Salmonella, and Lactobacillus reuteri, Lactobacillus casei, and Lactobacillus plantarum can effectively prevent and treat Escherichia coli. Compared with single strains, the composite microecological preparation can produce a wider spectrum of antibacterial substances such as antimicrobial peptides, reuterin, lactic acid, plant lactobacillus, etc. after activation, and the four strains are not antagonistic to each other, and have a wider spectrum of antibacterial effects. After the composite microecological preparation is activated by the process of the present invention, the microecological preparation expansion liquid has a longer shelf life, is not easy to be contaminated, and has a good function of preventing and treating Escherichia coli and Clostridium perfringens.

[0024] (3) The Bacillus Velez subtilis of this solution can be applied to the application of Bacillus Velez subtilis fermentation broth, bacterial agents and derivative products in livestock and poultry breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 The colony morphology of Bacillus Velez in Example 1;

[0027] Figure 2 The electrophoresis diagram of the PCR of Bacillus Velez in Example 1;

[0028] Figure 3 is the phylogenetic tree of Bacillus Velez in Example 1;

[0029] Figure 4 The colony morphology of two fungi in Example 2, a is Aspergillus pallidum, and b is Aspergillus niger;

[0030] Figure 5 This is the PCR electrophoresis diagram of two fungi in Example 2;

[0031] Figure 6 is the phylogenetic tree of Aspergillus pallidum in Example 2;

[0032] Figure 7 is the phylogenetic tree of the white capsule rake teeth in Example 2;

[0033] Figure 8 The inhibition of Bacillus Velez on Clostridium perfringens after enzyme treatment in Example 2, a is the inhibition of 75 ppm chlortetracycline hydrochloride on Clostridium perfringens; b is the inhibition of Bacillus Velez on Clostridium perfringens without enzyme treatment; c is the inhibition of Bacillus Velez on Clostridium perfringens treated with proteinase K; d is the inhibition of Bacillus Velez on Clostridium perfringens treated with pepsin;

[0034] Fig. 9 The inhibition of Bacillus Velez on Clostridium perfringens after different pH treatments in Example 2, a is the inhibition of 75 ppm chlortetracycline hydrochloride on Clostridium perfringens; b is the inhibition of Bacillus Velez treated at pH 3.0 on Clostridium perfringens; c is the inhibition of Bacillus Velez treated at pH 5.0 on Clostridium perfringens; d is the inhibition of Bacillus Velez treated at pH 7.0 on Clostridium perfringens; e is the inhibition of 75 ppm chlortetracycline hydrochloride on Clostridium perfringens; f is the inhibition of Bacillus Velez treated at pH 9.0 on Clostridium perfringens;

[0035] Fig.10 is the inhibitory effect of Bacillus Velez on Aspergillus alba and white capsule rake tooth fungus in Example 2, a is the inhibition of Bacillus Velez on Aspergillus alba, and b is the inhibition of Bacillus Velez on white capsule rake tooth fungus;

[0036] Fig.11 The inhibitory effect of Bacillus Velez on Staphylococcus aureus in Example 3;

[0037] Fig.12 The inhibitory effect of Bacillus Velez on Micrococcus luteus in Example 3;

[0038] Fig.13 The inhibitory effect of Bacillus Velez on Salmonella in Example 3;

[0039] Fig.14 The conditions of the microecological enrichment solution in Example 5, a is a microecological preparation enrichment solution containing Bacillus Velezii, and b is a microecological preparation enrichment solution without Bacillus Velezii;

[0040] Fig.15This is a comparison of the antibacterial effects of Bacillus Velez SFT4 enrichment fluid T1, Lactobacillus enrichment fluid T2, and microecological preparation enrichment fluid T3 in Example 5, where a is the antibacterial effect of each group on Escherichia coli, and b is the antibacterial effect of each group on Clostridium perfringens. DETAILED DESCRIPTION

[0041] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0042] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0043] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0044] Example 1

[0045] Screening of Bacillus velez SFT4

[0046] Healthy laying hen manure was taken from the chicken house of Taojiang County Jinyuan Animal Husbandry Co., Ltd., and the Bacillus in the manure was separated by the coating method, and the culture medium was LB solid culture medium. Clostridium perfringens, Escherichia coli, Salmonella, and Staphylococcus aureus were used as indicator bacteria, and the isolated strains were screened out by the plate confrontation method to find out the strains that had antagonistic effects on the indicator bacteria. The screened strains were cultured in LB liquid culture medium, and then sterile glycerol (final glycerol concentration 20%) was added, and the sterile lyophilized tubes were stored in the company's strain storage at -80°C for future use.

[0047] A candidate strain SFT4 was obtained through preliminary screening (colony morphology is shown in Figure 1 ), the purified SFT4 strain was picked and PCR was performed using primers 27F and 1492R;

[0048] 27F: AGAGTTTGATCCTGGCTCAG; (SEQ ID NO. 2)

[0049] 1492R: GGT TACCTTGTTACGACTT) (SEQ ID NO. 3);

[0050] The PCR stock solution (PCR results see Figure 2 ) were sent to Beijing Qingke Biotechnology Co., Ltd. Changsha Branch for sequencing, and the sequencing sequences were used to construct a phylogenetic tree using MEG7.0 (see Figure 3), whose 16S rDNA sequence is shown in SEQ ID NO: 1. Combined with physiological and biochemical reactions, it has been confirmed that SFT4 is a different strain of the same species Bacillus velezensis.

[0051] Finally, the SFT4 strain was sent to the General Microbiology Center of China Microbiological Culture Collection Administration for preservation on August 22, 2024, with the address at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. After identification, the strain was named Bacillus velezensis SFT4, classified as Bacillus velezensis, with a preservation date of August 22, 2024 and a preservation number of CGMCC No.31720. The collection center completed the test on August 22, 2024 and confirmed that the deposited microorganisms were alive.

[0052] Example 2

[0053] Investigating the inhibitory activity of Bacillus velezensis SFT4 against Aspergillus pallidum and Clostridium perfringens

[0054] First, fungi were isolated from the liquid of the activated and expanded microecological preparations in the chicken farm. After multiple sampling, separation and purification, it was found that there were two main fungi in the microecological preparations in the chicken farm (see the colony morphology for details). Figure 4 ), the fungus was purified and cultured in PDA medium, the hyphae were picked and ultrasonically disrupted with a cell ultrasonic disruptor, and PCR was performed using primers NL1 and NL4 (PCR results are shown in Figure 5 ).

[0055] NL1: GCATATCAATAAGCGGAGGAAAAG; (SEQ ID NO.4)

[0056] NL4: GGTCCG TGTTTCAAGACGG; (SEQ ID NO.5)

[0057] The PCR stock solution was sent to Beijing Qingke Biotechnology Co., Ltd. Changsha Branch for sequencing, and the sequencing sequence was used to construct a phylogenetic tree using MEG7.0 ( Figure 6 , Figure 7 ), the two fungi were preliminarily identified as: Irpexlacteus and Aspergillus pallidus, the 16SrDNA sequence of Aspergillus pallidus strain is shown in SEQ ID NO.6, and the 16SrDNA sequence of Irpexlacteus strain is shown in SEQ ID NO.7;

[0058] The fermentation broth of Bacillus Velezii SFT4 was centrifuged at 8000r / min for 10 minutes, and the supernatant was treated with proteinase K and pepsin for 30 minutes respectively. The effect of enzymes on the inhibition of SFT4 against Clostridium perfringens was investigated with 75ppm chlortetracycline hydrochloride as control (see the results in the table). Figure 8 ), a is the inhibition of 75ppm chlortetracycline hydrochloride on Clostridium perfringens, with an inhibition diameter of 33.06mm; b is the inhibition of Bacillus Velez on Clostridium perfringens without enzyme treatment, with an inhibition diameter of 22.38mm; c is the inhibition of Bacillus Velez on Clostridium perfringens treated with proteinase K, with an inhibition diameter of 20.30mm; d is the inhibition of Bacillus Velez on Clostridium perfringens treated with pepsin, with an inhibition diameter of 22.37mm. The results show that the metabolites of Bacillus Velez can tolerate protease and will not be decomposed by pepsin in the gastrointestinal tract of animals, and can still play a good role in inhibiting Clostridium perfringens in the animal intestine.

[0059] The pH value of the supernatant was adjusted to 3.0, 5.0, 7.0, and 9.0 for 30 min, and the pH of the treated supernatant was adjusted back to 7.0. The inhibitory effect of the treated supernatant on Clostridium perfringens was determined by the Oxford cup method with 75 ppm chlortetracycline hydrochloride as the control. The inhibition rate was calculated. The inhibition rate = the inhibition diameter of the experimental group / the inhibition diameter of chlortetracycline hydrochloride * 100% (see the results). Fig. 9 ), a is the inhibition of 75ppm chlortetracycline hydrochloride on Clostridium perfringens; b is the inhibition of Bacillus Velez treated with pH3.0 on Clostridium perfringens, with an inhibition rate of 53.68%; c is the inhibition of Bacillus Velez treated with pH5.0 on Clostridium perfringens, with an inhibition rate of 55.56%; d is the inhibition of Bacillus Velez treated with pH7.0 on Clostridium perfringens, with an inhibition rate of 52.61%; e is the inhibition of 75ppm chlortetracycline hydrochloride on Clostridium perfringens; f is the inhibition of Bacillus Velez treated with pH9.0 on Clostridium perfringens, with an inhibition rate of 51.98%. The results show that the Bacillus Velez SFT4 of this scheme can maintain a high inhibitory activity against Clostridium perfringens in pH3-9, and can still exert its antibacterial function in the acidic environment of the animal gastrointestinal tract.

[0060] The Oxford cup method was used to determine the antibacterial effect of SFT4 strain on white sac rake tooth fungus and pale Aspergillus. White sac rake tooth fungus and pale Aspergillus were inoculated into sterilized potato glucose liquid culture medium (20g of potato was chopped and boiled for 30min, filtered through 4 layers of gauze, 20g of glucose, supplemented with water to 1L, pH natural) and cultured for 72h for standby. Pour a small amount of sterilized PDA solid culture medium (about 5mL) into a 9cm sterile culture dish and spread it evenly. After the culture medium is cooled and solidified, place a 10mm Oxford cup in the middle of the culture dish, pour an appropriate amount of PDA culture medium (about 20mL), and remove the Oxford cup after the culture medium is cooled. Take 50μL of white sac rake tooth fungus and pale Aspergillus culture solution into the PDA culture medium respectively, spread it evenly with a coating rod, add 150μL SFT4 fermentation liquid supernatant to the Oxford cup hole, and do not add fermentation liquid supernatant to the blank control. The experimental results showed that the SFT4 strain had an inhibitory effect on Aspergillus niger and Aspergillus pallidum (see Fig.10 ) and Clostridium perfringens, which shows that Bacillus Velez subtilis has an inhibitory effect on Albugo serrata and Aspergillus pallidum. The metabolites of Bacillus Velez subtilis can tolerate the protease and acidic environment of the gastrointestinal tract, and can play a good role in the gastrointestinal tract of animals after being drunk.

[0061] Example 3

[0062] Investigating the antibacterial effect of Bacillus Velez SFT4 on Staphylococcus aureus, Micrococcus luteus and Salmonella

[0063] The strain of Bacillus Velez SFT4 obtained by screening was cultured in LB liquid medium for 36 hours, and the supernatant was filtered through a 0.22 μm sterile microporous filter membrane after centrifugation. The filtrate was subjected to antibacterial experiments on Staphylococcus aureus, Micrococcus luteus, Escherichia coli, Salmonella, and Klebsiella pneumoniae using the Oxford cup method. The experimental results showed that the diameter of the inhibition zone of Bacillus Velez SFT4 against Staphylococcus aureus was 15.64 mm (see Fig.11 ) and the diameter of the inhibition zone of Micrococcus luteus was 23.76 mm (see Fig.12 ) has a good inhibitory effect, and the diameter of the inhibition zone for Salmonella is 11.47mm, which has a certain inhibitory effect (see Fig.13 ), but had no inhibitory effect on Escherichia coli and Klebsiella pneumoniae.

[0064] Example 4

[0065] Preparation of microecological preparation containing Bacillus Velezii SFT4

[0066] The plate confrontation method was used to screen strains with good inhibitory effects on Escherichia coli and Clostridium perfringens, and Lactobacillus plantarum ACCC 10171, Lactobacillus reuteri ACCC 03959, and Lactobacillus casei ACCC 03965 were obtained. The three strains had good inhibitory effects on Escherichia coli.

[0067] S1. Preparation of slant seeds

[0068] Bacillus Velez SFT4 was activated on the slant of nutrient agar medium test tube, and Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus casei were activated on the slant of MRS agar test tube, respectively.

[0069] S2. Preparation of seed solution

[0070] The activated Bacillus Velez subtilis was selected and inoculated into LB liquid culture medium (1000 ml Erlenmeyer flask, liquid volume of 400 ml, autoclaved at 121° C. for 15 min), and fermented at 37° C. and 200 r / min for 16 h to obtain Bacillus Velez subtilis seed liquid.

[0071] Select 2-3 ringlets of activated Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus casei, respectively, and inoculate them into MRS broth culture medium (1000ml triangular flask, liquid volume is 800ml, high pressure sterilization at 110℃ for 15min), and ferment them in a closed manner at 37℃ for 16h to obtain lactic acid bacteria seed liquid.

[0072] S3. Proliferation of microecological preparations

[0073] Propagation culture of Bacillus Velez subtilis: 3% brown sugar, 1.5% ammonium sulfate, 1% sodium chloride, weigh 100L tap water, stir the above substances evenly, inoculate 2L of Bacillus Velez subtilis seed liquid, stir evenly, and place in a closed environment at 37°C for 24h.

[0074] Propagation of microecological preparations: Add 2% brown sugar to the propagation liquid of Bacillus Velez subtilis for 24 hours, inoculate 1% seed liquid (1L) of each lactic acid bacteria, stir evenly, place in a closed environment at 37°C for 24 hours, and obtain a microecological preparation containing Bacillus Velez subtilis.

[0075] Example 5

[0076] Investigating the actual antibacterial effect of microecological preparations containing Bacillus Velezii SFT4

[0077] (1) Place the propagated microecological preparation in a farm environment at room temperature, and use the microecological preparation propagation liquid without Bacillus velezensis as a control to observe whether mold grows on the surface of the propagation liquid.

[0078] The results are as follows Fig.14It shows that the propagation fluid of the probiotic preparation without Bacillus Velez subtilis starts to grow mold from the second day, while the propagation fluid of the probiotic preparation containing Bacillus Velez subtilis will not grow mold for at least 12 days.

[0079] (2) Using Clostridium perfringens and Escherichia coli as indicator bacteria, and expanding SFT4 Bacillus and expanding lactic acid bacteria as controls, the antibacterial effects of the expanded microecological preparations were compared with those of the controls. Expanded Bacillus (Bacillus Velez SFT4 expansion culture: 3% brown sugar, 1.5% ammonium sulfate, 1% sodium chloride, weigh 100L of tap water, stir the above substances evenly, inoculate 2L of Bacillus Velez seed liquid, stir evenly, and place in a closed culture at 37°C for 24h), expanded lactic acid bacteria (activate Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei to prepare seed liquid, add 2% brown sugar to 100L of tap water and stir evenly, inoculate 1% seed liquid of each lactic acid bacteria, stir evenly, and place in a closed culture at 37°C for 24h.), and expanded microecological preparations were centrifuged and filtered through a 0.22μm sterile filter membrane for use. Pour 5mL of sterile agar into each 9cm sterile plate, spread it flat, and after cooling, place 3 10mm Oxford cups on each plate. Sterile TSC medium is cooled to 50℃, add 2‰ of Clostridium perfringens, mix well, and pour 20mL of the medium into each plate; sterile LB solid medium is cooled to 50℃, add 2‰ of Escherichia coli, mix well, and pour 20mL of the medium into each plate. After the medium cools down, remove the Oxford cup. Add 150μL of centrifuged filtered expansion liquid to each plate, culture overnight in a 37℃ incubator, measure the antibacterial diameter, and compare the antibacterial effect.

[0080] The results are as follows Fig.15 As shown in the figure, the antibacterial effects of Velez Bacillus SFT4 enrichment liquid T1, lactobacillus enrichment liquid T2, and microecological preparation enrichment liquid T3 are compared. a is the antibacterial effect of each group on Escherichia coli, and b is the antibacterial effect of each group on Clostridium perfringens; the expanded Velez Bacillus SFT4 has no inhibitory effect on Escherichia coli, and the diameter of the inhibition zone on Clostridium perfringens is 19.61mm; the diameter of the inhibition zone of the expanded lactic acid bacteria on Escherichia coli is 19.81mm and the diameter of the inhibition zone on Clostridium perfringens is 20.33mm; the diameter of the inhibition zone of the expanded microecological preparation on Escherichia coli is 20.05mm, and the diameter of the inhibition zone on Clostridium perfringens is 21.24mm. The results show that the antibacterial effect of the composite microecological preparation is better than that of the separately expanded Bacillus SFT4 and lactic acid bacteria.

[0081] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A bacteriostatic Bacillus Velezii SFT4, It is characterized in that The Bacillus Velez is a new strain SFT4 of the genus Bacillus, which was deposited in the General Microbiology Center of the China Culture Collection Administration on August 22, 2024, with the deposit number CGMCC No.31720.

2. The Bacillus Velezii SFT4 according to claim 1, It is characterized in that The 16SrDNA sequence of the Bacillus Velezii SFT4 is shown in SEQ ID NO.

1.

3. Use of the Bacillus Velezii SFT4 according to any one of claims 1 to 2 in inhibiting Albugo spp., Aspergillus pallidum, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus and Salmonella.

4. A microecological preparation containing the Bacillus Velezii SFT4 according to any one of claims 1 to 2, It is characterized in that The microbial preparation comprises Bacillus Velez SFT4, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus casei.

5. The microecological preparation according to claim 4, It is characterized in that The preparation method of the microecological preparation comprises the following steps: S1. Preparation of slant seeds: Activate Bacillus Velezii SFT4 on the slant of a nutrient agar test tube, and activate Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei on the slant of an MRS agar test tube, respectively; S2, preparation of seed liquid: 2-3 loops of the Velez SFT4 activated in step S1 are inoculated into a seed liquid culture medium to obtain Velez SFT4 seed liquid; 2-3 loops of the Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei activated in step S1 are inoculated into MRS broth culture medium respectively, and the mixture is sealed and fermented at 37° C. for 16 hours to obtain lactic acid bacteria seed liquid; S3. Propagation of microecological preparations: The seed solution of Bacillus Velez subtilis SFT4 prepared in S2 is inoculated into the Bacillus Velez subtilis propagation medium at an inoculation rate of 1%-5% by volume, and the culture medium is closed and fermented for 24 hours. Then, the seed solutions of Lactobacillus reuteri, Lactobacillus casei, and Lactobacillus plantarum prepared in S2 are inoculated. The total inoculation rate of the lactic acid bacteria seed solution is 1.5%-5% by volume. 1%-5% brown sugar is added at the same time of inoculation. The microecological preparations are obtained after 24 hours of closed fermentation. The volume ratio of the three lactic acid bacteria seed solutions in the total inoculation rate of the lactic acid bacteria seed solution is 1:1:

1.

6. The preparation method according to claim 5, It is characterized in that The culture conditions of the Bacillus Velez seed solution in step S2 are: culture temperature 37° C., rotation speed 200 r / min, ventilation volume 15 L / min, and culture time 16-20 h.

7. The preparation method according to claim 5, It is characterized in that The seed liquid culture medium in step S2 is LB, NB or YPD culture medium.

8. The preparation method according to claim 5, It is characterized in that In step S3, the Bacillus Velez subtilis expansion medium comprises 1-5% brown sugar, 0.5%-2% ammonium sulfate, and 1% sodium chloride, and the fermentation temperature is 30-37°C.

9. Use of a probiotic preparation prepared by the preparation method according to any one of claims 4 to 8 in the preparation of an antibacterial preparation in aquaculture, It is characterized in that The bacterial species include white capsule rake tooth bacteria, Aspergillus pallidum, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus, Salmonella and Escherichia coli.

10. The use according to claim 9, It is characterized in that The microecological preparation can be made into a feed additive or fed directly through a drinking water line.

Images