Construction method of uterine stromal cell specific gene editing mouse

Abstract

The invention belongs to a molecular biological technology, discloses a construction method of a uterus stromal specific gene editing mouse, and relates to a CRISPR-Cas9-based stromal specific gene editing mouse. The Cre mouse using Vim as a specific promoter activates Cas9, and the Cas9 mouse not only solves the problem of complex breeding of the traditional Cre mouse, but also can realize tissue specific knockout without homozygosis. Cas9 mice can be used for knocking out various sgRNAs, and more possibilities are provided for development of a gene editing model. The obtained Cas9 mouse is mated with an sgMettl3 report mouse, and the Mettl3 gene is successfully knocked out in the uterine stromal cells in a guided manner. The invention provides a valuable gene editing model for endometrial gene research, and overcomes the challenge of difficult knockout of bispecific site mediated genes.

Description

Technical Field

[0001] The present invention relates to molecular biology technology, and more specifically, to a method for constructing uterine stroma-specific gene-edited mice. Background Art

[0002] Uterine stromal cells are cells present in the endometrial stroma, which is the part of the endometrium that provides support and nutrition. The endometrium is composed of two layers: the epithelium (surface cells) and the stroma (supporting cells). Stromal cells are mainly involved in the regeneration and remodeling of the endometrium, especially during the menstrual cycle and pregnancy. Uterine stromal cells play a key role in regulating the function of the endometrium, supporting embryo implantation and maintaining pregnancy. Understanding the function of these cells is of great significance for the diagnosis and treatment of gynecological diseases.

[0003] Vimentin is a gene encoding an intermediate filament protein, which is expressed in a variety of cell types, especially in mesenchymal cells. The Vimentin protein encoded by the Vimentin gene is one of the main components of the cytoskeletal intermediate filaments. It plays a role in maintaining the cell's structure, stabilizing its shape, transducing internal and external signals, and cell migration. The expression of Vimentin during embryonic development is essential for normal differentiation and organ formation of the embryo.

[0004] The main principle of the Cre-Loxp system is to insert two LoxP sequences at specific sites in the target genome to form a target region between the LoxP sites. By expressing the Cre enzyme, the enzyme will catalyze the cutting of the LoxP sequence and guide the occurrence of DNA recombination events, which can achieve gene knockout, insertion or inversion. If two LoxP sites in the same direction are located on a chromosome DNA chain, Cre will recognize and knock out the sequence between the LoxP sites. The Flpo recombinase system is similar to Cre, and the FRT site is similar to the LoxP site and is used to construct conditional knockout mice.

[0005] The CRISPR-Cas system was first discovered in Escherichia coli. Its function is to resist phage infection, capture the spacer sequence from the phage and integrate it into its own genome to obtain exogenous resistance. The CRISPR-Cas system can protect the genome from destruction by phages, viruses, etc., which is related to the host Cas protein's ability to acquire anti-phage capabilities. CRISPR is a natural immune system for a variety of archaea and bacteria to deal with foreign DNA invasions. It uses Cas protease to cut and achieve autoimmunity. The CRISPR-Cas locus consists of a series of genes encoding Cas proteins and a CRISPR repeat spacer sequence. A typical CRISPR repeat spacer sequence consists of a leader sequence, a series of short, highly conserved direct repeat sequences, and a spacer sequence arranged in sequence.

[0006] In the field of embryo implantation, there is currently a good progesterone receptor-driven Pgr-Cre for uterine-specific knockout. This mouse has been widely used and has proven the physiological regulatory effects of various important molecules on the uterus. At present, Cre mice driven by Wnt7a, Sprr2f and Ltf have also been developed and utilized to achieve uterine epithelial-specific knockout. In addition, Amhr2-driven Cre mice are used to achieve specific knockout in the uterine stroma. However, Amhr2-Cre is not efficient, and after knockout, it is impossible to distinguish whether it affects the early development of the reproductive tract, and it also has a direct effect on embryo implantation. Tool mice using the Cre-loxp system require homozygous Flox mice carrying Cre to successfully knock out genes on two chromosomes, which is very difficult for breeding multi-gene knockout mice. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the above-mentioned problems existing in the prior art. First, a sgRNA targeting the Vim gene is provided.

[0008] The second object of the present invention is to provide a DNA fragment for knocking in the Vim gene.

[0009] The third object of the present invention is to provide a method for constructing a Cas9 mouse that can achieve tissue-specific knockout.

[0010] The fourth object of the present invention is to provide the application of Cas9 mice that can achieve tissue-specific knockout.

[0011] The fifth object of the present invention is to provide a conditional knockout mouse TG sgMettl3 -Pgr flpo / + -Vim fsf -Cre / + -Rosa26 lsl-Cas9 / + The construction method of .

[0012] The purpose of the present invention is achieved through the following technical solutions:

[0013] The present invention first provides a sgRNA targeting the Vim gene, wherein the sequence of the sgRNA is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0014] The present invention also provides a DNA fragment for knocking in a Vim gene, wherein the DNA fragment comprises an upstream homology arm, a FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression frame and a downstream homology arm in sequence from the 5' end to the 3' end; the nucleotide sequence of the upstream homology arm is a 5' end adjacent sequence of the start codon of the first exon of the Vimentin gene, the nucleotide sequence of the downstream homology arm is a 3' end adjacent sequence of the start codon of the first exon of the Vimentin genome, and the sequence of the FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression frame is shown in SEQ ID NO: 3.

[0015] The present invention also provides a method for constructing a Cas9 mouse capable of achieving tissue-specific knockout, comprising the following steps:

[0016] S1. Build Vim fsf-Cre / + Mouse: Obtain Cas9 mRNA and the sgRNA described in claim 1 by in vitro transcription; Use BAC clone RP23-14I24 as a template to construct a homologous recombination vector containing the DNA fragment described in claim 2; Transfer Cas9 mRNA, sgRNA and homologous recombination vector into mouse fertilized eggs, and then obtain through genotype screening;

[0017] S2. Build Pgr Flpo / + Mouse: The 2A-flop sequence was inserted into the 3'UTR of the Pgr gene and then obtained by genotypic screening;

[0018] S3. Build Pgr flpo / + -Vim fsf-Cre / + Mouse: Vim fsf-Cre / + Mice and Pgr Flpo / + Mouse hybridization, through genotype screening to obtain double positive mice Pgr flpo / + -Vim fsf-Cre / + Mice;

[0019] S4. Pgr flpo / + -Vim fsf-Cre / + Mouse and Rosa26 lsl-Cas9 / + Mice were crossed and Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice, that is, Cas9 mice that can achieve tissue-specific knockout.

[0020] The present invention uses Cre and Flpo to drive Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / +Knockout Solution: Designing and Building Vim fsf-Cre / + Mouse, the start codon of the Vim gene was partially replaced with the fsf-Cre expression cassette, Vim fsf-Cre Mouse and Pgr flp Mice were mated to delete the stop expression cassette, resulting in the generation of bi-yang mice Pgr flpo / + -Vim fsf-Cre / + .Rosa26 lsl-Cas Mice and Pgr flpo / + -Vim fsf-Cre / + After mating, the Cas9-expressing Sanyang mice Pgr flpo / + -Vim fsf -Cre / + -Rosa26 lsl-Cas9 / + .

[0021] This study aims to create uterine stroma-specific knockout mice based on the CRISPRCas9 system to solve the problem of low efficiency of Amhr2-Cre. CRISPRCas9 can achieve tissue-specific knockout without homozygosity, solving the problem of complex breeding of traditional Cre-Loxp tool mice. In addition, breeding Cas9 mice with multiple sgRNA tandem mice can achieve simultaneous knockout of multiple genes, solving the problem that traditional Cre-Loxp tool mice are difficult to knock out multiple genes simultaneously.

[0022] Therefore, the present invention also provides the use of the Cas9 mouse that can achieve tissue-specific knockout obtained by the above method in constructing a tissue-specific knockout animal model.

[0023] Specifically, the present invention also provides a conditional knockout mouse TG of uterine stroma sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + The construction method of the three-yang mouse Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice and TG sgMettl3 The uterine matrix conditional knockout mice TG were obtained by genotyping. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + .

[0024] Preferably, the TG sgMettl3 The mouse was constructed by integrating the DNA fragment of the sgRNA targeting Mettl3 into the mouse genome using the PiggyBAC transposase system, and then obtained through genotype identification and screening.

[0025] More preferably, the DNA fragment of the sgRNA targeting Mettl3 includes, from 5' to 3' end, U6 promoter, Mettl3-sgRNA1, U6 promoter, Mettl3-sgRNA2, U6 promoter, sgGFP encoding gene, CAG promoter encoding gene, mcherry encoding protein, SV40 poly (A) encoding gene, mcherry encoding protein, P2A peptide encoding gene, GFP encoding gene, and bGH poly (A) encoding gene.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention is a matrix-specific gene editing mouse based on CRISPR-Cas9. The Cre mouse with Vim as a specific promoter activates Cas9. The Cas9 mouse not only solves the problem of complex breeding of traditional Cre mice, but also can achieve a tissue-specific knockout without homozygosity. The Cas9 mouse can be used for the knockout of multiple sgRNAs, providing more possibilities for the development of gene editing models.

[0028] The obtained Cas9 mice were mated with sgMettl3 reporter mice, and the Mettl3 gene was successfully knocked out in uterine stromal cells. The present invention provides a valuable gene editing model for endometrial gene research, overcoming the challenge of bispecific site-mediated gene knockout. The successful construction of CRISPR-Cas9 conditional knockout mice provides a reference for exploring other gene editing model animals and broadens the development of model animals in the veterinary field. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Schematic diagram of the gene knock-in design strategy in Example 1;

[0030] Figure 2 For Vim in Example 2 fsf-Cre / + Results of mouse genotype electrophoresis identification;

[0031] Figure 3 For TG sgMettl3 PCR electrophoresis identification results of overexpression transgenic mice;

[0032] Figure 4 Pgr flpo / + Mouse PCR electrophoresis identification results; HE is heterozygous mouse, WT is wild mouse;

[0033] Figure 5 For Rosa26 lsl-Cas9 / + Mouse PCR electrophoresis identification results; HE is heterozygous mouse, WT is wild mouse;

[0034] Figure 6is TG in Example 3 sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + The results of electrophoresis identification of mouse genotype;

[0035] Figure 7 TG in Example 4 sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mouse, Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Immunohistochemical detection results of Vimintin protein and METTL3 in the uterus of mice and wild-type mice;

[0036] Figure 8 TG in Example 4 sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mouse, Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Western blot detection results of METTL3 and CAS9 in the uterus of mice and wild-type mice. DETAILED DESCRIPTION

[0037] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0038] The antibodies Mettl3, Cas9, Vimentin and β-Actin used in the present invention were purchased from CST, with the product numbers being E3F2A, 19526T, D21H3 and 4970S, respectively.

[0039] Example 1 FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA fragment knock-in design strategy

[0040] The mouse Vim gene (NCBI reference sequence: NM_011701.4) is located on mouse chromosome 2. Nine exons have been identified, of which the ATG start codon is located in exon 1 and the TAA stop codon is located in exon 9 (Transcript: 201ENSMUST00000028062). Run the Crisprick online tool for screening and select two sgRNAs with high scores. Using the BAC clone RP23-14I24 as a template, homology arms were generated by PCR, and the target fragment FRT-6xSV40pA-FRT-Kozak-iCre-WPRE-BGH PA (SEQ ID No. 3) was inserted to achieve the purpose of replacing part of exon 1 of the Vim gene with the target band.

[0041] The two sgRNAs were obtained as follows:

[0042] sgRNA1: 5'GGACACAGACCTGGTAGACA-TGG 3' (SEQ ID No. 1);

[0043] sgRNA2: 5'CCTTCGAAGCCATGTCTACC-AGG 3' (SEQ ID No. 2).

[0044] Example 2 Vim fsf-Cre / + Identification and screening of mouse models

[0045] 1. Experimental Methods

[0046] 1. Build Vim fsf-Cre / + Transgenic mice: Cas9 mRNA and sgRNA were obtained by in vitro transcription; Cas9 mRNA and sgRNA and the vector containing the homologous recombinant DNA fragment of Example 1 were microinjected into fertilized eggs of C57BL / 6J mice to obtain transgenic positive founder mice, and the successful construction was confirmed by genotype identification and sequencing.

[0047] 2. DNA extraction: Cut 3-5mm ear samples of the mouse to be identified and transfer them to a 200μL centrifuge tube. Add 50μL and 1μL of mouse tissue lysis buffer and Proteinase K to the centrifuge tube, mix well, and centrifuge quickly for 20s. Put the centrifuge tube into the PCR instrument, set the program to 55℃20min, 95℃5min, and lyse the sample to extract DNA. The extracted DNA sample is stored in a -40℃ refrigerator for later use.

[0048] 3. PCR extension of target fragment: Use the primers shown in Table 1, the PCR amplification system shown in Table 2, and the PCR amplification program shown in Table 3 to extend the PCR target fragment of the mouse to be identified.

[0049] Table 1 Vim fsf-Cre / + Genotype identification primer information:

[0050] Primer Sequence5'-->3' F TGCCTTCCTTGACCCTGGAAG R1 AGGAATAGAGGCTGCGGCTAG R2 GGGACCCTCTTTCCTAACAGTG

[0051] Table 2 Vim fsf-Cre / + Genotype identification reaction system

[0052] ReactionComponent Volume(μl) ddH2O 7.4 2x RapidTaqMasterMix* 10 PrimerI (10 pmol / μl) 0.8 Primer II (10 pmol / μl) 0.8 genomicDNA 1 Total 20

[0053] Table 3 Vim fsf-Cre / + Genotyping reaction conditions

[0054] Step Temperature(℃) Time Note 1 95 3min - 2 95 15sec - 3 60 15sec - 4 72 1min repeatsteps2-4for34cycles 5 72 5min - 6 12 - hold

[0055] 3. Agarose gel electrophoresis

[0056] (1) Select a suitable glue tank and matching glue sheet, and place the glue sheet and comb into the glue tank.

[0057] (2) Prepare the gel according to the size of the gel plate, take 1×TEA at a ratio of 1.5%-2%, weigh agarose, add them to a conical flask, mix thoroughly, and heat in a microwave until completely dissolved.

[0058] (3) Add 0.1% nucleic acid dye, shake well and pour into the gel tank, check and pop bubbles, and let it cool and solidify.

[0059] (4) Carefully remove the solidified agarose gel, pull out the comb, and fully immerse the gel and the sample wells in the TAE working solution, with the end closest to the sample well at the negative pole.

[0060] (5) 8uL of sample was loaded per well, and the band size was marked using DL2000 DNA Marker, where the band sizes were marked as 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp, respectively. Electrophoresis was performed at 120V constant voltage for 30min, and the agarose gel was placed in a gel imager for band observation and photography.

[0061] 2. Experimental results: Figure 2 As shown, when specific primers are used, F+R1 is the mutant allele primer with a fragment size of 340 bp; F+R2 is the wild-type allele primer with a fragment size of 339 bp; HE is a heterozygous mouse; and WT is a wild-type control.

[0062] Example 3TG sgMettl3-Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Genotyping and screening of tool mice

[0063] 1. Experimental Methods

[0064] 1. TG sgMettl3 Construction of mice

[0065] Use the Crisprick online tool to enter the following parameters:

[0066] (1) Reference genome: Mouse GRCm38

[0067] (2) Mechanism: CRISPRko

[0068] (3) Enzyme: SpyoCas9 (chen (2013) tracrRNA)

[0069] (4) Gene information: Mettl3 (Ensembl: ENSG00000165819)

[0070] 244 gene sequences were obtained by running the Crisprick online tool, and then the above sequences were screened according to the following two strategies: on the one hand, the comprehensive score of the sequence was as high as possible; on the other hand, the number of bases cut between two sgRNAs could not be a multiple of three.

[0071] The two Mettl3 sgRNAs were obtained as follows:

[0072] Mettl3-sgRNA1: 5'-TGCCGCCCAGGAGTTGATTG-3' (SEQ ID No. 15);

[0073] Mettl3-sgRNA2: 5'-GTTGAAAAGTTTCGCTCTCG-3' (SEQ ID No. 16).

[0074] The sgRNA expression element was designed: U6-sgRNA1-U6 sgRNA2-U6-sgRNA3-CAG-mcherry-SV40poly(A)-mcherry-P2A-GFP-bGH poly(A); the sgRNA1 was as shown in SEQ ID No.1; the sgRNA2 was as shown in SEQ ID No.2; the sgRNA3 was as shown in SEQ ID No.17, and sent to Shanghai Sangon Biotechnology Co., Ltd. for whole gene synthesis.

[0075] sgRNA3 (sgGFP encoding gene): 5′-CGAAGTTATATTAAGGGTTC-3′ (SEQ ID No. 17).

[0076] The DNA recombination method was referred to the instructions of the In-Fusion® HD Cloning Kit. The hNCR3-Tg plasmid was cut open by double digestion with BamHI and SalI to produce sticky ends. The target fragment U6-sgRNA1-U6sgRNA2-U6-sgRNA3-CAG-mcherry-SV40 poly(A)-mcherry-P2A-GFP-bGH poly(A) was amplified by PCR. The target fragment and the digested vector were recombined and identified using In-Fusion enzyme to obtain the vector plasmid PiggyBAC.

[0077] PiggyBAC mRNA and the vector plasmid PiggyBAC containing the target insert (sgRNA expression element) were injected into the fertilized eggs of C57BL / 6J mice by microinjection, and the injected fertilized eggs were transplanted into the oviducts of pseudopregnant female mice to obtain mice to be identified.

[0078] 2. DNA extraction: Cut 5 mm ear samples from the mice to be identified and transfer them to a 200 μL centrifuge tube.

[0079] Add 50 μL of mouse tissue lysis buffer and 1 μL of Proteinase K to a centrifuge tube, mix well, and centrifuge quickly for 20 seconds.

[0080] Place the centrifuge tube after centrifugation into the PCR instrument, set the program to 55℃20min, 95℃5min, and lyse the sample to extract DNA. Store the extracted DNA sample in a -40℃ refrigerator for later use.

[0081] PCR extension of target fragments: PCR extension of target fragments was performed on the mice to be identified using the primers shown in Table 4, the PCR amplification system shown in Table 5, and the PCR amplification program shown in Table 6.

[0082] Table 4TG sgMettl3 Genotype identification primer information

[0083] Primer Sequence5'-->3' PrimerType F ACAAGCTGGAGTACAACTACAACA Forward R CGGTAAGTGTCACTGATTTTGAACT Reverse

[0084] Table 5TG sgMettl3 Genotype identification reaction system

[0085] ReactionComponent Volume(μl) ddH2O 7.4 2x RapidTaqMasterMix* 10 PrimerI (10 pmol / μl) 0.8 Primer II (10 pmol / μl) 0.8 genomicDNA 1 Total 20

[0086] Table 6TG sgMettl3Genotyping reaction procedure

[0087] Step Temperature(℃) Time Note 1 95 3min - 2 95 15sec - 3 60 15sec - 4 72 2min repeatsteps2-4for34cycles 5 72 5min - 6 12 - hold

[0088] 3. Agarose gel electrophoresis

[0089] Clean the glue tank, glue board, comb, measuring cylinder and conical flask. After they are dried, put the glue board and comb into the glue tank for later use.

[0090] Add 60 mL of 1×TEA solution and 1.2 g of agar powder to a conical flask. According to the standards of our laboratory, we use 1.5% to 2% agarose content. Then use a microwave to heat the mixture to boiling. When the agar powder is completely dissolved and clear, take it out and shake it well for later use.

[0091] After the mixture has cooled slightly, add 6 μL of nucleic acid dye (diluted at a ratio of 1:1000), shake it again, pour it into the gel tank, and let it cool and solidify at room temperature. You can shake it slightly to check the solidification of the gel.

[0092] After the gel solidifies, pull out the comb and carefully transfer the gel to the electrophoresis tank, taking care to keep the TAE working solution in the electrophoresis tank clean and free of impurities.

[0093] 6 μL of sample was loaded into each well and labeled with DL2000 DNA Marker, where the band sizes were 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp, and 2000 bp, respectively. Finally, electrophoresis was performed at a constant voltage of 120 V for 30 min, and then the agarose gel was placed in a gel imager for band observation and photographing.

[0094] Experimental results: Figure 3 As shown, when specific primers were used, PCR amplified a band of 791 bp, and the positive mouse numbers identified were 1, 4, 6, 7, 8, 16, 18, 19, 24, 26, 27, 29, 30, 31, 33, 34, and 35.

[0095] 2. Pgr flpo / + Identification of mice:

[0096] Pgr flpo / + Mice were purchased from Jackson Laboratory and used in the laboratory. According to the above DNA extraction method, the genotype identification results are as follows Figure 4 As shown, the corresponding genotype identification PCR amplification system is shown in Table 2, the amplification primers are shown in Table 7, and the amplification program information is shown in Table 9. The heterozygous mouse F+R1 amplified a 193bp fragment, and F+R2 also amplified a 300bp fragment; the heterozygous mouse only amplified a 300bp fragment in F+R2.

[0097] The mouse was designed to insert the 2A-flpo sequence into the 3'UTR of the Pgr gene in mice. The endogenous Pgr promoter region directly expresses the flpo recombinase into the uterus without interfering with its gene expression.

[0098] 3. Rosa26 lsl-Cas9 / + Identification of mice:

[0099] Rosa26 lsl-cas9 / + Mice (purchased from Shanghai South Model Organisms Technology Development Co., Ltd.) are conditionally overexpressed Cas9 mice. After breeding with Cre mice, the loxp-stop-loxp fragment was deleted to express Cas9. They were propagated by the laboratory. According to the above DNA extraction method, the corresponding genotype identification PCR amplification system is shown in Table 2, the amplification primers are shown in Table 7, the amplification program information is shown in Table 10, and the genotype identification results are shown in Table 10. Figure 5 As shown, the heterozygous mouse F+R1 amplified a 275bp fragment, and F+R2 also amplified a 435bp fragment; the heterozygous mouse only amplified a 435bp fragment in F+R2.

[0100] 4. Hybridization and expansion: The above Vim fsf-Cre / + Transgenic mice and TG sgMettl3 , Pgr flpo / + 、Rosa26 lsl-Cas9 / + The mice were crossed and genotyped and screened to obtain the offspring of triple-yang and quadruple-yang mice.

[0101] Table 7TG sgMettl3 , Pgr flpo / + 、Rosa26 lsl-Cas9 / + Genotype identification primer information

[0102]

[0103] Table 8TG sgMettl3 Genotyping reaction procedure

[0104]

[0105] Table 9 Pgr flpo / + Genotyping reaction procedure

[0106]

[0107] Table 10Rosa26 lsl-Cas9 / + Genotyping reaction procedure

[0108]

[0109] 2. Experimental Results

[0110] like Figure 6 As shown, lane 1 is TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mouse, lane 2 is wild type control, lane 3 is blank control. The ear tag of mouse No. 1 is t397, and its Pgr flpo / + The mutant allele primers amplified a 193 bp band, and the wild-type allele primers also amplified a 300 bp band, which is Pgr flpo / + Hybrid. Vim fsf -Cre / + The mutant allele primers amplified a 340 bp band, and the wild-type allele primers amplified a 339 bp band, which is Vim fsf-Cre / + Heterozygous, Rosa26 lsl-Cas9 / + The mutant allele of Rosa26 was amplified with a 275 bp band, and the wild-type allele was also amplified with a 435 bp band. lsl-Cas9 / + Heterozygous. TG sgMettl3 The target gene in 2 was amplified with a 791bp band, which was positive. 2 was the wild-type mouse control, and no allele amplification band appeared.

[0111] Example 4 Immunohistochemical detection of TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Protein expression of Vimintin and METTL3 in mouse uterine epithelium

[0112] 1. Experimental Methods

[0113] 1. Solution preparation: 4% paraformaldehyde fixative: Measure 4g paraformaldehyde and dissolve it in 10mL 1×PBS and 90mL distilled water. 10×PBS: Weigh 14.2g Na2HPO4, 14.2g KH2PO4, 2g KCL, 81.8g NaCl, add deionized water to 1L. 1×PBS: Measure 100mL and add distilled water to 1000mL. Sodium citrate antigen repair solution: Weigh 1.47g trisodium citrate dihydrate and 0.18g anhydrous sodium citrate, dissolve in 300mL distilled water, add distilled water to 500mL, and adjust the pH value to 6.0. EDTA antigen repair solution: Measure 50mL 50×Tris-EDTA antigen repair solution, add 490mL distilled water, and adjust the pH to 8.0. 3% hydrogen peroxide solution: 20mL hydrogen peroxide (30%) + 180mL methanol. Blocking solution (10% goat serum): 100μL blocking goat serum + 900μL 1×PBS. Ammonia water for blueing: 1mL ammonia water + 200mL distilled water. Hydrochloric acid for color separation: 20μL salt + 20mL distilled water. Weak hematoxylin stain: 1mL hematoxylin stain solution + 3mL 1×PBS. DAB colorimetric solution: 60μL DAB colorimetric solution + A solution 1200μLDB colorimetric solution B.

[0114] 2. Preparation of paraffin sections

[0115] (1) The target mice were killed by cervical dislocation, the uterus was removed by dissection, the mesentery, fallopian tubes and ovaries were removed, and the excised uterine segments were placed in a tissue embedding frame and immersed in 4% paraformaldehyde (PFA) solution for fixation for more than 16 hours.

[0116] (2) Set the program of the fully automatic tissue dehydrator for gradient dehydration: 50% alcohol for 1 h, 70% alcohol for 1 h, 80% alcohol for 1 h, 90% alcohol for 1 h, 100% alcohol I for 1 h, 100% alcohol II for 1 h, a 1:1 mixture of alcohol and xylene for 20 min, xylene I for 10 min, xylene II for 10 min, a 1:1 mixture of xylene and paraffin for 30 min, and paraffin I for 1 h.

[0117] (3) After the dehydration machine program is completed, take out the embedding frame containing the tissue and put it into the pre-melted wax II, and fully immerse it in wax in a 70℃ oven for 1 hour. Take out the tissue from the paraffin embedding machine, pour liquid paraffin into the embedding mold, and use tweezers to quickly insert the uterine segment in the required direction. After the wax block cools and solidifies, mark it and store it for subsequent paraffin sectioning.

[0118] (4) Fix the wax block on the wooden block, trim the blade to the cutting surface range, fix it on the microtome, set the slice thickness to 5 μm, spread the slice with water drops and observe the tissue morphology under a microscope, collect the intact and flat slices and mark them, place them in a 40°C drying machine to dry overnight, and collect and store them.

[0119] 3. Immunohistochemical staining

[0120] (1) Set the slice oven to 55°C and bake the slices for 1 hour.

[0121] (2) Place the sections on a staining rack and immerse them in a xylene-containing staining jar for dewaxing for 10 minutes each time. Use an alcohol gradient of 100%, 100%, 90%, 80%, 70%, and 50% for five minutes each, and rehydrate with deionized water for five minutes.

[0122] (3) Weigh 1.47 g of trisodium citrate dihydrate and 0.18 g of anhydrous citric acid and dissolve them in 500 mL of deionized water to prepare an acidic repair solution. Heat the repair solution in a microwave oven until it boils and then add it to the slices. Heat on low heat for 10 minutes to repair the antigenic determinants. After cooling to room temperature, add it to 1× PBS for 5 minutes.

[0123] (4) Prepare 200 ml of 3% hydrogen peroxide solution by mixing 30% hydrogen peroxide and methanol in a ratio of 1:9. Place the slices in a solution for 10 minutes to block endogenous peroxidase and then wash with 1× PBS three times for 5 minutes each time.

[0124] (5) Use a histochemical pen to outline the tissue area, add 10% goat serum, and seal in a 37°C oven for 1 h.

[0125] (6) Rabbit-specific antibodies were diluted in proportion with 10% goat serum (primary antibodies). The primary antibodies used included: Anti-Progesterone Receptor A / B Rabbit mAb (1:1000), Anti-CRISPR-Cas9 Rabbit mAb (1:1000), Vimentin Rabbit mAb (1:1000), and Mettl3 Rabbit mAb (1:1000). Incubate at 4°C overnight.

[0126] (7) Recover the primary antibody and wash three times with 1× PBS, 5 min each time.

[0127] (8) Prepare goat anti-rabbit IgG solution (secondary antibody) in corresponding proportion and incubate at 37°C for 1 h.

[0128] (9) Discard the secondary antibody, wash three times with 1× PBS, 5 min each time, dilute the horseradish peroxidase (HRP) solution (tertiary antibody) in proportion, and incubate at 37°C for 40 min.

[0129] (10) Discard the tertiary antibody and wash three times with 1× PBS, each time for 5 min. Add color developing solution and develop color in real time under a microscope. Record the color development time and add deionized water to stop the color development.

[0130] (11) Stain with diluted hematoxylin for about one minute, rinse with deionized water, place in ammonia water for blueing for 2 minutes, separate with hydrochloric acid for 2 seconds, rinse with deionized water, place in ammonia water for blueing for 4 minutes, and place the sections in deionized water for 5 minutes.

[0131] (12) Dehydrate with 50%, 70%, 80%, 90%, 100%, and 100% alcohol for 2 min each, and soak in xylene I and xylene II for 3 min each.

[0132] (13) Add an appropriate amount of neutral resin and cover with a clean coverslip. After sealing, observe under a microscope and take photos.

[0133] 2. Experimental results: No. t397 is genotype TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Siyang mice, t393 is Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + In the case of Sanyang mice, black arrows indicate epithelial cells, including luminal epithelium and glandular epithelium. White arrows indicate stromal cells. LE is luminal epithelial cells, GE is glandular epithelial cells, ST is stromal cells, and the scale bar is 100 microns. Figure 4 As shown, Vimintin is normally expressed in mouse uterine stromal cells. METTL3 is expressed in the endometrium in wild-type mice and triple-positive mice t393, but in the uterus of quadruple-positive mice t397, METTL3 is mainly expressed in the endometrial epithelium, and the expression in stromal cells is significantly reduced, and Mettl3 is knocked out in the uterine stroma.

[0134] Example 5 Western blotting (WB) detection of TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Protein expression of CAS9 and METTL3 in mouse uterine epithelium

[0135] 1. Experimental Methods

[0136] 1. Solution preparation:

[0137] RIPA protein lysis buffer: RIPA 1mL, protease inhibitor 10μL; 1× SDS-PAGE protein loading buffer: 5× SDS-PAGE protein loading buffer 1mL, RIPA protein lysis buffer 4mL; 1× electrophoresis buffer: SDS-PAGE electrophoresis buffer (10×) 100mL, add distilled water to 1L; 1× transfer buffer: Western Blot transfer buffer (10×) 100mL, methanol 200mL, distilled water to 1L; 10% upper gel: upper gel solution 0.75mL, upper gel buffer 0.75mL, improved coagulant 15μL; 10% lower gel: lower gel solution 2.7mL, lower gel buffer 2.7mL, improved coagulant 60μL; 1×TBST buffer: TBST washing buffer (10×) 100mL, distilled water to 1L; 5% skimmed milk powder blocking solution: skimmed milk powder 5g, 1×TBST buffer 100mL.

[0138] 2. Preparation of mouse uterine protein samples

[0139] (1) Objective Mice were killed by spinal dislocation, and the uterus was removed by dissection. The mesentery, fallopian tubes and ovaries were removed, and the isolated uterus was cut into several segments.

[0140] (2) Add 100-250 μL of lysis buffer containing protease inhibitors for every 20 mg of tissue sample, place in grinding tubes, add 2-3 grinding beads per tube, mark the tubes, cap tightly, and homogenize thoroughly with a tissue homogenizer.

[0141] (3) Centrifuge at 13,000 rpm for 15 min at 4°C. Collect the supernatant with a pipette and aliquot it at -40°C for storage to facilitate subsequent experiments.

[0142] (4) The protein sample concentration was determined using the BCA method according to the BCA protein concentration determination kit (Pierce TM According to the BCA Protein Assay Kit instruction manual, the BCA standard (2 mg / mL) in the kit was diluted to prepare standards with concentrations of 0, 250, 500, 1000 and 2000 ng / μL. The prepared standards were fully shaken, centrifuged and stored at 4°C.

[0143] (5) Mix solution A and solution B in the kit at a volume ratio of 50:1. Prepare an appropriate amount of the mixture according to the volume of 100 μL required for each sample, vortex mix, and centrifuge for instant use.

[0144] (6) Prepare 200 μL PCR tubes for standards and samples to be tested. Add 100 μL of freshly prepared BCA working solution to each tube. Add 5 μL of gradient standards and 5 μL of protein samples to be tested in sequence. Replace the 4000 ng / μL standard with 10 μL of 2000 ng / μL standard. Vortex to mix, centrifuge briefly, and incubate in a 37°C oven for 1 h.

[0145] (7) Take 80 μL of BCA reaction solution and transfer it to a 96-well plate. Check and pop the bubbles. Place the plate in a microplate reader and set the absorbance value at a wavelength of 560 nm. Draw a binomial standard curve between the standard concentrations of 0 to 4000 ng / μL and the corresponding absorbance values. Calculate the protein concentration of the sample to be tested according to the formula.

[0146] (8) Each sample was diluted to the same concentration using RIPA protein lysis buffer, and 5× SDS-PAGE protein loading buffer was added according to one-fourth of the sample volume. The samples were vortexed, centrifuged, boiled for 5-10 min, and stored at -20°C for later use.

[0147] 3. SDS-PAGE gel preparation

[0148] (1) Prepare the glue making tools. Select a 1 mm thick long glass plate and a short glass plate. Clean them with clean pure water to remove any residue. Align the two ends of the long and short plates and insert them into the glue making bracket. Inject pure water into the glass plate to check for leakage. If leakage is found after a short period of time, reassemble them. If there is no leakage, dry them and set them aside.

[0149] (2) Use the YAZY PAGE Gel Rapid Preparation Kit (10%) to prepare a 1 mm gel according to the instructions, take 2.7 mL of the lower gel solution and lower gel buffer, and mix them thoroughly.

[0150] (3) Add 60 μL of improved coagulant to the lower glue mixture, mix well, and use a 1 mL pipette to absorb the solution. Slowly inject it into the glass plate along the edge of the short plate until the liquid surface is about 0.5 cm away from the upper edge of the glass short plate. Then add it to the upper edge of the glass short plate to solidify the lower glue.

[0151] (4) After the lower layer of gel solidifies, pour off the isopropanol, gently rinse the excess liquid with pure water, invert for several minutes to filter out the water, and carefully absorb the excess liquid with absorbent paper. Take 0.75 mL of the upper layer gel solution and upper layer gel buffer, mix well, add 15 μL of the improved coagulant, mix gently, fill the glass tank, insert the clean 1 mm tooth comb prepared in advance, and wait for the upper layer of gel to solidify.

[0152] 4. SDS polyacrylamide gel electrophoresis

[0153] (1) Place the solidified gel plate in the electrophoresis tank, pour in the freshly prepared electrophoresis buffer, carefully remove the tooth comb, observe the integrity of the tooth holes, and use a syringe to absorb the electrophoresis solution to gently rinse the sample wells to balance the liquid in the sample wells with the electrophoresis solution to avoid affecting the migration of the sampled protein.

[0154] (2) According to the experimental sequence, add 10 μL of protein sample in sequence (the loading volume is determined by the gel thickness and the tooth comb), add protein marker to one side, and add the same volume of 1× SDS-PAGE protein loading buffer to the blank well.

[0155] (3) Install the electrophoresis equipment and set the constant voltage to 100V to allow the bromophenol blue band to run out of the concentrated gel. Then adjust the voltage to 120V for electrophoresis to allow the protein marker to be completely separated. Stop the electrophoresis when the bromophenol blue band reaches the bottom of the gel.

[0156] 5. SDS-PAGE protein transfer

[0157] (1) After the protein separation by gel electrophoresis is completed, remove the gel plate, separate the short glass plate, use a gel knife to cut off the concentrated gel and the gel below the bromophenol blue, and carefully place it in the pre-cooled transfer buffer for immersion and equilibrium.

[0158] (2) Take out the pre-cut PVDF membrane with a pore size of 0.22 μm to 0.45 μm, place it in methanol for activation for 3 minutes, and then transfer it to pre-cooled transfer buffer for equilibrium. At the same time, place the filter paper and sponge pad for transfer in the pre-cooled transfer buffer for wetting.

[0159] (3) With the blackboard facing downward, stack the sponge, filter paper, SDS-PAGE gel, PVDF membrane, filter paper, and sponge from bottom to top. Be sure to use pre-cooled transfer buffer to keep the SDS-PAGE gel and PVDF membrane free of contamination and damage. Make sure they are fully soaked and avoid bubbles that may affect protein transfer. Then tighten the splint.

[0160] (4) Place the transfer clip in the transfer tank in the direction corresponding to the positive and negative poles, put it in an ice box and fill it with transfer buffer, put the transfer electrophoresis box in ice water, cover it according to the positive and negative poles, set a constant current of 150mA for 90 minutes.

[0161] 6. Immunoblotting

[0162] (1) After the transfer is completed, remove the PVDF membrane, immerse it in Ponceau red dye solution for 1 min with the side in contact with the SDS-PAGE gel facing up, then elute the dye solution with methanol and observe the protein lane.

[0163] (2) According to the molecular weight of the target protein and the protein marker band, cut the corresponding lane position, put the cut PVDF membrane into the marked incubation solution, and wash the membrane three times with 1× TBST, each time for 5 minutes.

[0164] (3) Block the membrane with freshly prepared 5% skim milk powder on a shaker at room temperature for 1 h, and wash the membrane three times with 1× TBST, each time for 5 min.

[0165] (4) Use the Western Blot primary antibody diluent of Guangzhou Shuiyuntian Company to dilute the antibody according to the proportion in the instruction manual. The primary antibodies used include: Anti-GAPDH Rabbit mAb (1:1000, CST), Anti-Progesterone Receptor A / BRabbit mAb (1:1000, CST), Anti-CRISPR-Cas9 Rabbit mAb (1:1000, CST), METTL3 Rabbit mAb (1:1000, CST). Add the corresponding primary antibody to the PVDF membrane and evenly immerse it, and incubate it on a shaker at 4°C overnight. Recover the primary antibody and wash the PVDF membrane 3 times with 1×TBST, 5 minutes each time.

[0166] (5) The secondary antibody was selected according to the source of the primary antibody and diluted 1:20,000 with 5% skim milk powder; the PVDF membrane was added with the secondary antibody and incubated on a shaker at room temperature for 1 h, the secondary antibody was discarded, and the membrane was washed 3 times with 1× TBST, each time for 5 min.

[0167] (6) According to the instructions of the ECL chemiluminescence kit, solution A and solution B were mixed in a 1:1 ratio, evenly added to the membrane, detected on a chemiluminescence instrument, photographed and saved, and analyzed.

[0168] 2. Experimental results: Figure 8 As shown, immunoblotting analysis was used to observe the protein expression in uterine tissue. T397 is TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mouse, t393 is Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl -Cas9 / + Mice, WT is wild-type mice. CAS9 protein was detected in Siyang and Sanyang mice, with no significant difference in expression levels, and no expression was found in wild-type mice, indicating that CAS9 protein was successfully induced and activated; the expression level of METTL3 protein in Siyang mice was slightly lower, and no significant changes were found between Sanyang mice and wild-type mice, proving that METTL3 protein in the uterus of Siyang mice was successfully knocked down.

[0169] Combining the results of Example 4 and Example 5, immunohistochemistry showed that there was no TG sgMettl3 In the presence of TG, METTL3 was not knocked out in the mouse uterine stroma, and its expression was consistent with that of the wild type. sgMettl3 In the genotype Siyang mice, the expression of METTL3 in stromal cells was significantly decreased, and no CAS9 expression was detected by immunohistochemistry. sgMettl3 -Pgr flpo / + -Vim fsf -Cre / + -Rosa26 lsl-Cas9 / + Mice and Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice successfully expressed CAS9, and METTL3 was also only expressed in TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Knocked out in mice.

[0170] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. An sgRNA targeting the Vim gene, characterized in that: The sequences of the sgRNA are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

2. A DNA fragment for knocking in the Vim gene, characterized in that: The DNA fragment includes an upstream homology arm, a FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression frame and a downstream homology arm from the 5' end to the 3' end; the nucleotide sequence of the upstream homology arm is the 5' end adjacent sequence of the start codon of the 1st exon of the Vimentin gene, the nucleotide sequence of the downstream homology arm is the 3' end adjacent sequence of the start codon of the 1st exon of the Vimentin genome, and the sequence of the FRT-6xSV40 pA-FRT-Kozak-iCre-WPRE-BGH pA expression frame is shown in SEQ ID NO:

3.

3. A method for constructing a Cas9 mouse capable of achieving tissue-specific knockout, characterized in that: The following steps are involved: S1. Build Vim fsf-Cre / + Mouse: Obtain Cas9 mRNA and the sgRNA described in claim 1 by in vitro transcription; Use BAC clone RP23-14I24 as a template to construct a homologous recombination vector containing the DNA fragment described in claim 2; Transfer Cas9 mRNA, sgRNA and homologous recombination vector into mouse fertilized eggs, and then obtain through genotype screening; S2. Build Pgr Flpo / + Mouse: The 2A-flop sequence was inserted into the 3'UTR of the Pgr gene and then obtained by genotypic screening; S3. Build Pgr flpo / + -Vim fsf-Cre / + Mouse: Vim fsf-Cre / + Mice and Pgr Flpo / + Mouse hybridization, through genotype screening to obtain double positive mice Pgr flpo / + -Vim fsf-Cre / + Mice; S4. Pgr flpo / + -Vim fsf-Cre / + Mouse and Rosa26 lsl-Cas9 / + Mice were crossed and Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice, that is, Cas9 mice that can achieve tissue-specific knockout.

4. Use of the Cas9 mouse capable of achieving tissue-specific knockout obtained by the method of claim 3 in constructing a tissue-specific knockout animal model.

5. Uterine stromal conditional knockout mouse TG sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + The construction method is characterized in that Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + Mice and TG sgMettl3 The uterine matrix conditional knockout mice TG were obtained by genotyping. sgMettl3 -Pgr flpo / + -Vim fsf-Cre / + -Rosa26 lsl-Cas9 / + .

6. The construction method according to claim 5, characterized in that: The TG sgMettl3 The mouse was constructed by integrating the DNA fragment of the sgRNA targeting Mettl3 into the mouse genome using the PiggyBAC transposase system, and then obtained through genotype identification and screening.

7. The construction method according to claim 6, characterized in that: The DNA fragment of the sgRNA targeting Mettl3 includes U6 promoter, Mettl3-sgRNA1, U6 promoter, Mettl3-sgRNA2, U6 promoter, sgGFP encoding gene, CAG promoter encoding gene, mcherry encoding protein, SV40 poly (A) encoding gene, mcherry encoding protein, P2A peptide encoding gene, GFP encoding gene, and bGH poly (A) encoding gene from 5' to 3' end.

Images