Recombinant duck plague virus for expressing DTMUV virus-like particles as well as construction method and application of recombinant duck plague virus

Abstract

The invention provides a recombinant duck plague virus for expressing DTMUV virus-like particles as well as a construction method and application of the recombinant duck plague virus, and belongs to the field of medicines. The invention provides recombinant polynucleotide which is derived from a duck tembusu virus genome and is subjected to codon optimization by taking a duck as a host. According to the invention, the recombinant polynucleotide is inserted into pEP-BGH-end, and a plasmid pEP-pCMV-CME451 is constructed and obtained. According to the invention, pEP-pCMV-CME451 plasmid is taken as a template, and a recombinant exogenous expression cassette is inserted into a duck plague virus vaccine strain, so that recombinant duck plague mutant BAC clone is obtained. According to the invention, the BAC clone is also rescued. Compared with a control strain rE1, the rescue virus provided by the invention has a larger plaque area, and can detect corresponding DTMUV virus E protein and generate an antibody aiming at the E protein. Under a transmission electron microscope, after virus infection CEFs is saved, DTMUV C-M-E451 forms a virus-like particle structure.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and in particular relates to a recombinant duck plague virus expressing DTMUV virus-like particles and a construction method and application thereof. Background Art

[0002] Duck Tembusu virus (DTMUV) and other waterfowl TMUVs all have flavivirus properties. Therefore, the development of a DTMUV vaccine is very urgent. At present, there are commercialized DTMUV inactivated vaccines (HB strain) and attenuated vaccines (WF100 strain). These vaccines each have their own advantages and disadvantages. The inactivated vaccine is highly safe but expensive, while the attenuated vaccine has certain safety risks. Duck plague is an acute, febrile, septicemic infectious disease of ducks, geese and other Anseriformes. The disease is widespread, spreads rapidly, has high morbidity and mortality, and has caused huge economic losses to the poultry industry.

[0003] The prevention and control of duck plague currently relies mainly on the traditional duck plague chicken embryo attenuated live vaccine, which is widely used in waterfowl production. It has the characteristics of good immune effect and high safety, and can also overcome the interference of maternal antibodies. However, it cannot distinguish between immune ducks and naturally infected ducks, which affects the immune detection and monitoring of the disease. This is also a problem that vaccine researchers urgently need to solve.

[0004] In addition to the characteristics of herpes virus, the commercialized attenuated vaccine strain of duck plague virus (DEV) has been widely used for the prevention and control of DEV. Therefore, DEV is an excellent candidate for the viral vector for the development of waterfowl vaccines. So far, researchers have tried to use DEV as a vector to insert the antigen genes of infectious bursal disease virus, duck viral hepatitis virus type I and type III, Newcastle disease virus, H5N1 subtype avian influenza virus (AIV), H5N6 subtype AIV, H5N8 subtype AIV, H9N2 subtype AIV, DTMUV, goose parvovirus, and goose H5 subtype avian influenza virus into the DEV genome for the development of related bivalent vaccines. Chen et al. inserted the DTMUV truncated form of E protein (TE) with prefix signal peptide tPAS and the E truncated form (prM / TE) expressed in tandem with prM into the genome of DEV vaccine strain US7 / US8, and obtained two recombinant duck plague viruses. The virus infected chicken embryo fibroblasts can express exogenous proteins and induce ducks to produce E protein antibodies. After two immunizations, rDEV-PrM / TE can completely protect ducks from DTMUV attack, while rDEV-TE can only protect some ducks from DTMUV attack. The study showed that the addition of tTPA signal peptide increased the expression of E protein and the production of secretory protein. Zou et al. also succeeded in expressing the full-length E gene of DTMUV using DEV as a vector. The recombinant virus C-KCE-E can protect ducks from DEV strong toxin attack and produce DTMUV E protein neutralizing antibodies. Afterwards, Zou et al. cloned H5N1 subtype avian influenza virus HA and DTMUVprM-E into the genome of DEV vaccine strain at the same time, and obtained recombinant virus C-KCE-HA / PrM-E, which can induce some ducks to produce neutralizing antibodies against H5N1 subtype AIV and DTMUV, but also can induce humoral immunity in the body. Vaccination with recombinant virus can protect ducks from DEV, H5N1 subtype AIV and DTMUV. After long-term research, we have also constructed recombinant duck plague virus expressing different forms of DTMUV E antigen and optimized its expression conditions. Although these studies have achieved good results, there is no report on using duck plague virus as a vector to express DTMUV virus-like particles. Summary of the invention

[0005] The invention provides a recombinant duck plague virus expressing DTMUV virus-like particles, a construction method and an application thereof. The recombinant virus can form DTMUV virus-like particles (VLPs) and can stably induce ducks to produce specific antibodies against DTMUV E protein.

[0006] The present invention provides a recombinant polynucleotide, comprising a C gene, a prM gene and a truncated E gene connected in sequence;

[0007] The C gene, prM gene and truncated E gene are all derived from the duck Tembusu virus genome, and codon optimization is performed using duck as a host before the connection.

[0008] In a specific embodiment of the present invention, the nucleotide sequence of the C gene after codon optimization includes the sequence shown in SEQ ID No.1;

[0009] The nucleotide sequence of the codon-optimized prM gene includes the sequence shown in SEQ ID No.2.

[0010] In a specific embodiment of the present invention, the truncated E gene includes a truncated E gene that retains only the amino acid sequence 1-451;

[0011] The nucleotide sequence of the truncated E gene includes the sequence shown in SEQ ID No.3.

[0012] The present invention provides a recombinant plasmid comprising the recombinant polynucleotide.

[0013] In a specific embodiment of the present invention, the basic backbone plasmid of the recombinant plasmid includes pEP-BGH-end plasmid.

[0014] The present invention provides the use of the above recombinant polynucleotide or the above recombinant plasmid in constructing a recombinant duck plague virus.

[0015] The present invention provides a method for constructing a recombinant duck plague virus mutant BAC clone, comprising the following steps:

[0016] (1) Insert the above recombinant polynucleotide into pEP-BGH-end to obtain the recombinant plasmid pEP-pCMV-CME 451 ;

[0017] (2) Using the recombinant plasmid pEP-pCMV-CME described in step (1) 451 The primer pair was used as a template for PCR amplification, and the PCR amplified fragment was transformed into the competent cells of the strain to screen and obtain the recombinant clone intermediate ppCMV-kan.CME containing the Kan marker. 451 ; The strain competent cell is a strain carrying the infectious BAC clone (pDEV-EF1, abbreviated as pE1) of the duck plague virus vaccine strain; the primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID No.4 and a downstream primer with a nucleotide sequence as shown in SEQ ID No.5;

[0018] (3) Removing the recombinant clone intermediate ppCMV-kan.CME obtained in step (2) by homologous recombination 451The Kan gene was expressed in 247 samples of duck plague virus and a recombinant duck plague virus mutant BAC clone was constructed.

[0019] The present invention also provides a recombinant duck plague virus mutant BAC clone obtained by the construction method.

[0020] The present invention also provides a recombinant virus obtained by rescuing the recombinant duck plague virus mutant BAC clone.

[0021] The present invention also provides virus-like particles prepared by using the above-mentioned recombinant duck plague virus mutant BAC clone or the above-mentioned recombinant virus.

[0022] The present invention also provides the use of the recombinant duck plague virus mutant BAC clone, the recombinant virus or the virus-like particle in preparing a vaccine.

[0023] In a specific embodiment of the present invention, the vaccine comprises a dual live vaccine.

[0024] The present invention also provides a vaccine, comprising the above-mentioned recombinant duck plague virus mutant BAC clone, the above-mentioned recombinant virus or the above-mentioned virus-like particle, and pharmaceutically acceptable adjuvants.

[0025] Beneficial effect: The present invention provides a recombinant polynucleotide (CME) derived from the duck Tembusu virus genome and codon-optimized in ducks as hosts. 451 Gene), including C gene, prM gene and truncated E gene connected in sequence. The present invention inserts the recombinant polynucleotide into pEP-BGH-end to construct the plasmid pEP-pCMV-CME 451 .

[0026] The present invention uses pEP-pCMV-CME 451 The plasmid was used as a template, and a recombinant duck plague mutant BAC clone was obtained through "Red E / T two-step recombination", such as the recombinant BAC clone intermediate ppCMV-kan.CME containing the Kan marker. 451 ; and pCMV-CME containing only pCMV-CME after the Kan gene is removed 451 -BGH-pA expression cassette recombinant ppCMV-CME 451 .

[0027] The present invention utilizes chicken embryo fibroblasts (CEFs) to treat ppCMV-CME 451 Rescue and obtain rpCMV-CME 451 The rpCMV-CME of the present invention 451 The plaque area increased by 46% compared with rE1; rpCMV-CME 451After infecting cells, the corresponding DTMUV virus E protein can be detected, showing three bands, which are suspected to be E-containing before and after the cleavage of the exogenous protein. 451 Protein band: CME 451 (81.31 kDa), ME 451 (68.03 kDa) and E 451 (49.06 kDa). Under transmission electron microscopy, rpCMV-CME 451 After viral infection of CEFs, DTMUV CME 451 Formation of virus-like particles (VLPs) structure; recombinant virus rpCMV-CME 451 Infected ducks can produce antibodies against E protein, and the antibody positive conversion rate reaches 100% at 1 week after the second immunization. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The results of Xba I restriction enzyme digestion of the recombinant mutant BAC clone are shown in Figure 1, where M in a: Marker; 1: pE1; 2: pkan.pCMV.CME 451 ; 3: ppCMV.CME 451 ;M in b: Marker; 1: pE1 (641bp); 2: pkan.pCMV.CME 451 (4956bp); 3: ppCMV.CME 451 (3900 bp);

[0029] Figure 2 Fluorescence microscopy images of rescued recombinant viruses (100×);

[0030] Figure 3 The figure shows the results of measuring and comparing the plaque area of ​​the recombinant virus on cells;

[0031] Figure 4 This is the result of Western blotting to detect the expression of E protein in cells infected with recombinant virus;

[0032] Figure 5 This is the result of immunoelectron microscopy observation of DTMUV virus protein expression;

[0033] Figure 6 This is a diagram showing the formation of virus-like particles observed using transmission electron microscopy. DETAILED DESCRIPTION

[0034] The present invention provides a recombinant polynucleotide, comprising a C gene, a prM gene and a truncated E gene connected in sequence;

[0035] The C gene, prM gene and truncated E gene are all derived from the duck Tembusu virus genome, and codon optimization is performed using duck as a host before the connection.

[0036] In a specific embodiment of the present invention, the duck Tembusu virus genome is GenBank: JF270480, and the DTMUV C\prM\E sequence is referred to, and ducks are used as hosts to perform codon optimization to synthesize C-prM-truncated E 1-451 Sequence, obtain CME 451

[0037] The recombinant polynucleotide of the present invention is obtained by sequentially connecting SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, and the encoded amino acid sequence is shown in SEQ ID No.6:.

[0038] The present invention provides a recombinant plasmid comprising the recombinant polynucleotide.

[0039] In a specific embodiment of the present invention, the basic skeleton plasmid of the recombinant plasmid includes a pEP-BGH-end plasmid. In one embodiment of the present invention, restriction sites are inserted into both ends of the recombinant polynucleotide sequence, such as a PstI-Kozak sequence and a NotI restriction site are introduced into the 5' and 3' ends, respectively, and the fragment is double-digested and then inserted into pEP-BGH-end to obtain a recombinant plasmid pEP-pCMV-CME 451 In the present embodiment, a PstI-Kozak sequence (SEQ ID No.7: ctgcagccaccATGGga) was introduced into the 5' end of the fragment, and a NotI (GCGGCCGC) was introduced into the 3' end to form a complete sequence of the recombinant polynucleotide, as shown in SEQ ID No.10.

[0040] The present invention provides the use of the above recombinant polynucleotide or the above recombinant plasmid in constructing a recombinant duck plague virus.

[0041] The present invention provides a method for constructing a recombinant duck plague virus mutant BAC clone, comprising the following steps:

[0042] (1) Insert the above recombinant polynucleotide into pEP-BGH-end to obtain the recombinant plasmid pEP-pCMV-CME 451 ;

[0043] (2) Using the recombinant plasmid pEP-pCMV-CME described in step (1) 451 The primer pair was used as a template for PCR amplification, and the PCR amplified fragment was transformed into the competent cells of the strain to screen and obtain the recombinant clone intermediate ppCMV-kan.CME containing the Kan marker. 451 ; The strain competent cell is a strain carrying an infectious BAC clone of a duck plague virus vaccine strain; the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID No.4 and a downstream primer having a nucleotide sequence as shown in SEQ ID No.5;

[0044] (3) Inducing the recombinant clone intermediate ppCMV-kan.CME obtained in step (2) 451 The Kan gene was removed and a recombinant duck plague virus mutant BAC clone was constructed.

[0045] The recombinant plasmid pEP-pCMV-CME of the present invention 451 The construction method is the same as the above content and will not be repeated here.

[0046] In one embodiment of the present invention, pEP-pCMV-CME 451Plasmid was used as template and primer pair pDEVvac-in-s / pDEVvac-in-as was used to amplify a PCR fragment of 4403 bp in length:

[0047] pDEV vac-in-s (SEQ ID No. 4): 5'-TACTAATTTAAGTGTGCAGCCTGGTTAACTGTATTATGCGCGGAgcgatgtacg ggccagata-3';

[0048] pDEV vac-in-as (SEQ ID No. 5): 5'-TCCGTAGTCTGGCCGGCAGTATGTTGGTGTTTAGTACTCCAAACCCATAG AGCCCACCGCATCCCC-3'.

[0049] The primer pair pDEVvac-in-s / pDEVvac-in-as of the present invention is used to transfer the expression cassette pCMV-CME 451 -BGH-pA is inserted between the US7 and US8 genes of the DEV genome.

[0050] The present invention transforms the PCR fragment into the competent cells of the strain, and the transformation method can be electrotransformation. For example, in the embodiment, the PCR fragment is electrotransformed into the pDEV-EF1 / GS1783 competent cells by the electrotransformation method, and the PCR fragment is transformed into pCMV-CME through the DEV genome homology arm on its own sequence. 451 -BGH-pA expression cassette and screening gene kanamycin (Kan) are inserted into pDEV-EF1 / GS1783. The pDEV-EF1 / GS1783 of the present invention is a strain carrying the infectious BAC clone of duck plague virus vaccine strain, which is constructed and preserved by the Poultry Disease Research Laboratory of the Institute of Animal Husbandry and Veterinary Medicine of Zhejiang Academy of Agricultural Sciences and has been disclosed in the article (Chen L et al, Virol. J. 2013, 10, 328; Chen Liu et al, Journal of Zhejiang Agricultural Sciences, 2015, 7 (11): 1889-1895.).

[0051] In the present embodiment, the obtained recombinant BAC clones were also identified by PCR, and the recombinant BAC clone intermediate ppCMV-kan.CME containing the Kan marker was screened. 451 Then, the Kan gene carried by the pEP-BGH-end plasmid vector was removed by homologous recombination to obtain a plasmid containing only pCMV-CME 451 -BGH-pA expression cassette recombinant. Use identification primers to perform PCR amplification on JD-F / JD-R, send the amplified fragment for sequencing, and screen out the correct clone ppCMV-CME451 In one embodiment of the present invention, the sequence of the identification primer pair JD-F / JD-R can be as follows:

[0052] JD-F (SEQ ID No. 8): 5'-CTACCACAAGCGTCATCAACCA-3';

[0053] JD-R (SEQ ID No. 9): 5'-TGTCCATTACCAAATCCGAAAA-3'.

[0054] The present invention also provides a recombinant duck plague virus mutant BAC clone obtained by the construction method.

[0055] The present invention also provides a recombinant virus obtained by rescuing the recombinant duck plague virus mutant BAC clone.

[0056] The present invention does not specifically limit the method for rescuing the virus. In one embodiment, alkaline lysis method can be used to extract ppCMV-CME 451 , transfect CEFs according to the calcium phosphate transfection kit operating instructions, place in a 37℃ 5% CO2 incubator, and collect cells and supernatant after 70-80% fluorescent spots appear, which is the rescued virus liquid, named rpCMV-CME 451 .

[0057] The present invention also provides virus-like particles prepared by using the above-mentioned recombinant duck plague virus mutant BAC clone or the above-mentioned recombinant virus.

[0058] In the embodiment of the present invention, the rpCMV-CME 451 After the virus infected CEFs, DTMUV CME was observed under structural transmission electron microscopy. 451 Virus-like particles (VLPs) structures were formed.

[0059] The present invention also provides the use of the recombinant duck plague virus mutant BAC clone or the recombinant virus or the virus-like particle in preparing a vaccine.

[0060] In a specific embodiment of the present invention, the vaccine comprises a dual live vaccine. The present invention embodiment was verified and found that rpCMV-CME 451 The virus can stably induce ducks to produce specific antibodies against the E protein of DTMUV virus, laying the foundation for the study of duck plague virus and duck Tembusu virus bivalent live vaccine.

[0061] The present invention also provides a vaccine, comprising the above-mentioned recombinant duck plague virus mutant BAC clone or the above-mentioned recombinant virus or the above-mentioned virus-like particle, and pharmaceutically acceptable excipients.

[0062] To further illustrate the present invention, the recombinant duck plague virus expressing DTMUV virus-like particles and its construction method and application provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0063] Unless otherwise specified, the reagents and materials used in the examples of the present invention are conventional commercial products in the art and can be obtained through conventional commercial channels:

[0064] The pDEV-EF1 / GS1783 strain (a strain carrying the infectious BAC clone of the duck plague virus vaccine strain) and the corresponding rE1 virus strain were constructed and preserved by the Poultry Disease Research Laboratory, Institute of Animal Husbandry and Veterinary Medicine, Zhejiang Academy of Agricultural Sciences; the pEP-BGH-end plasmid was constructed and preserved by this laboratory (Chen L et al, Virol. J. 2013, 10, 328; Chen Liu et al, Journal of Zhejiang Agricultural Sciences, 2015, 7(11): 1889-1895.).

[0065] KOD enzyme was purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.; restriction endonuclease, gel purification kit, quick ligation kit, WesternBLoT Chemiluminescence HRP Substrate chemiluminescent substrate was purchased from Yubao Bioengineering (Dalian) Co., Ltd.; plasmid extraction kit was a product of Omega; Trans-T1 chemical competent cells and protein molecular weight Marker (EasySee WesternMarker) were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; fetal bovine serum was a product of Gibco BRL; calcium phosphate transfection kit was a product of Promega; DMEM high glucose medium was purchased from Shanghai Jinuo Biotechnology Co., Ltd.; enzyme-labeled secondary antibodies (HRP-labeled goat anti-mouse IgG, HRP-labeled goat anti-rabbit IgG) were purchased from Santa Cruz; GFP monoclonal antibody was purchased from Beyotime Biotechnology Co., Ltd.

[0066] Chicken embryo fibroblasts (CEFs) were prepared by trypsin digestion of 9-11 day old SPF chicken embryos. SPF chicken embryos were provided by the Zhejiang Academy of Agricultural Sciences Poultry Hatching Base. SPF ducks were purchased from the Experimental Animal Center of Harbin Veterinary Research Institute, Chinese Academy of Sciences.

[0067] Example 1

[0068] 1. pEP-pCMV-CME 451 Plasmid construction

[0069] Referring to the DTMUV C\prM\E sequence (GenBank: JF270480), codon optimization was performed using duck as the host to synthesize C-prM-truncated E 1-451 Sequence, obtain CME 451 Gene, Pst I and Not I restriction sites were introduced at the 5' and 3' ends respectively, the fragment (SEQ ID No.10) was double-digested and then inserted into pEP-BGH-end, positive clones were obtained by PCR and restriction enzyme screening, and sent to Hangzhou Qingke Biological Co., Ltd. for sequencing. The positive clones were named pEP-pCMV-CME 451 .

[0070] 2. Construction of recombinant duck plague virus mutant BAC clone

[0071] Each recombinant duck plague mutant BAC clone was obtained by "Red E / T two-step recombination". 451 The plasmid was used as a template and a primer pair pDEVvac-in-s / pDEVvac-in-as (SEQ ID No. 4 / SEQ ID No. 5) was used to amplify a PCR fragment with a length of 4403 bp.

[0072] The PCR fragment was electroporated into pDEV-EF1 / GS1783 competent cells. The PCR fragment was transferred to pCMV-CME through the DEV genome homology arm on its own sequence. 451 -BGH-pA expression cassette and screening gene kanamycin (Kan) were inserted into pDEV-EF1 / GS1783. The obtained recombinant BAC clones were identified by PCR, and the recombinant BAC clone intermediate ppCMV-kan.CME containing Kan marker was screened. 451 Then, the Kan gene was removed by the homologous sequence carried by the pEP-BGH-end plasmid vector to obtain a plasmid containing only pCMV-CME 451 -BGH-pA expression cassette recombinant. Use identification primer pair JD-F / JD-R (SEQ ID No.8 / SEQ ID No.9) for PCR amplification, send the amplified fragment for sequencing, and screen out the correct clone ppCMV-CME 451 .

[0073] The recombinant duck plague virus BAC mutant clones and Kan intermediates were extracted respectively, digested with Xba I, and the electrophoresis identification results were as follows: Figure 1 As shown in a, the DNA electrophoresis pattern is basically consistent with the prediction based on the duck plague virus reference sequence included in GenBank (accession number KF487736.1). At the same time, the size of the PCR fragment amplified by the JD-F / JD-R identification primer pair ( Figure 1b) and the sequences are consistent with expectations, indicating that the exogenous gene was inserted into the genome of the duck plague virus vaccine strain as expected.

[0074] 3. Rescue of recombinant viruses

[0075] Extraction of ppCMV-CME by alkaline lysis 451 , transfect CEFs according to the calcium phosphate transfection kit operating instructions, place in a 37℃ 5% CO2 incubator, and collect cells and supernatant after 70-80% fluorescent spots appear, which is the rescued virus liquid, named rpCMV-CME 451 .

[0076] The transfected cells were observed under a fluorescence microscope 48 hours after infection. Figure 2 As shown, fluorescent plaques were found in the transfection wells. The cells were cultured until 70-80% of the cells showed fluorescent plaques, and then the cells and supernatant were collected to rescue the recombinant virus.

[0077] 4. Determination of recombinant virus plaque size

[0078] rpCMV-CME 451 The rE1 virus solution was diluted and inoculated on a monolayer of CEFs, washed once with PBS (pH 7.2) after 90 minutes, covered with 1.5% methylcellulose, and placed in a cell culture incubator for 48 hours. 100 photos of each virus fluorescent plaque were taken under a fluorescence microscope, and the virus plaque area was measured using Image J software, and the average value was calculated. The rE1 virus strain plaque area was used as a reference, and its area was set as 100%. The plaque area of ​​other strains of viruses was converted into percentages based on this as a standard. SPSS11.5 software was used to perform statistical analysis on these data.

[0079] The results of virus plaque area determination were as follows Figure 3 As shown, compared with rE1, rpCMV-CME 451 The plaque area increased by 46% compared with rE1.

[0080] 5. Protein expression analysis

[0081] RpCMV-CME 451and control strain rE1 in CEFs cells, culture until the cells show more than 90% fluorescence, and collect the cell pellet. After the collected cells are treated with loading buffer, SDS-PAGE electrophoresis is performed and transferred to a nitrocellulose NC membrane. Take out the NC membrane and put it in a blocking solution containing 10% skim milk at 4°C overnight. Mouse anti-TUMV E protein DIII domain monoclonal antibody (1:500 dilution) was used as the primary antibody, and HRP-labeled goat anti-mouse (1:5000 dilution) was used as the secondary antibody for incubation at 37°C for 1h. Finally, Western BLoT Chemiluminescence HRP Substrate chemiluminescent substrate was used for color development, and the gel imager was placed for band exposure.

[0082] Each recombinant strain was used to infect CEFs, and the cell samples were subjected to SDS-PAGE electrophoresis and membrane transfer. Mouse anti-TUMVE protein DIII domain monoclonal antibody was used as the primary antibody for Western blotting detection. The results are shown in Figure 4 As shown, compared with the control strain rE1 infected cell samples, rpCMV-CME 451 Three bands appeared in the infected cell samples, which were suspected to be bands containing E451 protein before and after cleavage of exogenous protein: CME451 (81.31 kDa), ME451 (68.03 kDa) and E451 (49.06 kDa).

[0083] 6. Immunoelectron microscopy observation of VLPs formation

[0084] Take rpCMV-CME 451 The infected cell samples were commissioned to Hawke Biotech for immunoelectron microscopy observation. The primary antibody used was E protein DIII monoclonal antibody (1:500).

[0085] Immunoelectron microscopy results Figure 5 As shown, rpCMV-CME 451 The corresponding DTMUV virus E protein can be detected in virus-infected CEFs; the transmission electron microscopy results are as follows Figure 6 As shown, in rpCMV-CME 451 In virus-infected CEFs, DTMUV CME 451 Virus-like particles (VLPs) structures were formed.

[0086] 7. Virus purification

[0087] Collection of rpCMV-CME virus 4515mL of infected cell culture supernatant was first centrifuged at 4℃, 12000rpm for 30min to perform preliminary purification and remove cell impurities. Collect the supernatant and perform sucrose density gradient centrifugation. The specific operation is as follows: add 2mL of 30%, 40%, 50% and 60% sucrose solution to the centrifuge tube, then add the sample to be purified, balance at 4℃ for 4h, and then centrifuge at 4℃, 38000rpm for 2h. Carefully remove the target band. Take out 10μL of solution, perform conventional negative staining, and then observe under a JEM-1200EX electron microscope.

[0088] 8. Animal experiments

[0089] Thirty 30-day-old SPF ducks were randomly divided into three groups (n=10) and kept in different rooms. 6 TCID 50 rE1,1×10 6 TCID 50 rpCMV-CME 451 , and set up cell culture as negative control group. Blood was collected 1, 2 and 3 weeks after immunization, and serum was separated. After 3 weeks, the same dose was inoculated for secondary immunization. Blood was collected 1, 2 and 3 weeks after the second immunization, and the production of DTMUV E antibody was detected using the indirect ELISA detection method for duck Tembusu virus antibody established by Yu Bin et al. (Yu Bin et al., Zhejiang Animal Husbandry and Veterinary Medicine, 2014(05):1-6).

[0090] In order to clarify the recombinant virus rpCMV-CME 451 To investigate whether infected ducks can produce antibodies against E protein, blood samples were collected from three groups of 40-day-old ducks negative for Tembusu virus and duck plague antibodies at 1, 2, and 3 weeks after immunization and at 1, 2, and 3 weeks after 2 immunizations. Serum was separated and the levels of DTMUV E antibodies were tested. The results are shown in Tables 1 and 2. 451 The antibody positive conversion rate of the recombinant virus immunization group was 100% at 1 week after the second immunization, while the E antibody of the rE1 group and the cell culture fluid group (NC) was negative. In Tables 1 and 2, NC-pre-immunization (pre-immunization control group); NC-1 immunization-1w (control group was counted as 1w according to the immunization time of other groups); rE1-1 immunization-1w (1w after the first immunization of the rE1 group); CME 451 -1 free -1w (immune rpCMV-CME 451 1 week after the first immunization of the rE1 group); NC-1 immunization - 2 weeks (the control group was counted as 2 weeks according to the immunization time of other groups); rE1-1 immunization - 2 weeks (2 weeks after the first immunization of the rE1 group); CME 451 -1-2 weeks (immunity to rpCMV-CME 4512 weeks after the first immunization of the rE1 group); NC-1 immunization - 3 weeks (the control group is counted as 3 weeks according to the immunization time of other groups); rE1-1 immunization - 3 weeks (3 weeks after the first immunization of the rE1 group); CME 451 -1-3 weeks (immunity to rpCMV-CME 451 NC-2 immunization - 1w (control group is calculated as 1w for the second immunization of other immunization groups), rE1-2 immunization - 1w (rE1 immunization group is calculated as 1w for the second immunization); CME 451 -2 free-1w (immune rpCMV-CME 451 1 week after the second immunization of the rE1 group); NC-2 immunization - 2 weeks (the control group is calculated as 2 weeks after the second immunization of the other immunization groups), rE1-2 immunization - 2 weeks (the rE1 group is immunized 2 weeks after the second immunization); CME 451 -2 free-1w (immune rpCMV-CME 451 NC-2 immunization - 3 weeks (control group is calculated as 3 weeks according to the second immunization of other immunization groups), rE1-2 immunization - 3 weeks (rE1 immunization group is calculated as 3 weeks after the second immunization); CME 451 -2-3 weeks (immunity to rpCMV-CME 451 Group 2 (3 weeks after the second immunization).

[0091] Table 1 Antibody production of DTMUV E in ducks inoculated with recombinant virus

[0092]

[0093] Table 2 Antibody production of DTMUV E in ducks inoculated with recombinant virus

[0094]

[0095]

[0096] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant polynucleotide, characterized in that It includes a C gene, a prM gene and a truncated E gene connected in sequence; The C gene, prM gene and truncated E gene are all derived from the duck Tembusu virus genome, and codon optimization is performed using duck as the host before the ligation; Preferably, the nucleotide sequence of the C gene after codon optimization includes the sequence shown in SEQ ID No.1; The nucleotide sequence of the codon-optimized prM gene includes the sequence shown in SEQ ID No. 2; Preferably, the truncated E gene includes a truncated E gene that retains only the amino acid sequence of positions 1-451; The nucleotide sequence of the truncated E gene includes the sequence shown in SEQ ID No.

3.

2. A recombinant plasmid comprising the recombinant polynucleotide according to claim 1.

3. The recombinant plasmid according to claim 2, characterized in that: The basic skeleton plasmid of the recombinant plasmid includes pEP-BGH-end plasmid.

4. Use of the recombinant polynucleotide according to claim 1 or the recombinant plasmid according to claim 2 or 3 in constructing a recombinant duck plague virus.

5. A method for constructing a recombinant duck plague virus mutant BAC clone, characterized in that: The following steps are involved: (1) Inserting the recombinant polynucleotide of claim 1 into pEP-BGH-end to obtain the recombinant plasmid pEP-pCMV-CME 451 ; (2) Using the recombinant plasmid pEP-pCMV-CME described in step (1) 451 The primer pair was used as a template for PCR amplification, and the PCR amplified fragment was transformed into the competent cells of the strain to screen and obtain the recombinant clone intermediate ppCMV-kan.CME containing the Kan marker. 451 ; The strain competent cell is a strain carrying an infectious BAC clone of a duck plague virus vaccine strain; the primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID No.4 and a downstream primer having a nucleotide sequence as shown in SEQ ID No.5; (3) Removing the recombinant clone intermediate ppCMV-kan.CME obtained in step (2) by homologous recombination 451 The Kan gene was expressed in 247 samples of duck plague virus and a recombinant duck plague virus mutant BAC clone was constructed.

6. A recombinant duck plague virus mutant BAC clone obtained by the construction method of claim 5.

7. A recombinant virus obtained by rescuing the recombinant duck plague virus mutant BAC clone according to claim 6.

8. Virus-like particles prepared from the recombinant duck plague virus mutant BAC clone according to claim 6 or the recombinant virus according to claim 7.

9. Use of the recombinant duck plague virus mutant BAC clone according to claim 6, the recombinant virus according to claim 7 or the virus-like particle according to claim 8 in the preparation of a vaccine.

10. A vaccine, characterized in that It comprises the recombinant duck plague virus mutant BAC clone according to claim 6, the recombinant virus according to claim 7 or the virus-like particle according to claim 8, and pharmaceutically acceptable excipients.

Images