Yeast genome editing system without interval loop iteration

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a non-interval loop iteration yeast genome editing system. The system is composed of Cas and gRNA double plasmids, two sets of circulating selection markers are designed for the gRNA plasmids, and auxotrophy types include gRNA-URA3, gRNA-HIS3 and gRNA-LEU2; and the resistance is gRNA-BleoR, gRNA-HygR, and gRNA-NrsR. And through coordinated use with a Cas selection marker, interval-free, cyclic and iterative efficient editing operation on the yeast genome is realized. The genome editing system provided by the invention can be used as a practical tool for multi-gene continuous iterative editing of saccharomyces cerevisiae and other fungi and has extremely high editing efficiency, an experimental terminal eliminates Cas and gRNA plasmids to realize traceless operation, and the genome editing system is low in off-target rate, universal, accurate and easy to operate, and can be applied to multi-gene continuous iterative editing of saccharomyces cerevisiae and other fungi. The method can be used for knockout, knockin, site-specific mutagenesis and the like of large-scale genes.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a yeast genome editing system with no gap cycle iteration. Background Art

[0002] CRISPR / Cas technology has become the tool of choice for synthetic biology pathway modification due to its excellent gene editing capabilities. CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats. It is the adaptive immune system of archaea and bacteria. When a virus invades for the first time, the bacteria records the original spacer sequence of the virus and transcribes it to form a Cas-RNA complex. When exogenous genes containing the same original spacer sequence, such as plasmid DNA, bacteriophage, and viral nucleic acid, invade again, the Cas-RNA complex is activated to cut the exogenous gene and inactivate it. Based on this mechanism, CRISPR / Cas technology that specifically recognizes host genes has been developed. Among them, CRISPR / Cas9 is the first system reported and maturely applied. It consists of two core components: guide RNA (gRNA) and endonuclease (Cas9). gRNA and Cas are expressed in the host. There is a scaffold sequence on the gRNA that is connected to Cas, through which the gRNA-Cas complex is formed with Cas. Under the guidance of the gRNA (20bp) complementary to the target gene base, Cas9 reaches the vicinity of the target gene, recognizes the protospacer adjacent motif (PAM) of the target gene target site, and cuts the target gene near the PAM to form double-strand breaks (DSBs). The broken double strands significantly stimulate the endogenous DNA repair reaction, causing DSBs to be repaired by homologous recombination (HR) or error-prone non-homologous end joining (NHEJ) ( Figure 2 ). When using CRISPR / Cas for gene editing, in order to introduce customized sequences, the Cas / gRNA plasmid and a repair DNA sequence, also known as donor DNA, are transformed simultaneously during the yeast transformation stage. The 5' and 3' ends of this DNA contain several sequences homologous to the two ends of the target gene, respectively, and the middle is an inserted gene fragment. DSBs are repaired by HR to achieve knockout or replacement of the target gene.

[0003] According to the above mechanism, a variety of CRISPR / Cas systems have been developed, including single-gene or multi-gene simultaneous editing modes, but the current system has certain limitations. For example, in a single-gene editing system, in order to ensure traceless operation and a new round of editing after a round of gene editing is completed, it is necessary to gradually lose the resistance or nutritional selection markers through multiple subcultures or reverse selection before the next round of gene manipulation can be carried out. This step is time-consuming (72-96h), becoming the rate-limiting step for multi-gene iterative editing, which seriously restricts the efficiency of gene editing; while the multi-gene simultaneous editing system has a high off-target rate and cannot effectively ensure that several target genes are deleted or knocked in at the same time in one round of gene editing. Often, one positive colony completes the editing of gene A, and another colony realizes the editing of gene B, but the proportion of positive strains that successfully edit genes A and B at the same time is low. This system also faces the time-consuming step of losing marker genes in a new round of editing. However, the current editing systems based on CRISPR / Cas technology are mostly focused on the efficiency of multiple genome integration, and there is not much research and attention on the intermediate intervals in the continuous editing of each gene. It cannot effectively guide the iterative editing of multiple genes without intervals, thereby improving the overall efficiency of large-scale gene editing. Summary of the invention

[0004] To solve the above problems, the present invention provides a gapless cyclic iteration system for editing the yeast genome, which consists of a double plasmid of a Cas plasmid and a gRNA plasmid.

[0005] Furthermore, the gRNA plasmid selection marker cycle pattern consists of an auxotrophic cycle marker or a resistance cycle marker.

[0006] Furthermore, the nutritional deficiency cycle marker is gRNA-URA3, gRNA-HIS3 or gRNA-LEU2.

[0007] Furthermore, the nucleotide sequence of gRNA-URA3 in the nutritional deficiency type circulating marker is shown as SEQ ID No.1, the nucleotide sequence of gRNA-HIS3 is shown as SEQ ID No.2, and the nucleotide sequence of gRNA-LEU2 is shown as SEQ ID No.3.

[0008] Furthermore, the resistance cycle marker is gRNA-BleoR, gRNA-HygR or gRNA-NrsR.

[0009] Furthermore, the nucleotide sequence of gRNA-BleoR in the resistance cycle marker is shown as SEQ ID No.4, the nucleotide sequence of gRNA-HygR is shown as SEQ ID No.5, and the nucleotide sequence of gRNA-NrsR is shown as SEQ ID No.6.

[0010] Furthermore, the nuclease of the Cas plasmid can be two types of CRISPR-related enzymes Cas9, Cas12 or Cas13.

[0011] Furthermore, the nuclease is Cas9.

[0012] Furthermore, the nutritional deficiency cycle marker of the Cas plasmid pair is MET15, and the resistance cycle marker of the Cas plasmid pair is kanamycin resistance gene.

[0013] The present invention has the following beneficial effects:

[0014] The yeast genome editing system with uninterrupted cyclic iteration provided by the present invention can be used for multi-gene editing operations of Saccharomyces cerevisiae and other fungi, and has strong versatility; since two sets of gRNA plasmid selection marker cycle modes are designed, there is no need for time-consuming steps of multiple subcultures (generally requiring 3-5 generations, taking 72-96 hours) or reverse selection to gradually eliminate resistance or nutritional selection markers after each round of editing, and continuous iterative knock-in and knock-out operations of multiple genes are realized for an unlimited number of times, and the efficiency of large-scale gene editing is increased to 3 times that of the existing system, and a marker cycle mode can be flexibly selected according to laboratory conditions; a single gene editing mode is designed, which has the advantages of extremely high editing efficiency, low off-target rate, accuracy and easy operability, and can be used for applications such as knockout of target genes, knock-in of long fragments (less than 7k bp) and site-directed mutagenesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 It is a schematic diagram of the core elements of the Cas plasmid and two sets of gRNA plasmid selection marker recycling mode;

[0017] Figure 2 is a schematic diagram of gene knockout;

[0018] Figure 3 is a schematic diagram of gene knock-in;

[0019] Figure 4 It is a schematic diagram of the Cas and gRNA plasmid elimination process;

[0020] Figure 5 This is the SST2 gene knockout validation diagram;

[0021] Figure 6This is the GPA1 gene knockout validation diagram;

[0022] Figure 7 This is the GPA2 gene knockout validation diagram;

[0023] Figure 8 This is the PEP4 gene knockout validation diagram;

[0024] Fig. 9 This is the validation diagram of the knock-in of the pPGK1-GFP-tADH1 fragment;

[0025] Fig.10 This is the validation diagram of the knock-in of the pCCW12-T1R1-tSSA1 fragment;

[0026] Fig.11 This is the knock-in verification diagram of the pCCW12-T1R3-tSSA1 fragment. DETAILED DESCRIPTION

[0027] Now, various exemplary embodiments of the present invention are described in detail. The methods in the examples are conventional methods unless otherwise specified, and the reagents used are conventional commercially available reagents or reagents prepared by conventional methods unless otherwise specified. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, features and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] The multi-gene gapless iterative editing operation provided by the present invention is implemented by the following description:

[0033] 1. Design of gRNA and construction of circulating gRNA plasmid system

[0034] Use Benchling (https: / / www.benchling.com) to design gRNA sequences with high specificity, high efficiency and low off-target rate, and select gRNA sequences with high "off-target score" and "on-target score" and closer to the 5' end of the target gene. Since only 20bp of specific gRNA sequence is added to the backbone sequence during gRNA plasmid preparation, two complementary single-stranded DNAs are directly synthesized, annealed to form double strands, and the double-stranded gRNA fragments are integrated into the backbone sequence through Gibson assembly to form a new gRNA plasmid.

[0035] 2. Preparation of Donor DNA

[0036] Based on different gene editing purposes, donor DNA comes in two forms.

[0037] The first is to knock out the target gene. The donor DNA can only consist of upstream and downstream homology arm sequences of the target gene and several connected genes (complete knockout). At this time, in order to facilitate subsequent genome editing at this site, in addition to the upstream and downstream homology arms, addressable landing pads (LPs) can be added in the middle part of the donor DNA. Specifically, CRISPR / Cas is used to form DSBs at the position of each gene open reading frame (ORF). The donor DNA serves as a template for homology-directed repair (HDR), including a unique 20bp Cas9 targeting sequence (UTS) and the PAM sequence CGG (LPs) immediately following it, flanked by 500bp of homology arm sequences upstream and downstream of the knockout gene ORF ( Figure 2 ). The resulting knockout represents a precise replacement of the ORF, with a unique UTS to allow for future editing at that site.

[0038] The second is to replace the target gene. The donor DNA consists of upstream and downstream homology arms and the ORF of the replacement gene ( Figure 3 ). In order to improve the knock-in efficiency of the replacement gene, the upstream and downstream homology arms are generally set to 800 bp; for sequence insertions below 3k bp, a 500 bp homology arm can be used.

[0039] 3. Yeast transformation and screening of positive clones

[0040] The exogenous gene was transformed into yeast by chemical transformation, and then inverted and cultured at 30°C for 48-72 hours. After a single colony was grown, the positive clone was verified. The positive clone was verified by colony PCR combined with sequencing.

[0041] 4. Elimination of gRNA and Cas plasmids

[0042] The strain that has completed the final editing is gradually removed from the gRNA and Cas plasmids by multiple passages in the absence of selection pressure (resistance screening mode) or SD medium (nutritional deficiency mode). Taking the resistance mode as an example, the plasmid elimination steps are as follows: take 0.5μL of the positive strain and inoculate it into 500μL YPD liquid medium for culture; wait until the bacterial solution becomes turbid (18-24h), take 0.5μL of the above bacterial solution and inoculate it into YPD medium and continue to culture; repeat the above operation 5 times; streak the last bacterial solution onto YPD solid medium, pick a single colony into 100μLddH2O after the colony grows, and inoculate (10μL) into 1mL YPD liquid medium containing G418, HyB / Bleo / NTC and antibiotics. If it grows on YPD medium without antibiotics but cannot grow on YPD medium containing antibiotics, it means that the gRNA plasmid and Cas plasmid in the strain have been successfully eliminated ( Figure 4 ).

[0043] Example

[0044] The present invention is further described below with specific embodiments to illustrate the implementation process of the invention.

[0045] In this example, the gRNA plasmid resistance selection marker cycle mode is selected, the gRNA backbone plasmid is pRS42H, which contains a yeast 2μ plasmid replication origin, and the expression of gRNA is controlled by the yeast SNR52 promoter (pSNR52) and SUP4 terminator (tSUP4); Cas selects Cas9, the plasmid is p414-pTEF1-Cas9-tCYC1-KanR, which contains a CEN / ARS replication origin, and a monkey virus 40 nuclear localization sequence is added to the end of Cas9 to help the Cas9 protein localize to the yeast nucleus, and the transcription of Cas9 is controlled by the yeast TEF1 promoter (pTEF1) and CYC1 terminator (tCYC1); Saccharomyces cerevisiae BY4741 is selected as a model strain, and the specific implementation process of the present invention is introduced by knocking out four genes (SST2, GPA1, GPA2, PEP4) of BY4741, knocking in GFP at the X3 and XI-2 sites, and knocking in T1R1 and T1R3 genes at the X2 and XII-5 sites, respectively.

[0046] Example 1: Continuous iterative knockout of four genes: SST2, GPA1, GPA2, and PEP4

[0047] 1. Design of gRNA and assembly of gRNA plasmid

[0048] Use Benchling (https: / / www.benchling.com) to design gRNA sequences with high specificity, high efficiency, and low off-target rate, and select gRNA sequences with high "off-target score" and "on-target score" and closer to the 5' end of the target gene. The specific gRNA sequences for knocking out the four genes SST2, GPA1, GPA2, and PEP4 are shown in Table 1.

[0049] Table 1 gRNA sequence information for knocking out the four genes SST2, GPA1, GPA2, and PEP4

[0050] gRNA Sequence (5'-3') SST2 TGTTAAAGAAGCGGTCTCGT GPA1 ATCAACGCCAGTGTTGCCGG GPA2 TAATAACGCGATATCTCCCA PEP4 TGGGTTCCAAGTAACGAATG

[0051] When preparing the gRNA plasmid, only a 20-bp specific gRNA sequence was added to the backbone sequence (Table 1), so two complementary single-stranded DNAs were directly synthesized, annealed to form double strands, and the double-stranded gRNA fragments were integrated into the backbone sequence by Gibson assembly to form a new gRNA plasmid. The four gRNA plasmids are gRNA (SST2)-HygR, gRNA (GPA1)-BleoR, gRNA (GPA2)-NrsR, and gRNA (PEP4)-HygR.

[0052] Annealing system and program parameters are as follows: 6.25 μL (10 μM) of forward and reverse primers in a 25 μL reaction system, add ddH2O to 25 μL. Program parameters are as follows: 98°C (2 min); 72°C (30 s); 60°C (2 min); 37°C (30 s); 12°C (30 s); cool down at a rate of 0.1°C / s.

[0053] The PCR amplification procedure for gRNA backbone sequence was as follows: in a 25 μL reaction system, template DNA 2 ng / μL, upstream and downstream primers 0.4 μM each, 2× PrimeSTAR Max Premix 12.5 μL (Takara), add sterile ddH2O to 25 μL. Other systems can increase or scale the proportion of each reagent according to the volume multiple.

[0054] Table 2 PCR reaction program parameters

[0055] process Pre-denaturation transsexual annealing extend Incubation cool down Temperature(℃) 98 98 55 72 72 4 Time(s) 60 10 10 5-10s / Kb 600 ∞

[0056] After the PCR reaction, nucleic acid electrophoresis was performed, and the target gene was recovered according to the DNA gel recovery kit (Guangzhou Feiyang Bioengineering Co., Ltd.), and the DNA concentration was determined. HiFi DNA Assembly Master Mix completes the Gibson assembly of each gene fragment to form a new gRNA. Each assembly system contains 0.05pmol / gene fragment, add 2×Mastermix, mix well and place on a PCR instrument for incubation at 50℃ for 30-50min, and the above products are directly transformed into E. coli competent cells; pick a single colony grown on the LB resistance plate to 100μL sterile ddH2O, mix well, add 1μL of the colony mixture as a template to the 5μL PCR system, add other components in equal proportions according to the above PCR system, and verify the correctly assembled plasmid by colony PCR; take 20μL of the verified single colony mixture and inoculate it into 8mL LB liquid culture medium (containing 100μL / mL ampicillin antibiotics), and culture at 37℃ for 12-18h. The bacterial solution is operated according to the plasmid kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) to extract the plasmid, sequence and verify the assembled fragment, and store the plasmid at -20℃ for use.

[0057] The resistance gene sequences in the gRNA plasmid selection marker cycle mode are as follows:

[0058] HygR:

[0059]

[0060] BleoR:

[0061] tcagtcctgctcctcggccacgaagtgcacgcagttgccggccgggtcgcgcagggcgaactcccgcccccacggctgctcgccgatctcggtcatggccggcccggaggcgtcccggaagttcgtggacacgacctccgaccactcggcgtacagctcgtccaggccgcgcacccacacccaggccagggtgttgtccggcaccacctggtcctggaccgcgctgatgaacagggtcacgtcgtcccggaccacaccggcgaagtcgtcctccacgaagtcccgggagaacccgagccggtcggtccagaactcgaccgctccggcgacgtcgcgcgcggtgagcaccggaacggcactggtcaacttggccat

[0062] NrsR:

[0063] ttaggggcagggcatgctcatgtagagcgcctgctcgccgtccgaggcggtgccgtcgtacagggcggtgtccaggccgcagagggtgaaccccatccgccggtacgcgtggatcgccggtgcgttgacgttggtgacctcca gccagaggtgcccggcgccccgctcgcgggcgaactccgtcgcgagccccatcaacgcgcgcccgaccccgtgcccccggtgctccggggcgacctcgatgtcctcgacggtcagccggcggttccagccggagtacgagacg accacgaagcccgccaggtcgccgtcgtccccgtacgcgacgaacgtccgggagtccgggtcgccgtcctccccgtcgtccgattcgtcgtccgattcgtcgtcggggaacaccttggtcaggggcgggtccaccggcacctc ccgcagggtgaagccgtccccggtggtggtgacgcggaaaacggtgtcggtggtgaaggacccatccagtgcctcgatggcctcggcgtcccccgggacactggtgcggtaccggtaagccgtgtcgtcaagagtggtacccat

[0064] 2. Preparation of Donor DNA

[0065] Donor DNA is generally prepared through a plasmid system. The fragments that make up the donor DNA are subcloned into a vector to form a new plasmid, and then the target donor DNA is amplified by PCR from the newly constructed plasmid. The small molecular weight, high copy pUC19 is selected as the cloning vector to prepare donor DNA. The Donor NDA plasmid consists of 4 parts, namely the pUC19 backbone sequence, the homology arms (HAU / HAD) 500-800bp upstream and downstream of the target gene ORF, and LPs (UTS-PAM-CGG). HAU / HAD is prepared by PCR amplification using the yeast crude genome as a template; LPs consists of only 24bp sequences and is directly designed into the target gene primer in the form of primers. The plasmid preparation process is basically the same as the gRNA plasmid, and the plasmid is constructed by Gibson assembly.

[0066] 3. Yeast Transformation

[0067] The BY4741 strain was inoculated into 5 mL YPD liquid medium, cultured overnight at 30 ° C, and the OD600 value was measured. Transformation was performed when the OD600 value was 0.8-1.0. The bacterial solution (1 mL) was centrifuged (6000 rpm, 1 min, room temperature) to collect the bacteria; 1 mL of sterile water was added to resuspend and wash the bacteria, centrifuged (6000 rpm, 1 min, room temperature), and the supernatant was discarded. 1 mL of LiTE was added to the above bacteria, resuspended, centrifuged (6000 rpm, 1 min, room temperature), and the supernatant was discarded. 320 μL LiTE / PEG, 20 μL single-stranded DNA, plasmid or other exogenous DNA were added to each tube and resuspended (negative control: use an equal volume of sterile water instead of DNA). Cas9 and gRNA plasmids were transformed into yeast twice. First transform the Cas9 plasmid, the amount of plasmid in 1mL OD6000.8-1.0 bacterial solution is about 1μg; when co-transforming the gRNA plasmid and donor DNA, the amount of both in 1mL OD6000.8-1.0 bacterial solution is not less than 2μg. Incubate at 30℃ for 30min; place in a 42℃ water bath for heat shock for 30min. Centrifuge (6000rpm, 3min, room temperature) and discard the supernatant. Resuspend in sterile water (clean the transformation reagent), centrifuge (6000rpm, 1min, room temperature), and discard the supernatant. Add 1mL YPD, culture at 30℃ for 1.5h (activation), centrifuge (6000rpm, 1min, room temperature); discard the supernatant; if it is a nutrient deficiency screening, this activation step is not required. Add 125μL sterile water to resuspend, apply to the plate (nutrient deficiency or antibiotic selection medium), and invert and culture at 30℃ for 48-72h.

[0068] 4. Knockout result verification

[0069] In this example, the order of knockout of the four genes is SST2→GPA1→GPA2→PEP4, and the corresponding gRNA resistances are gRNA (SST2)-HygR, gRNA (GPA1)-BleoR, gRNA (GPA2)-NrsR and gRNA (PEP4)-HygR. Figure 5-8 The four genes SST2, GPA1, GPA2, and PEP4 were successfully iteratively knocked out in the gRNA plasmid selection marker cycle mode, and the knockout success rate was greater than 97%, indicating that the gapless iterative yeast genome editing system constructed by the present invention can continuously and efficiently knock out yeast target genes.

[0070] Example 2: Continuous iterative targeted knock-in of three exogenous genes with different sequence lengths

[0071] The performance of the three-cycle gRNA plasmid system of the present invention in iterative gene knock-in was verified by knocking in GFP at the X3 and XI-2 sites, and knocking in gene fragments of different lengths such as T1R1 and T1R3 at the X2 and XII-5 sites.

[0072] 1. Design of gRNA and assembly of gRNA plasmid

[0073] Use Benchling (https: / / www.benchling.com) to design gRNA sequences with high specificity, high efficiency, and low off-target rate, and select gRNA sequences with high "off-target score" and "on-target score" and closer to the 5' end of the target gene. The specific gRNA sequences designed for X2, X3, XI-2, and XII-5 sites are shown in Table 3.

[0074] Table 3 gRNA sequence information designed for X2, X3, XI-2 and XII-5 sites

[0075] gRNA Sequence (5'-3') X2 CTCTCGAAGTGGTCACGTGC X3 CTAATGTGTCCGCGTTTCTA XI-2 GTTGACCAGTTGATCAGTTG XII-5 TTGTCACAGTGTCACATCAG

[0076] The preparation process of gRNA plasmids is the same as that in Example 1. The resistances of the four gRNA plasmids are gRNA (X3)-HygR, gRNA (XI-2)-BleoR, gRNA (X2)-NrsR and gRNA (XII-5)-HygR.

[0077] 2. Preparation of Donor DNA

[0078] The preparation process of Donor DNA was the same as that of Example 1. The sequence composition of GFP knocked into the X3 and XI-2 sites was HAU-pPGK1-GFP-tADH1-HAD, and the sequence composition of T1R1 and T1R3 knocked into the X2 and XII-5 sites was HAU-pCCW12-T1R1-tSSA1-HAD and HAU-pCCW12-T1R3-tSSA1-HAD, respectively, where HAU and HAD represent the upstream and downstream homology arm sequences of the insertion site, respectively.

[0079] 3. Yeast Transformation

[0080] The yeast transformation process was consistent with that described in Example 1, wherein when the gRNA plasmid and donor DNA were co-transformed, the gRNA plasmid in 1 mL of bacterial solution with an OD6000 of 0.8-1.0 was not less than 2 μg, and the donor DNA was not less than 3 μg.

[0081] 4. Knock-in fragment result verification

[0082] In this example, the order of three gene knock-in is GFP→T1R1→T1R3, and the corresponding gRNA resistances are gRNA (X3)-HygR, gRNA (XI-2)-BleoR, gRNA (X2)-NrsR and gRNA (XII-5)-HygR. Figure 9-11 The three gene fragments of GFP, T1R1 and T1R3 were successfully and continuously iteratively knocked into specific sites under the gRNA plasmid selection marker cycle mode, and the knockout success rate was greater than 70%, indicating that the gapless iterative yeast genome editing system constructed in this discovery can continuously and efficiently target and knock in gene fragments below 7k bp.

[0083] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A non-interval loop iterative system for editing yeast genome, characterized in that: The system consists of a double plasmid consisting of a Cas plasmid and a gRNA plasmid.

2. A non-interval loop iteration system for editing yeast genome according to claim 1, characterized in that: The gRNA plasmid selection marker cycle pattern consists of a nutritional deficiency cycle marker or a resistance cycle marker.

3. A non-interval loop iteration system for editing yeast genome according to claim 2, characterized in that: The auxotrophic cycle marker is gRNA-URA3, gRNA-HIS3 or gRNA-LEU2.

4. A non-interval loop iteration system for editing yeast genome according to claim 3, characterized in that: The nucleotide sequence of gRNA-URA3 in the nutritional deficiency type circulating marker is shown as SEQ ID No.1, the nucleotide sequence of gRNA-HIS3 is shown as SEQ ID No.2, and the nucleotide sequence of gRNA-LEU2 is shown as SEQ ID No.

3.

5. A gapless loop iteration system for editing yeast genome according to claim 2, characterized in that: The resistance cycle marker is gRNA-BleoR, gRNA-HygR or gRNA-NrsR.

6. A gapless loop iteration system for editing yeast genome according to claim 5, characterized in that: The nucleotide sequence of gRNA-BleoR in the resistance cycle marker is shown as SEQ ID No.4, the nucleotide sequence of gRNA-HygR is shown as SEQ ID No.5, and the nucleotide sequence of gRNA-NrsR is shown as SEQ ID No.

6.

7. A gapless loop iteration system for editing yeast genome according to claim 1, characterized in that: The nuclease of the Cas plasmid can be two types of CRISPR-related enzymes Cas9, Cas12 or Cas13.

8. A non-interval loop iteration system for editing yeast genome according to claim 7, characterized in that: The nuclease is Cas9.

9. The system for editing yeast genome without gaps according to claim 1, characterized in that: The nutritional deficiency cycle marker of the Cas plasmid paired with the gRNA plasmid is MET15, and the resistance cycle marker of the Cas plasmid paired with the gRNA plasmid is the kanamycin resistance gene.

Images