Tmem165 gene snp molecular marker related to yellow-feathered broiler feed conversion rate and application thereof
By developing the TMEM165 gene SNP molecular marker, yellow-feathered broiler chickens with low feed conversion ratio were screened, solving the problem of lack of relevant markers in existing technologies, realizing efficient genetic selection and reducing feed consumption, and improving economic benefits.
Patent Information
- Application Number
- CN202411593054.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-08
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2044-11-08
AI Technical Summary
The lack of SNP molecular markers related to feed conversion ratio in yellow-feathered broilers makes it difficult to effectively carry out genetic selection for low feed conversion ratios, thus increasing breeding costs.
A TMEM165 gene SNP molecular marker was developed, located at base 64634301 of the rs312546095 sequence on chicken chromosome 4, with a polymorphism of G/A. Yellow-feathered broiler individuals with low feed conversion ratio were screened using PCR technology, and detection and breeding were carried out using primers and kits.
It enables the rapid selection and retention of yellow-feathered broilers with low feed conversion rates, effectively reducing feed consumption during the production process and improving the economic benefits of enterprises.
Smart Images

Figure CN119162342B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of animal genetics and breeding and molecular biology, specifically to a TMEM165 gene SNP molecular marker related to feed conversion rate in yellow-feathered broiler chickens and its application. Background Technology
[0002] Yellow-feathered broilers are a native breed of chicken in my country, bred through crossbreeding of high-quality local varieties. Compared to white-feathered broilers, yellow-feathered broilers have a longer growth cycle and produce more flavorful meat, catering to the taste preferences of Chinese consumers. In 2023, the average monthly inventory of yellow-feathered grandparent breeder chickens was 2.1634 million sets, a 0.43% increase compared to 2022. With the rise in corn and soybean meal prices in 2022, especially the significant increase in soybean meal prices, broiler feed costs reached historical highs. Affected by factors such as increased feed costs, the cost of raising yellow-feathered broilers increased by 2.36% in 2023. Therefore, saving feed costs is one of the key issues in yellow-feathered broiler farming.
[0003] Feed conversion ratio (FCR) is an indicator of feed efficiency in livestock production, representing the amount of feed consumed to produce one unit of product. Studies have shown that FCR, as a phenotypic trait for evaluating feed utilization efficiency, has moderate heritability and exhibits good selection response. Selection based on FCR leads to reduced feed consumption without decreasing production rate. Selecting a base population with low FCR for genetic selection is beneficial for reducing feed costs in livestock farming.
[0004] SNP molecular marker technology is a powerful tool for early selection of feed conversion ratio traits and for accelerating the genetic breeding process. At present, there are few SNP molecular markers related to chicken feed conversion ratio, and there is a lack of sufficient SNP molecular markers to be applied to the breeding of yellow-feathered broilers with low feed conversion ratio. Summary of the Invention
[0005] To address the aforementioned technical problems, the present invention aims to provide a TMEM165 gene SNP molecular marker related to feed conversion ratio in yellow-feathered broilers and its application, thereby solving the problem of the lack of existing SNP molecular markers associated with feed conversion ratio in yellow-feathered broilers.
[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:
[0007] A SNP molecular marker for the TMEM165 gene associated with feed conversion ratio in yellow-feathered broilers was discovered. The SNP molecular marker is located at base 64634301 of the rs312546095 sequence on chicken chromosome 4, and the polymorphism is G / A.
[0008] Furthermore, the mutation sites and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, where n is the A>G mutation site. When n is A, it is a yellow-feathered broiler with low feed conversion ratio.
[0009] SEQ ID NO.1: 5'-GCCTGGAAATGAGTCGTTGGAGGTGGTTTGCAC TTTGAAGTTTCCATTGCGTTTGCAGCCTGAGATGCAAATTCTTGCTTTAGAAGCTGATGTGGAAATTCCCCTGGAACTGGCAGGGATGTGTGCCGGAACTGATAATGCATCCCGCTTCAGTAGGGTTGGAAAGGCTGTGCTGGGTCATTGCTTGTGTTCACATTGCTnGTGTGGTGATTTGCAGAG CCTTATCTTCACTGCCTAAGCATCCACTCACCACATTTAACATCCTCCAGCCACAAGAGCAAACAAAATAGCAGAGAACCATCAAAAGCTCCAGCTACTTTAGTCTCTGTTTCTCATTCTACTGTGCGAGGCAAACTCAAAATATTTAAAAGGAAGAGTACTATTTAAATTGTGTACATTTC-3'.
[0010] Furthermore, the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3;
[0011] SEQ ID NO.2: 5'-GTTGGAGGTGGTTTGCACTTTGA-3';
[0012] SEQ ID NO. 3: 5'-TGCCTCGCACAGTAGAATGAGAA-3'.
[0013] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned primers.
[0014] The above-mentioned SNP molecular markers, primers, or kits are used in the breeding of yellow-feathered broilers with low feed conversion ratios.
[0015] A breeding method for yellow-feathered broilers with low feed conversion ratio involves amplifying and sequencing the SNP molecular markers of the individuals to be tested using PCR technology, and screening to obtain homozygous individuals with the SNP molecular marker genotype AA.
[0016] Furthermore, PCR amplification of SNP molecular markers was performed using the aforementioned primers or kits.
[0017] Furthermore, the PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.
[0018] Furthermore, the PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.
[0019] The present invention has the following beneficial effects:
[0020] This invention provides a SNP molecular marker for the TMEM165 gene, which is associated with feed conversion ratio in yellow-feathered broilers. The polymorphism of this SNP molecular marker is significantly correlated with the feed conversion ratio of yellow-feathered broilers. Applying it to the breeding of yellow-feathered broilers can quickly select yellow-feathered broilers with low feed conversion ratios. It can be used to efficiently screen individuals or parent yellow-feathered hens with excellent traits of low feed conversion ratios, effectively reducing feed consumption in the production process and improving the economic benefits and competitiveness of enterprises. Attached Figure Description
[0021] Figure 1 Manhattan plot of SNP molecular markers in Example 1;
[0022] Figure 2 This is a sequencing diagram of the SNP molecular marker genotype in Example 2. Detailed Implementation
[0023] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0024] Example 1: Screening of SNP molecular markers
[0025] 1872 healthy yellow-feathered broiler chickens were selected and fed together until 56 days of age. After 56 days, they were transferred to individual cages for feeding. The experiment ended at 98 days of age. The feed intake, initial body weight, and final body weight of each chicken were recorded, and the feed conversion ratio was calculated using the following formula:
[0026]
[0027] In the formula, FCR is the feed conversion ratio; W f For feed consumption; W a To increase the weight of living organisms.
[0028] A lower FCR value, meaning a lower feed conversion ratio, indicates that less feed is consumed for the same production capacity, thus saving feed. The presence of extremely low values in the 49-day-old body weight trait records that deviate significantly from the core distribution area may indicate erroneous records or other anomalies and should be removed.
[0029] The above phenotypic records were subjected to quality control processing. The upper / lower limits of the quality control standard were the mean ± 3 × standard deviation (x ± 3u). Phenotypes within this range were considered valid records, and phenotypes outside this range were considered invalid records and were set as missing values (NA).
[0030] A total of 1872 DNA samples were collected from Yellow-feathered chicken breeders. The DNA samples underwent quality testing. DNA concentration was determined using a qubit fluidometer, and DNA fragment size and degradation were assessed using agarose gel electrophoresis. The results showed that 99 samples were substandard, while the remaining 1773 qualified Yellow-feathered chicken breeder DNA samples were used for subsequent library construction and sequencing.
[0031] 1773 samples that passed quality inspection were used for library construction and sequencing. The MGIEAsy DNA library rapid preparation kit was used for library construction. Genomic DNA was fragmented using a double enzyme digestion method, and the fragments were recovered and ligated with adapters. Equal amounts of the ligation products were mixed and amplified by PCR to create single-stranded circular molecules and DNB spheres. PE100 sequencing was performed using a BGISEQ500. Sequencing data were processed in three batches: 188 samples in the first batch, 1491 samples in the second batch, and 94 samples in the third batch.
[0032] Raw data for each sample was obtained through sequencing, filtered using SOAP software, and then compared with a reference genome using bwa software. Finally, variant detection and genotyping were performed using software such as SAMtools and GATK. After obtaining high-quality marker data, subsequent bioinformatics analysis was conducted.
[0033] GWAS analysis was performed on the recorded traits of 1773 yellow-feathered breeder chickens in this population using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html). The analysis model is as follows:
[0034] y = Xb + Za + Wp + e;
[0035] In the model, y represents the true value of the trait record, X represents the fixed-effects association matrix, b represents the fixed-effects vector, the fixed effects include batch effects and three principal component effects, Z represents the additive genetic effects association matrix, u represents the individual additive genetic effects vector, e represents the residual, and u ~ N(0, Gσ) 2α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ 2 α σ 2 ε α represents the variance of the additive genetic effect and the variance of the residuals, respectively, and m represents the SNP marker effect.
[0036] Based on the association analysis results, a SNP molecular marker associated with the feed conversion ratio trait in yellow-feathered broilers was identified. This marker is located on the TMEM165 gene on chromosome 4 of yellow-feathered broilers. Figure 1 The Harman diagram is shown below. The mutation site and upstream and downstream sequences of this SNP molecular genetic marker are as follows:
[0037] SEQ ID NO.1: 5'-GCCTGGAAATGAGTCGTTGGAGGTGGTTTGCAC TTTGAAGTTTCCATTGCGTTTGCAGCCTGAGATGCAAATTCTTGCTTTAGAAGCTGATGTGGAAATTCCCCTGGAACTGGCAGGGATGTGTGCCGGAACTGATAATGCATCCCGCTTCAGTAGGGTTGGAAAGGCTGTGCTGGGTCATTGCTTGTGTTCACATTGCTnGTGTGGTGATTTGCAGAG CCTTATCTTCACTGCCTAAGCATCCACTCACCACATTTAACATCCTCCAGCCACAAGAGCAAACAAAATAGCAGAGAACCATCAAAAGCTCCAGCTACTTTAGTCTCTGTTTCTCATTCTACTGTGCGAGGCAAACTCAAAATATTTAAAAGGAAGAGTACTATTTAAATTGTGTACATTTC-3';
[0038] n is the mutation site. When n at nucleotide 201 of the above sequence is A or G, i.e., n(A / G), the above sequence is polymorphic. 5'- and -3' represent the 5' end and 3' end of the nucleotide sequence, respectively.
[0039] Example 2: Validation of SNP molecular markers
[0040] (1) The SNP molecular marker was validated in another yellow-feathered broiler flock, totaling 1773 healthy individuals. All experimental chickens were fed together until 56 days of age, and then transferred to individual cages for feeding. The experiment ended at 98 days of age. The daily feed intake, initial body weight, and final body weight of each chicken were recorded, and the feed conversion ratio was calculated. 150 individuals with low feed conversion ratio (FCR < 3.0) and 150 individuals with high feed conversion ratio (FCR > 3.0) were selected, and blood was collected for DNA extraction. The average FCR of the 150 individuals with low feed conversion ratio was 2.6 ± 0.38, and the average FCR of the individuals with high feed conversion ratio was 3.4 ± 0.39.
[0041] (2) Using the DNA extracted in step (1) as a template, add forward primer (SEQ ID NO.2: 5'-GTTGGAGGTGGTTTGCACTTTGA-3') and reverse primer (SEQ ID NO.3: 5'-TGCCTCGCACAGTAGAATGAGAA-3') to perform PCR reaction.
[0042] PCR amplification system: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL.
[0043] PCR reaction conditions: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.
[0044] (3) The PCR products from step (2) were sequenced and analyzed using Sanger sequencing. The genotype of each individual was recorded according to the sequencing peak diagram of each sample (e.g., ...). Figure 2 In the sequencing data of genotype AA, only one peak appears at the corresponding locus, indicating that the alleles are the same (A). In the sequencing data of genotype AG, two peaks appear at the corresponding locus, indicating that the alleles are different (one is A and the other is G). One-way ANOVA using SPSS 26.0 was used to analyze the relationship between the genotype and allele of the SNP molecular marker and feed conversion ratio. The results are shown in Tables 1 and 2. For this SNP molecular marker, both genotype and allele frequencies showed highly significant differences between the low and high feed conversion ratio groups (P < 0.01). In the low feed conversion ratio group, the frequency of allele A was higher than that of allele G, and the frequency of genotype AA was higher than that of genotype AG, indicating that individuals with the AA genotype at position 201 had a better feed conversion ratio phenotype than those with the AG genotype. This further demonstrates that the polymorphism of the screened molecular marker is significantly correlated with the feed conversion ratio trait, and these are SNP loci associated with the feed conversion ratio trait, which can be used for breeding yellow-feathered broilers with low feed conversion ratio traits.
[0045] Table 1. Statistical table of distribution differences of SNP molecular marker genotypes between low and high feed conversion ratios.
[0046] chromosome site genotype High FCR (%) Low FCR (%) Chi-square value (P) Chr4 64634301bp AA 44(29%) 113(75%) 15.654 AG 106(71%) 37(25%) <![CDATA[6.9×10 -3 ]]>
[0047] Table 2: Statistical table of distribution differences of SNP molecular marker alleles between low and high feed conversion ratios.
[0048] chromosome site genotype High FCR (%) Low FCR (%) Chi-square value (P) Chr4 64634301bp A 194(64.7%) 263(87.6%) 9.327 G 106(35.3%) 37(12.4%) <![CDATA[9.5×10 -5 ]]>
[0049] Example 3: Assisted molecular breeding method for low yellow-feathered broiler feed conversion ratio using SNP molecular marker alleles
[0050] Assisted molecular breeding using the above-mentioned kit for detecting SNP molecular markers includes the following steps:
[0051] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.
[0052] (2) Amplification was performed using the DNA extracted in step (1) as a template via a kit. The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL. The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, for 35 cycles; and 72℃ extension for 5 min.
[0053] (3) The PCR products obtained in step (2) were sequenced using the Sanger sequencing method.
[0054] (4) Based on the genotyping results, select homozygous individuals with the SNP molecular marker chr4-64634301 as the AA genotype for breeding to reduce feed conversion rate and feed cost; select individuals with this marker to join the core breeding population to achieve rapid homozygosity of the alleles related to this trait, which can provide technical support for accelerating the progress of genetic selection.
[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A primer combination or kit for amplifying the SNP molecular marker of the TMEM165 gene associated with feed conversion ratio in yellow-feathered broilers, used in the breeding of yellow-feathered broilers with low feed conversion ratio, characterized in that, The RS number of the SNP molecular marker is rs312546095, and the polymorphism is A / G. When the SNP is A, it indicates a yellow-feathered broiler with low feed conversion ratio. The kit includes the primer combination.
2. The application according to claim 1, characterized in that, The mutation sites and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, where n is the A>G mutation site. When n is A, it is a yellow-feathered broiler with low feed conversion ratio.
3. The application according to claim 1, characterized in that, The forward primer sequence of the primer combination is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.
3.
4. A method for breeding yellow-feathered broiler chickens with low feed conversion ratio, characterized in that, The SNP molecular markers described in any one of claims 1-3 of the individuals to be tested are amplified and sequenced using PCR technology to screen for homozygous individuals with the SNP molecular marker genotype AA.
5. The breeding method for low feed conversion ratio yellow-feathered broilers according to claim 4, characterized in that, PCR amplification of SNP molecular markers was performed using the primer combinations or kits described in any one of claims 1-3.
6. The breeding method for low feed conversion ratio yellow-feathered broilers according to claim 4, characterized in that, The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.
7. The breeding method for low feed conversion ratio yellow-feathered broilers according to claim 4, characterized in that, The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.
Citation Information
Patent Citations
Yellow feather broiler feed conversion efficiency related gene, SNP molecular marker and application
CN117551784A