A gene of Amygdalus cyperus carbonyl transferase AqCGT51 and its application in preparing bergenin

Abstract

The invention relates to a kind of cyperus argyi carbonyl transferase AqCGT51 The invention discloses a gene and its application in preparing bergenin, belonging to the field of biotechnology. AqCGT51 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the full length of the sequence is 1455 bp; the amino acid sequence of the encoded protein is shown in SEQ ID NO.2, and it encodes 484 amino acid residues. AqCGT51 The gene can be used as a biosynthesis regulatory gene for bergenin and can be used to prepare bergenin. It has significant application prospects and is easy to promote and apply.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a gene of Amygdalus cyperus carbonyl transferase AqCGT51 and application thereof in preparing bergenin. Background Art

[0002] Ardisia quinquegona is a plant of the genus Ardisia in the family Primulaceae. This genus is mainly produced in Guangdong, Guangxi, Fujian, Taiwan, Yunnan and other places in China. It is also distributed from the Malay Peninsula to the Ryukyu Islands. It is commonly found on hillsides and forests at an altitude of 200-1000 meters, and is more common in the shade and wet places beside streams in the forest. Ardisia quinquegona contains many medicinal ingredients, and bergenin is one of the main active ingredients. Bergenin has attracted widespread attention due to its various pharmacological activities, such as antitussive, anti-inflammatory, anti-anxiety, antioxidant, anti-malarial, anti-cancer, treatment of diabetes, anti-hepatotoxicity, immunomodulation and neuroprotection. Unlike morphine-like central inhibitory cough suppressants, bergenin has a selective inhibitory effect on the cough center and has no inhibitory effect on other nerve centers. It has the characteristics of small toxic side effects, few adverse reactions, and no drug resistance after continuous use. Bergenin has been made into various dosage forms and is widely used in China to treat respiratory diseases, such as compound bergenin tablets, bergenin capsules, etc.

[0003] The precursor of bergenin biosynthesis is 2-glucose-4-methoxygallic acid, which is generated by intramolecular dehydration, rearrangement and ring closure; 2-glucose-4-methoxygallic acid is generated by 4-methoxygallic acid connecting glucose at the 2-position with uridine diphosphate glucose (UDP-glucose) as the glycosyl donor under the catalysis of carbon glycosyltransferase (CGT); 4-methoxygallic acid is catalyzed by gallic acid oxygen methyltransferase (OMT) with gallic acid as substrate and S-adenosyl-methionine (SAM) as the methyl donor; gallic acid is catalyzed by shikimate dehydrogenases (SDH) with NADP+ as the proton donor.

[0004] With the increasing number of chronic bronchitis diseases, the gap in raw materials for bergenin is increasing. At present, the raw materials for bergenin on the market are mainly obtained by extraction, and the annual demand for dry medicinal materials for extracting bergenin has reached more than 2,000 tons. The extensive mining in recent decades has caused a sharp decline in wild resource reserves and is on the verge of exhaustion. At the same time, the high altitude, many mountainous areas and cold climate conditions in the origin make it difficult to cultivate artificially on a large scale, further expanding the gap in the market for bergenin raw materials and causing prices to rise year by year. In recent years, with the rapid development of the field of synthetic biology, the use of synthetic biology technology to produce natural drug monomers can effectively solve the above problems. However, to understand the biosynthetic pathways of these active ingredients, it is necessary to identify the key genes related to these pathways, and discovering these catalytic enzyme genes has become a key link in studying the biosynthetic pathways of plant metabolites. Currently, the synthetic pathway of 4-methoxygallic acid catalyzing the glycosylation reaction at the C-2 position to form 2-glucose-4-methoxygallic acid has been clarified, but the function of the carbon glycosyltransferase responsible for glycosylation has been less verified, which has affected the advancement of the biosynthesis of bergenin. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a gene of Amygdalus cyperus carbonyl transferase AqCGT51, which can be used as a biosynthesis regulatory gene of bergenin and can be used in the preparation of bergenin.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a gene of A. cyperus carbonyl transferase AqCGT51. The nucleic acid sequence of the A. cyperus carbonyl transferase AqCGT51 gene is shown in SEQ ID NO.1, and the full length of the sequence is 1455 bp.

[0008] The second aspect of the present invention provides a protein encoded by the above-mentioned Amygdalus cyperus carbonyl transferase AqCGT51 gene, the amino acid sequence of the protein is shown in SEQ ID NO.2, encoding 484 amino acid residues.

[0009] The third aspect of the present invention provides a recombinant plasmid containing the above-mentioned Amygdalus cyperus carbonyl transferase AqCGT51 gene.

[0010] Preferably, the recombinant plasmid is obtained by homologous recombination of the above-mentioned Amygdalus oxysporum carbonyl transferase AqCGT51 gene with the pET28a vector and is named pET28a-AqCGT51.

[0011] The fourth aspect of the present invention provides a transgenic engineering bacterium, comprising the recombinant plasmid, or the genome of the genetic engineering bacterium is integrated with the exogenous Agaricus cyperus carbonyl transferase AqCGT51 gene.

[0012] Preferably, the genetically modified bacteria is Escherichia coli BL21 (DE3) strain.

[0013] The fifth aspect of the present invention provides an application of the AqCGT51 gene of the Amygdalus cyperus in the preparation of bergenin.

[0014] Preferably, 4-methoxygallic acid and glycosyl donor uridine diphosphate glucose (UDP-glucose) are used as raw materials, and a glycosylation reaction is carried out at the C-2 position of 4-methoxygallic acid under the catalysis of the Amygdalus oxyphylla glycosyltransferase encoded by the above-mentioned Amygdalus oxyphylla glycosyltransferase AqCGT51 gene to produce bergenin.

[0015] The present invention obtains the target protein after in vitro expression through the recombinant plasmid, and directly generates bergenin by further catalyzing the substrate 4-methoxygallic acid.

[0016] The AqCGT51 gene of the glycosyltransferase of the Rhizoma Ceratitis described in the present invention was identified from the Rhizoma Ceratitis plant through transcriptome sequencing and bioinformatics technology, and after screening after a large number of experiments; RNA from the rhizome of the Rhizoma Ceratitis was extracted using RNA reagent, and reverse transcribed into cDNA and then amplified by PCR. The amplification primers of the AqCGT51 gene of the Rhizoma Ceratitis are as follows:

[0017] 5'F: ATGTCCAACTCCGGCG; (SEQ ID NO.3)

[0018] 3'R: CTAATTTTTCTTCAACGTAGAAATT; (SEQ ID NO.4)

[0019] In addition, when homologous recombination is performed with the vector pET28a, the AqCGT51 gene needs to be amplified and recovered using primers with homologous walls. The primers with homologous walls are as follows:

[0020] Upstream homology arm primer:

[0021] 5'F: cagcaaatgggtcgcggatccATGTCCAACTCCGGCG; (SEQ ID NO.5)

[0022] Downstream homology arm primer:

[0023] 3'R: acggagctcgaattcggatccCTAATTTTTCTTCAACGTAGAAATT; (SEQ ID NO.6)

[0024] The glycosyltransferase AqCGT51 gene isolated and identified from the Amygdalus sphaerocephala can be used as an important marker gene for molecular-assisted breeding of the Amygdalus sphaerocephala, and can also be used as an important candidate gene for the production of bergenin in the construction of yeast chassis cells.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) The present invention provides a gene for the glycosyltransferase AqCGT51 from the Agaricus cyperus, which can be used as a biosynthesis regulatory gene for bergenin and can be used in the preparation of bergenin.

[0027] (2) With the rapid development of bioinformatics technology, the mining of key enzyme genes in the biosynthetic pathway of bergenin has been greatly promoted. The biosynthetic regulatory gene of bergenin in the present invention, namely the AqCGT51 gene of the Agaricus cyperus carbonyl transferase, was identified and successfully verified for the first time, opening up a new biosynthetic method for producing bergenin. The present invention obtains the target product by enzyme catalysis in vitro through heterologous expression of proteins in Escherichia coli, adopts in vitro biosynthesis, and carries out directional production, which has the advantages of less by-products, etc.

[0028] (3) The present invention also provides a recombinant plasmid, a genetically engineered bacterium and a recombinant protein containing the carbon glycosyltransferase AqCGT51 gene, which lays a foundation for synthesizing a large amount of bergenin by bioengineering methods and further for constructing a cell factory that produces bergenin.

[0029] (4) The in vitro biosynthesis of bergenin is highly controllable, which can reduce the demand for raw material planting, produce a single product, facilitate the separation and purification of bergenin in the later stage, and reduce the difficulties of chemical synthesis and the complexity of the synthesis path. The AqCGT51 gene of the Amygdalus cyperus carbonyl transferase, as a key gene for the biosynthesis of bergenin, can also be used for the breeding research of plants rich in bergenin such as Ardisia japonica. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the synthetic route derived for bergenin;

[0031] Figure 2 Schematic diagram of the construction of the recombinant expression plasmid Pet28a-AqCGT51;

[0032] Figure 3 The results of electrophoresis detection of the recombinant gene of AqCGT51 of the Ceratium cylindrica. Among them, M is the nucleic acid Mar, and 1 is the result of positive single colony detection;

[0033] Figure 4This is the SDS-PAGE protein electrophoresis detection diagram of the glycosyltransferase AqCGT51 of the Cistanche deserticola. Among them, M is the protein molecular weight standard; lanes 1, 2, 3, and 4 are the flow-through eluent, precipitation eluent, 20mmol / L imidazole eluent, and 50mmol / L imidazole eluent respectively; lanes 5-11 are all proteins in 250mmol / L imidazole eluent;

[0034] Figure 5 HPLC detection of the glycosylation of 4-methoxygallic acid by carbon glycosyltransferase AqCGT51. The horizontal axis is time, unit is min, and the vertical axis is the response value, unit is mAU; among them, CK: the enzyme activity reaction result of the control group (4-methoxygallic acid + UDP-glucose + inactivated Amygdalus cylindrica carbon glycosyltransferase AqCGT51); standard: 4-methoxygallic acid standard + bergenin standard; AqCGT51: the enzyme activity reaction result of the experimental group (4-methoxygallic acid + UDP-glucose + Amygdalus cylindrica carbon glycosyltransferase AqCGT51);

[0035] Figure 6 is the mass spectrometry analysis (LC / MS / MS) spectrum of the standard, wherein A is the retention time of the standard 4-methoxygallic acid, 20.04 minutes; B is the retention time of the standard bergenin, 19.43 minutes;

[0036] Figure 7 Mass spectrometry analysis (LC / MS / MS) of the reaction products for enzyme activity verification, where A is the retention time of the substrate 4-methoxygallic acid, 20.04 minutes; B is the retention time of the reaction product bergenin, 19.41 minutes;

[0037] Figure 8 The fragment ion pattern of the standard substance bergenin (theoretical molecular weight 328) (LC / MS / MS);

[0038] Fig. 9 The fragment ion pattern of the reaction product bergenin (theoretical molecular weight 328) (LC / MS / MS). DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with embodiments.

[0040] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0041] Example 1

[0042] Based on the basic functional annotation information of the transcriptome of the tree, the CGT candidate genes were screened in the sequencing annotation results. At the same time, the carbon glycosyltransferase (CGT) identified in plants was analyzed by local BLAST analysis, and then the screening results were sorted and analyzed. Finally, a carbon glycosyltransferase (CGT) gene was found. After a series of work such as cDNA preparation, candidate gene amplification and recovery, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate carbon glycosyltransferase AqCGT51 gene (which can catalyze the glycosylation reaction of 4-methoxygallic acid to produce bergenin) was finally identified. Figure 1 The operation steps of each stage of the synthesis of bergenin are as follows (the reagents, raw materials, instruments and equipment used in the following implementation are all commercially available):

[0043] (1) Preparation of cDNA template

[0044] Fresh samples of the tree were taken, sliced, and then quickly frozen in liquid nitrogen for RNA extraction. Total RNA was extracted using the HiPure Plant RNA Mini Kit from Magen (Guangzhou Meiji Biotechnology Co., Ltd.). RNA was extracted according to the procedure of the kit, and after passing the test, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20°C for later use.

[0045] (2) Gene amplification and recovery

[0046] Primers for amplifying the AqCGT51 gene of the cyperus rotundus carbonyl transferase were designed using primer design software (CE Design) v1.04. The primers consisted of primer F (SEQ ID NO.3) and primer R (SEQ ID NO.4). The KOD high-fidelity enzyme was used according to the instructions for use of the high-fidelity KOD enzyme, and the gene was amplified using the Bergenia cDNA as a template. The PCR reaction program was: 94°C, 5min; 94°C, 30S, 58°C, 90S, 72°C, 1min, 35 cycles; 72°C, 7min. After the PCR was completed, the gel was run, and the target band was recovered after confirming that the amplification was successful. The EasyPure Quick Gel Extraction Kit of Beijing Quanshijin Biotechnology Co., Ltd. was used for gene gel extraction and recovery to recover the target gene. After recovery, the recovery concentration was measured on a NanoReady ultra-micro UV-visible spectrophotometer, and finally stored in a -20°C refrigerator for later use, to obtain a gene fragment of the AqCGT51 glycosyltransferase from the cyperus arborescens. The nucleic acid sequence was sequenced as shown in SEQ ID NO.1.

[0047] 5'F: ATGTCCAACTCCGGCG; (SEQ ID NO.3)

[0048] 3'R: CTAATTTTTCTTCAACGTAGAAATT; (SEQ ID NO.4)

[0049] In addition, when the fragment of the AqCGT51 glycosyltransferase from the Rhizoma Coptidis with vector homology arms undergoes homologous recombination with the vector pET28a (the homology arms are Escherichia coli pET28a), the AqCGT51 glycosyltransferase from the Rhizoma Coptidis needs to be amplified and recovered using primers with homology walls (i.e., homology arm primers). The homology arm primers consist of an upstream homology arm primer (shown in SEQ ID NO.5 in the sequence table) and a downstream homology arm primer (shown in SEQ ID NO.6 in the sequence table). Using the AqCGT51 glycosyltransferase from the Rhizoma Coptidis as a template, the PCR amplification is performed again according to the instructions for use of the high-fidelity KOD enzyme to obtain the AqCGT51 glycosyltransferase gene fragment from the Rhizoma Coptidis with vector homology arms.

[0050] Upstream homology arm primer: 5'F: cagcaaatgggtcgcggatccATGTCCAACTCCGGCG. (SEQ ID NO.5)

[0051] Downstream homology arm primer: 3'R: acggagctcgaattcggatccCTAATTTTTCTTCAACGTAGAAATT. (shown in SEQ ID NO.6).

[0052] The lowercase letters in the upstream homology arm primer (SEQ ID NO.5) and the downstream homology arm primer (shown in SEQ ID NO.6) represent the pET28a homology arms, and the uppercase letters represent the primer sequences for amplifying the AqCGT51 gene of the Amygdalus cyperus carbonyl transferase.

[0053] (3) Construction and identification of gene recombination vectors

[0054] A schematic diagram of homologous recombination is shown in Figure 2. First, the vector pET28a was linearized, and the linearized vector was obtained by single enzyme digestion with BamH I enzyme. During homologous recombination, the assembly was carried out according to the operating instructions of the homologous recombination enzyme. Then, according to the concentration of the pET28a homologous arm inserted with the vector homologous arm, the capital letters represent the amplified AqCGT51 gene fragment of the Amygdalus cylindrica and the pET28a vector, the amount of each component was calculated according to the recombination instructions; finally, each component was added to the PCR reaction tube on ice, and the pET28a homologous arm, the capital letters represent the amplified AqCGT51 gene of the Amygdalus cylindrica and the pET28a vector were homologously recombined to obtain the recombinant plasmid, named pET28a-AqCGT51. After assembly, the results were tested and sent to the company for sequencing. The electrophoresis test results after assembly are shown in Figure 3 , indicating that the assembly is successful. Reassemble the operation according to the following process:

[0055] Table 1 Candidate gene recombination reaction system

[0056]

[0057]

[0058] Among them, X = (0.02 × pET28a base pair number) ng / linearized pET28a concentration ng / μL; Y = (0.02 × pET28a base pair number) ng / Agara cylindrica carbon glycosyltransferase AqCGT51 recovery concentration ng / μL, and the inserted gene fragment is the Agara cylindrica carbon glycosyltransferase AqCGT51 gene fragment inserted with the vector homology arm.

[0059] (4) SDS-PAGE protein electrophoresis detection

[0060] After a small protein expression test, the protein induction conditions of AqCGT51 were determined to be: 18°C, 0.1mM IPTG, 220r / min, induction for 12h; then shake vigorously, collect bacteria, break the cell wall, obtain protein supernatant after high-speed centrifugation (12000r / min), and then use SDS-PAGE protein electrophoresis and detection. The test results are shown in Figure 4 , Figure 4 This indicates that AqCGT51 protein can be eluted and purified in 250 mmol / L imidazole elution buffer.

[0061] (5) Enzyme activity reaction

[0062] The enzymatic activity of the AqCGT51 gene of the Rhizoma Ceratitis was determined by the glycosylation reaction to synthesize bergenin in a 1.5 mL centrifuge tube. The mixture in the experimental sample reaction system contained: 2 μL of 100 mM uridine diphosphate glucose, 2 μL of 100 mM 4-methoxygallic acid, 40 μg of purified Rhizoma Ceratitis carbonyl transferase AqCGT51 protein, and 50 mM Tris-HCl buffer (pH 8.0) was added to a total volume of 100 μL, and the total volume of the reaction system was 100 μL. After incubation at 32 ° C for 2 hours, an equal volume of 1 M hydrochloric acid was terminated, and the supernatant was taken after brief centrifugation (12000 r / min). Finally, the reaction product was detected by HPLC and LC-MS / MS analysis.

[0063] Control group (CK) reaction system: 2 μL of 100 mM 4-methoxygallic acid, 2 μL of 100 mM UDP-glucose, 40 μg of inactivated purified Amygdalus cyperus carbonyl transferase AqCGT51 protein, 50 mM Tris-HCl buffer (pH 8.0) was added to a total volume of 100 μL, and the total volume of the reaction system was 100 μL.

[0064] Standard products: 50 μl of 10 mM 4-methoxygallic acid, 50 μl of 10 mM bergenin.

[0065] (6) Product testing

[0066] HPLC detection conditions are as follows:

[0067] The instrument used for HPLC detection is Agilent 1290 ultra-high performance liquid chromatograph. The chromatographic column is XBridge ShieldRP18 (4.6mm×250mm, 5μm), column temperature: 30°C; the mobile phase for the determination of bergenin is 0.01% v / v formic acid aqueous solution (A)-acetonitrile (B), gradient elution: 0-8min, 1%-5% B; 8-13min, 5%-10% B; 13-20min, 10%-20% B; 20-25min, 20%-45% B; 25-35min, 45%-90% B; 35-38min, 90%-90% B; 38-45min, 90%-100% B; elution time: 45min; injection volume: 10 microliters; flow rate: 0.6ml / min; detection wavelength 270nm. The test results are shown in Figure 5 , indicating that the experimental samples produced bergenin under the catalysis of the Amygdalus membranaceus carbonyl transferase AqCGT51.

[0068] LC-MS / MS detection conditions are as follows:

[0069] In order to further confirm the reaction products detected by HPLC, Agilent 1290UPLC / 6540Q-TOF liquid chromatography-mass spectrometry (LC / MS / MS) was used for detection: Mass spectrometry conditions: the ion source used was negative ion mode, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V, scanning range: 100-1000 m / z, scanning mode: SRM. Chromatographic conditions: the chromatographic column is XBridge Shield RP18 (4.6mm, × 250mm, 5μm), the column temperature is 32°C, the mobile phase for determining bergenin is 0.01% v / v formic acid aqueous solution (A)-acetonitrile (B), gradient elution: 0-8min, 1%-5% B; 8-13min, 5%-10% B; 13-20min, 10%-20% B; 20-25min, 20%-45% B; 25-35min, 45%-90% B; 35-38min, 90%-90% B; 38-45min, 90%-100% B; elution time: 45min; injection volume: 10 μL; flow rate: 0.6ml / min; detection wavelength is 270nm, and the detector is a diode array detector.

[0070] Test results see Figure 6 to Figure 9 From the results, it can be seen that the peak time and characteristic fragmentation ions of the product are consistent with those of the standard substance bergenin, confirming that the reaction product is bergenin. Finally, it was concluded that carbon glycosyltransferase AqCGT51 has the ability to catalyze the glycosylation of 4-oxymethyl gallic acid to produce bergenin.

[0071] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A glycosyltransferase from the tree of Aspergillus niger AqCGT51 A gene characterized by The glycosyltransferase AqCGT51 The nucleic acid sequence of the gene is shown in SEQ ID NO.

1.

2. The glycosyltransferase of the Agarwood tree according to claim 1 AqCGT51 The gene encodes a protein characterized in that The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A composition containing the glycosyltransferase of the Agarwood tree according to claim 1. AqCGT51 Recombinant plasmid of gene.

4. The method according to claim 3 containing the glycosyltransferase of Agarwood AqCGT51 A recombinant plasmid of a gene, characterized in that Glycosyltransferase AqCGT51 The gene was homologously recombined with the pET28a vector to obtain pET28a - AqCGT51 Heavy Plasmid .

5. A genetically modified bacteria, characterized in that: The recombinant plasmid of claim 3 or 4, or the genome of the genetically engineered bacterium is integrated with the exogenous glycosyltransferase of the cyperus argyi of claim 1 AqCGT51 Gene.

6. The genetically modified bacteria according to claim 5, characterized in that: The transgenic engineering bacteria are Escherichia coli BL21 (DE3) strains.

7. The glycosyltransferase of the Agarwood tree according to claim 1 AqCGT51 Application of genes in the preparation of bergenin.

8. The glycosyltransferase of Agarwood according to claim 7 AqCGT51 The application of the gene in the preparation of bergenin is characterized in that: Using 4-methoxygallic acid as substrate and UDP-glucose as glycosyl donor, the above-mentioned glycosyltransferase AqCGT51 Under the catalysis of the genetically encoded glycosyltransferase from the tree, a glycosylation reaction is carried out at the C-2 position of 4-methoxygallic acid to produce bergenin.

Images