A method for screening plant broad-spectrum disease-resistance genes and application of the broad-spectrum disease-resistance gene HSP1 in preventing and controlling plant diseases

Abstract

The present invention belongs to the field of molecular biology technology, and specifically relates to a method for screening broad-spectrum disease-resistant genes in plants and the application of the broad-spectrum disease-resistant gene HSP1 in preventing and controlling plant diseases. The screening method comprises: comparing the CDS sequences of N target pathogens to obtain homologous gene sequences; N is a natural number ≥2; comparing the protein sequences of the N target pathogens to obtain homologous protein sequences; comparing the coding sequences of the homologous gene sequences and the homologous protein sequences, taking the intersection, and obtaining conserved genes; comparing the conserved genes with plant genomic DNA, eliminating highly homologous genes, and obtaining broad-spectrum disease-resistant genes in plants. The screening method provided by the present invention is a broad-spectrum disease-resistant gene screening system applicable to different types of crops and corresponding to different types of crop pathogens, providing a new gene cloning idea for plant disease-resistant molecular breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a method for screening a broad-spectrum disease-resistance gene for plants and application of the broad-spectrum disease-resistance gene HSP1 in preventing and controlling plant diseases. Background Art

[0002] Plant diseases pose a serious threat to food security. Currently, they are primarily controlled through pesticide spraying and planting disease-resistant varieties. While pesticides have mitigated the occurrence and severity of various plant diseases to a certain extent, they also severely impact human health and ecological safety. Furthermore, their extensive use requires significant human and material resources. Enhancing cultivar resistance is the most effective disease control measure. However, the process of selecting disease-resistant varieties using traditional hybrid breeding is lengthy, and identifying major disease-resistance genes through forward genetics is challenging. Most genes are also difficult to develop into effective molecular markers for direct use in assisted breeding. The use of biotechnology has significantly improved the selection of superior, resistant varieties.

[0003] Host-induced gene silencing (HIGS) is a widely used and effective method for breeding resistant varieties. When used to control plant fungal diseases, HIGS typically targets genes involved in the growth, development, or pathogenicity of the pathogen. dsRNA of the target gene is expressed in plant cells, or dsRNA or siRNA expressed or synthesized in vitro is introduced into plant cells. This silences the target gene in the pathogen upon infection, reducing the occurrence of disease and achieving a control effect. However, current screening methods for genes involved in the growth, development, or pathogenicity of pathogens are imperfect and can only be used to screen for a single pathogen and verify the effect of the resistance gene against that single pathogen. There is no rapid method for screening broad-spectrum plant resistance genes against multiple pathogens. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for screening a broad-spectrum disease-resistant gene for plants and the application of the broad-spectrum disease-resistant gene HSP1 in preventing and controlling plant diseases, so as to achieve rapid creation of disease-resistant germplasm against multiple pathogens.

[0005] The present invention provides a method for screening a broad-spectrum disease-resistance gene in plants, the screening method comprising the following steps:

[0006] Compare the CDS sequences of N target pathogens to obtain gene sequences with a homology of more than 85%, wherein N is a natural number ≥2; compare the protein sequences of the N target pathogens to obtain homologous protein sequences; compare the homologous gene sequences with the coding sequences of the homologous protein sequences, take the intersection, and obtain conserved genes; compare the conserved genes with plant genomic DNA, eliminate genes in the plant genomic DNA that are highly homologous to the conserved genes with a homology of more than 50%, and obtain plant broad-spectrum disease-resistant genes.

[0007] Preferably, the N target pathogens include Magnaporthe oryzae, Rhizoctonia solani and Ustilaginoidea virens.

[0008] The present invention also provides the use of the plant broad-spectrum disease-resistant gene or its highly conserved region obtained based on the screening method described in the above technical solution in preventing and controlling plant diseases and / or enhancing plant resistance to pathogens.

[0009] Preferably, the plant broad-spectrum disease resistance gene is the HSP1 gene, and the application includes the application of the HSP1 gene or its highly conserved region in preventing and controlling plant diseases and / or enhancing plant resistance to pathogens; the amino acid sequence of the protein encoded by the HSP1 gene is shown in SEQ ID No. 1.

[0010] Preferably, the nucleotide sequence encoded by the HSP1 gene is shown as SEQ ID No. 2; the nucleotide sequence of the highly conserved region is shown as SEQ ID No. 3.

[0011] Preferably, the plant diseases include one or more of rice blast, sheath blight and false smut.

[0012] Preferably, the pathogenic bacteria include one or more of Magnaporthe oryzae, Rhizoctonia solani and Ustilaginoidea virens.

[0013] The present invention also provides a method for enhancing rice resistance to pathogens, comprising the following steps: inserting a highly conserved region expressing the HSP1 gene into rice using an RNAi system; the nucleotide sequence of the highly conserved region is shown in SEQ ID No. 3.

[0014] Preferably, the method for inserting a highly conserved region expressing the HSP1 gene into rice comprises: introducing an HSP1 silencing vector into a rice plant; the HSP1 silencing vector comprises a basic vector and a target sequence inserted into the basic vector; the target sequence comprises a highly conserved region of the HSP1 gene and a reverse complementary chain of the highly conserved region, the nucleotide sequence of the highly conserved region is shown as SEQ ID No. 3, and the nucleotide sequence of the reverse complementary chain of the highly conserved region is shown as SEQ ID No. 4.

[0015] Beneficial effects:

[0016] The screening method provided by this invention can rapidly identify broad-spectrum disease-resistance genes in plants, creating a broad-spectrum disease-resistance gene screening system for a variety of pathogens. This screening method provides a new resource for plant disease resistance and a novel gene cloning strategy for molecular breeding of plant disease resistance. While ensuring crop yields, it lays the foundation for future molecular breeding development and has promising applications in cultivating high-quality plant varieties.

[0017] The rice broad-spectrum disease-resistant gene HSP1 obtained based on the screening method provided by the present invention has a simple sequence, can be stably transformed in monocotyledonous rice, and has significant disease resistance effects against rice blast fungus, Rhizoctonia solani and Aspergillus oryzae, while having no effect on rice growth and fruiting, and does not affect rice yield.

[0018] The plant broad-spectrum disease-resistant gene HSP1 obtained by screening using the screening method provided by the present invention is the pathogenic gene of the pathogenic bacteria. The present invention clarifies the pathogenic characteristics of the candidate gene by functional screening and verification of the pathogenic gene, and then designs RNAi interference fragments with the pathogenic gene as the target, thereby creating rice broad-spectrum disease-resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0020] Figure 1 It is a rapid screening system for core pathogenicity genes of rice pathogens such as Magnaporthe grisea, Rhizoctonia solani and U. oryzae.

[0021] Figure 2 The results of the evolutionary conservation analysis of HSP1 gene in different species;

[0022] Figure 3 The results of gene knockout of HSP1 in rice blast fungus and analysis of gene function and pathogenicity are shown;

[0023] Figure 4 This shows the disease status of barley leaves after inoculation with spores of rice blast fungus using the spot grafting method.

[0024] Figure 5 This shows the disease status of barley leaves after inoculation with spores of rice blast fungus using the spray method;

[0025] Figure 6 The disease condition of rice leaves after inoculation with spores of rice blast fungus by spraying;

[0026] Figure 7 This is the positive plant identification result of HSP1 gene transgenic rice;

[0027] Figure 8 The effect of HSP1 gene transgenic rice lines on the expansion of rice blast and sheath blight, where n = 10;

[0028] Figure 9 The effect of HSP1 gene transgenic rice lines on smut pathogen, n=10;

[0029] Figure 10 The results of field resistance test and panicle blast analysis of HSP1 gene transgenic rice lines against the spectrum of rice blast fungi in Enshi, Hubei Province are shown;

[0030] Figure 11 This is the growth status of HSP1 gene transgenic rice lines and wild-type rice at the heading stage in the field of Yingzhou Town, Lingshui Autonomous Prefecture, Sanya City, Hainan Province;

[0031] Figure 12 Comparison results of panicle shape, grain length and grain width between HSP1 gene transgenic rice lines and wild-type rice. DETAILED DESCRIPTION

[0032] The present invention provides a method for screening a broad-spectrum disease-resistance gene in plants, the screening method comprising the following steps:

[0033] Compare the CDS sequences of N target pathogens to obtain gene sequences with a homology of more than 85%, wherein N is a natural number ≥2; compare the protein sequences of the N target pathogens to obtain homologous protein sequences; compare the coding sequences of the homologous gene sequences and the homologous protein sequences, take the intersection, and obtain conserved genes; compare the conserved genes with plant genomic DNA, eliminate genes in the plant genomic DNA that are highly homologous to the conserved genes with a homology of more than 50%, and obtain plant broad-spectrum disease-resistant genes.

[0034] The present invention aligns CDS sequences of N target pathogens to obtain homologous gene sequences; N is a natural number ≥ 2. In the present invention, the N target pathogens preferably include Magnaporthe oryzae, Rhizoctonia solani, and Ustilaginoidea virens. The method for aligning the CDS sequences is not particularly limited in the present invention, and any conventional alignment software can be used, preferably Blast.

[0035] The present invention compares the protein sequences of the N target pathogens to obtain homologous protein sequences. The present invention has no particular limitation on the method for comparing the CDS sequences, and any conventional comparison software can be used, preferably Ortherfinder.

[0036] After obtaining the homologous gene sequence and the homologous protein sequence, the present invention compares the coding sequences of the homologous gene sequence and the homologous protein sequence, takes the intersection, and obtains the conserved gene.

[0037] After obtaining the conserved genes, the present invention compares the conserved genes with plant genomic DNA, and removes genes in the plant genomic DNA that are highly homologous to the conserved genes, with a homology of 50% or more, to obtain broad-spectrum plant disease resistance genes. In the present invention, the plants preferably include monocots and dicots, more preferably barley and / or rice, and even more preferably rice.

[0038] The screening method provided by the present invention can quickly screen out broad-spectrum disease-resistance genes in plants, and is a broad-spectrum disease-resistance gene screening system for a variety of pathogens. It provides a new resource for plant disease resistance and a new gene cloning idea for plant disease-resistant molecular breeding, while ensuring crop yields, laying the foundation for the future development of molecular breeding, and has application prospects in cultivating high-quality plant varieties.

[0039] Based on the advantages of the screening method provided by the present invention, the use of the broad-spectrum disease-resistant gene HSP1 gene or its highly conserved region screened by the screening method in preventing and controlling plant diseases and / or enhancing plant resistance to pathogens also falls within the scope of protection of the present invention.

[0040]

[0041] In the present invention, the nucleotide sequence of the highly conserved region of the HSP1 gene is preferably as shown in SEQ ID No. 3, specifically: 5'-TTTTATCCGCCCCACTGGTCACACGCTTAAGCCACTCGATATTGA GATCATGAAGCGCCTTGGGACCCGTGTCAACTTGATCCCTGTGATTGCCAAGGCTGACACGCTCACCCAGAACGACTTGGCCGTATTCAAACAGCGCATCCGTGAAGTTGTTGCCGCTCAAGGAATTCGTGTCTACCAACCCCCTATTGAGCCTGATGATCAGGCCAGTGCCGAGCAGGCCCGTATTCTCATGAACGCTATGCCTTTCTCCATTATTGGCTCCACTACCGACGTACAAACCCCCGACGGCCGTGTCGTCAAGGGCCGCGAATACCTCTGGGGAGTTGCTGAGGTCGAAA-3'.

[0042] The plant diseases of the present invention preferably include one or more of rice blast, sheath blight, and false smut, more preferably rice blast, sheath blight, and false smut; the pathogens preferably include one or more of Magnaporthe oryzae, Rhizoctonia solani, and Ustilaginoidea virens, more preferably Magnaporthe oryzae, Rhizoctonia solani, and Ustilaginoidea virens. The HS P1 gene obtained by the screening method provided by the present invention has a simple sequence, can be stably transformed in monocotyledonous rice, and has significant disease resistance against rice blast, Rhizoctonia solani, and Ustilaginoidea virens.

[0043] The present invention also provides a method for enhancing the resistance of rice to pathogens, comprising the following steps:

[0044] The RNAi system is used to insert and express the highly conserved region of the HSP1 gene in rice; the nucleotide sequence of the highly conserved region is shown in SEQ ID No.3.

[0045] In the present invention, the method for inserting a highly conserved region expressing the HSP1 gene into rice preferably comprises the following steps: introducing an HSP1 silencing vector into a rice plant; the HSP1 silencing vector preferably comprises a base vector and a target sequence inserted into the base vector; the target sequence comprises a highly conserved region of the HSP1 gene and a reverse complementary strand of the highly conserved region, the nucleotide sequence of the highly conserved region being shown in SEQ ID No. 3, and the nucleotide sequence of the reverse complementary strand of the highly conserved region being shown in SEQ ID No. 4, specifically: 5'-TTTCGACCT CAGCAACTCCCCAGAGGTATTCGCGGCCCTTGACGACACGGCCGTCGGGGGTTTGTACGTCGGTAGTGGAGCCAATAATGGAGAAAGGCATAGCGTTCATGAGAATACGGGCCTGCTCGGCACTGGCCTGATCATCAGGCTCAATAGGGGGTTGGTAGACACGAATTCCTTGAGCGGCAACAACTTCACGGATGCGCTGTTTGAATACGGCCAAGTCGTTCTGGGTGAGCGTGTCAGCCTTGGCAATCACAGGGATCAAGTTGACACGGGTCCCAAGGCGCTTCATGATCTCAATATCGAGTGGCTTAAGCGTGTGACCAGTGGGGCGGATAAAA-3'. The basic vector of the present invention is preferably DS1301; and the introduction method is preferably Agrobacterium transformation.

[0046] To further illustrate the present invention, a method for screening a broad-spectrum disease-resistance gene for plants and the application of the broad-spectrum disease-resistance gene HSP1 in preventing and controlling plant diseases provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1

[0048] Core gene identification

[0049] according to Figure 1 The method is to screen for broad-spectrum disease-resistance genes against rice blast pathogen, sheath blight pathogen and false smut pathogen, and the specific steps are as follows:

[0050] The genomes of three pathogenic fungi, Rice blast, Rhizoctonia solani, and U. oryzae, were downloaded and their protein sequences were aligned using Ortherfinder to identify genes highly conserved at the protein level. Homology screening of the CDS sequences of the three pathogens using Blast was performed to identify genes highly conserved at the DNA level across the three pathogens. The intersection of these highly conserved protein and DNA genes was used to identify candidate core genes. To prevent host-generated RNAi from interfering with plant growth and development, the candidate core genes were aligned with rice, and genes conserved with rice were filtered out. The remaining genes were those highly conserved only in the pathogens, ultimately identifying the broad-spectrum disease resistance gene HSP1.

[0051] Example 2

[0052] Analysis of evolutionary conservation of HSP1 gene in different species

[0053] The evolutionary conservation of HSP1 gene in different species was analyzed. The specific operation was as follows: the amino acid sequence of HSP1 protein was compared with that of different fungi by BLAST, and the compared sequences were analyzed by MEGA and phylogenetic tree analysis. The results are as follows: Figure 2 As shown, the nucleotide sequence of the HSP1 gene is shown as SEQ ID No. 2, and the amino acid sequence of the HSP1 protein encoded by it is shown as SEQ ID No. 1.

[0054] Depend on Figure 2 It can be seen that the HSP1 gene is highly conserved in Magnaporthe oryzae, Rhizoctonia solani, Ustilaginoidea virens and Fusarium oxysporum.

[0055] Example 3

[0056] Knockout of the broad-spectrum disease resistance gene HSP1 in rice blast fungus and analysis of its gene function and pathogenicity

[0057] The HSP1 gene in rice blast fungus was knocked out by homologous recombination, and the pathogenicity of the knockout strain was identified. The specific steps are as follows:

[0058] HSP1 gene sequence in rice blast fungus:

[0059]

[0060]

[0061]

[0062] The reference primers for homologous recombination knockout are shown below:

[0063] LBCK: 5'-GCTCGTATTGAGCCATCCAA-3' (SEQ ID No.8);

[0064] RBCK: 5'-CTATGTCCGCACGGAGCT-3' (SEQ ID No.9);

[0065] 1F: 5'-GCATGAAATAGTGCCGCT-3' (SEQ ID No.10);

[0066] 2R: 5'-TCCACTAGCTCCAGCCAAGGGTGTGGTGATGTGAAATAGAC-3' (SEQ ID No.11);

[0067] 3F: 5'-GAGTAGATGCCGACCGGGCTGTTAAGCTGGATACCCAGC-3' (SEQ IDNo.12);

[0068] 4R: 5'-CCTATAGCCGAATCGTCGGA-3' (SEQ ID No.13);

[0069] 5F: 5'-GGATTGGATAGTTGCTTGCG-3' (SEQ ID No.14);

[0070] 6R: 5'-GTGGCCTGTAGGGCGGAT-3' (SEQ ID No.15);

[0071] 7F: 5'-GTTGGTGGGTGGGTGCAA-3' (SEQ ID No.16);

[0072] 8R: 5'-CGATCCTGCAAGCTCCGG-3' (SEQ ID No.17);

[0073] 9F: 5'-AGGCCATGGATGCGATCG-3' (SEQ ID No.18);

[0074] 10R: 5'-TGATGTAATTCAGCCTCGCA-3' (SEQ ID No.19).

[0075] (1) DNA fragment preparation: Split-PCR method was used to amplify the LB+HY fragment using primers 1F and 8R, and the RB+YG fragment using primers 9F and 4R for transformation.

[0076] (2) Shake culture of mycelium: Burn the coated loop red, add 2 mL of CM liquid culture medium to the colony OTA plate, and gently smear it on the surface of the mycelium block to break the mycelium into the CM liquid culture medium. Transfer the CM liquid culture medium containing the broken mycelium into a culture bottle containing CM medium and shake culture at 28°C for 36 hours.

[0077] (3) Collecting hyphae: Filter the shaken hyphae using a funnel covered with four layers of sterile lens paper, and rinse the remaining CM medium on the mycelial mass with 0.7 M NaCl solution. Transfer the hyphae to a 50 mL weighed centrifuge tube and then weigh it.

[0078] (4) Enzymatic hydrolysis of mycelium: Add 1 mL of enzyme solution per gram of mycelium, then add 9 mL of 0.7 M NaCl solution, and then shake at 28°C and 150 rpm for 3-4 hours.

[0079] (5) Protoplast collection: Filter the enzymatic hydrolyzate from step (4) through three layers of sterilized lens paper, rinse slowly with 0.7 M NaCl solution, collect in an ice bath into a 50 mL centrifuge tube, and collect one tube for every 30 mL; then centrifuge at 4000 rpm and 4°C for 15 min, and remove the supernatant; add 5 mL of STC solution to the ice bath, mix well, and centrifuge at 4000 rpm and 4°C for 15 min.

[0080] (6) Protoplast concentration adjustment: After centrifugation in step (5), remove the supernatant, add an appropriate amount of STC solution, and adjust the protoplast concentration to 1×10 8 Protoplasts / mL (approximately 25 protoplasts per minimum grid). Mix protoplasts and DNA fragments: Mix protoplasts and DNA fragments in 300 μL per tube (add the amplified DNA fragments first, then the protoplasts, bringing the total volume to 300 μL). Mix thoroughly with a pipette and place on ice for 20 minutes to obtain a reaction system. 4-8 reaction tubes can be set up for each transformation.

[0081] (7) PEG-mediated transformation: PTC was added dropwise to the reaction system, with approximately 10 drops per tube, until 2 mL of PTC was added to each tube. After addition, the mixture was allowed to stand on ice for 15 min. Then, pre-cooled STC was slowly poured into centrifuge tubes, with 25 mL added to each tube. The mixture was centrifuged at 4000 rpm and 4°C for 15 min, and the supernatant was removed.

[0082] (8) Cell wall regeneration: Add 3 mL of LR medium to each tube, mix well, and place in a 28°C incubator for 12-13 h to allow cell wall regeneration.

[0083] (9) Transformant screening: The protoplasts cultured in LR medium were transferred to a 9 mm culture dish, 12 mL of melted SR (45-55°C, not hot) was added, and the culture dish was shaken to mix. After solidification, 15 mL of TOP Agar (containing 250 μg / mL of Hygromycin B) was poured in to screen for hygromycin resistance. The cells were cultured at 28°C for transformant screening.

[0084] (10) Secondary screening: After 3-4 days of culture in step (9), transformants grew out and were transferred to OTA medium. After 3-4 days of growth, DNA was extracted for identification. The results were as follows: Figure 3 As shown in A and B.

[0085] Figure 3 A in the middle is a schematic diagram of knocking out the HSP1 gene in rice blast fungus using the hygromycin replacement strategy; Figure 3 B in the figure is the result of knockout of HSP1 gene in rice blast fungus detected by PCR technology. ΔMohsp1-16, ΔMohsp1-28 and ΔMohsp1-52 are three HSP1 mutant strains of rice blast fungus, WT represents wild-type rice blast fungus strain, CK represents the detection using sterile water as control; Figure 3 As shown in Figures A and B, the HSP1 gene of rice blast fungus (ZB25) was knocked out by homologous recombination knockout method.

[0086] Test Example 1

[0087] The pathogenicity of the rice blast fungus mutants ΔMohsp1-28 and ΔMohsp1-52 obtained in Example 3 was analyzed in barley. The experiment was conducted in the Plant Pathology Building of Huazhong Agricultural University on June 8, 2022. The barley was divided into WT group, hsp1-28 group, hsp1-52 group and CK group, and treated as follows. The results are shown in Figure 2. Figure 4 As shown;

[0088] WT group: barley was inoculated with spores of wild-type strain of rice blast fungus by point-grafting method.

[0089] hsp1-28 group: barley was inoculated with spores of the blast fungus ΔMohsp1-28 strain using the spot inoculation method.

[0090] hsp1-52 group: barley was inoculated with spores of the blast fungus ΔMohsp1-52 strain using the spot inoculation method.

[0091] CK group: sterile water was used as a control and barley was inoculated using the point grafting method.

[0092] In addition, barley samples were selected and divided into WT group, hsp1-28 group, hsp1-52 group and CK group, and processed as follows. The results are shown in Figure 5 As shown;

[0093] WT group: barley was inoculated by spraying spores of wild-type strain of rice blast fungus to simulate field inoculation.

[0094] hsp1-28 group: barley was inoculated by spraying spores of the blast fungus ΔMohsp1-28 strain to simulate field inoculation.

[0095] hsp1-52 group: barley was inoculated by spraying spores of the blast fungus ΔMohsp1-52 strain to simulate field inoculation.

[0096] CK group: barley was inoculated by spraying with sterile water to simulate field inoculation.

[0097] Depend on Figure 4 and Figure 5 It can be seen that after knocking out the HSP1 gene in rice blast fungus, its pathogenicity was significantly reduced.

[0098] Test Example 2

[0099] The infection ability of Δhsp1 of the blast fungus HSP1 gene knockout mutants ΔMohsp1-28 and ΔMohsp1-52 obtained in Example 3 was analyzed in rice, and the experiment was conducted in the Plant Pathology Building of Huazhong Agricultural University on June 18, 2022.

[0100] Rice plants were divided into WT, hsp1-28, hsp1-52, and CK groups and treated as follows:

[0101] WT group: Sporulation of wild-type strain of rice blast fungus was used to inoculate rice.

[0102] hsp1-28 group: rice was inoculated with spores of the blast fungus ΔMohsp1-28 strain using the spray method.

[0103] hsp1-52 group: rice was inoculated with spores of the blast fungus ΔMohsp1-52 strain using the spray method.

[0104] CK group: sterile water was inoculated on rice using the spray method.

[0105] The results are as follows Figure 6 As shown by Figure 6It can be seen that after the HSP1 gene is knocked out, the rice blast fungus loses its pathogenicity to rice.

[0106] Example 4

[0107] Construction of HIGS silencing vector and HSP1 gene transgenic rice based on HSP1 gene

[0108] RNA from Rhizoctonia solani was extracted and reverse transcribed to obtain cDNA. Conserved fragments of HSP1 genes in three pathogens were selected and specific primers for the interference region were designed.

[0109] Reference designed primers are as follows:

[0110] Sep-(﹢)-F: 5'-gagggcgcgcctgcaggtaccGACTACCGTCGCCGTCATCT-3' (SEQ ID No. 20);

[0111] Sep-(﹢)-R: 5'-GCACGCGTACGTAAGGTTGGATCCCGTGTCAGCCTTGGCAATC A-3' (SEQ ID No. 21);

[0112] Sep-(﹣)-F: 5'-AAACAATTCAATTCAGTGGAGCTCCGTGTCAGCCTTGGCAA-3' (SEQ ID No. 22);

[0113] Sep-(-)-R: 5'-CAGGACTCTAGACCCACTAGTGACTACCGTCGGCGTCAT-3' (SEQ ID No. 23); wherein lowercase letters represent homology arms.

[0114] 1. Use primer Sep-(+)-F / R for positive strand amplification and gel purification using a Vazyme FastPure Gel DNA Extraction Mini Kit (DC301-01). Follow the steps described in the kit to obtain positive strand DNA and store at -20°C.

[0115] 2. Use the One-Step Cloning Kit to ligate the positive-strand DNA obtained in Step 1 into the DS1301 vector digested with Kpn I and Bam HI, and then transform it into E. coli. After screening for positive transformants, perform sequencing. Culture the bacteria containing the correct sequence overnight at 37°C for 12-16 hours, extract the plasmid using a plasmid extraction kit (Vazyme, FastPure Plasmid Mini Kit, DC201-01) and store at -20°C.

[0116] The extracted recombinant plasmid, which had been sequenced correctly, was digested with Spe I and Sac I and recovered from the gel. The antisense strand was amplified using Sep-(-)-F / R primers. After gel recovery, the antisense strand was ligated into the recombinant vector digested with Spe I and Sac I using a One-Step Cloning Kit and transformed into E. coli. Positive transformants were screened, and the plasmids were extracted and sequenced to obtain the HSP1 silencing vector for rice plants.

[0117] 3. Screen the positive clones by PCR and obtain the HSP1 silencing vector for rice plants for HSP1 rice transgenesis:

[0118] (1) Induction of rice callus: Rice seeds were sterilized with 0.1% w / v mercuric chloride and callus was cultured on N6 induction medium.

[0119] (2) Agrobacterium infection and co-cultivation: The vector containing the HSP1 silencing gene was transferred into GV3101 Agrobacterium, and the rice callus was placed in the Agrobacterium solution for infection for 30 min. After the infection, the bacterial solution was dried and the callus tissue was placed in a co-culture medium containing 0.1% w / v AS and cultured for 3 days.

[0120] (3) Screening of positive calli: The co-cultured calli were washed with ddH2O containing 0.1% w / v Cn and 0.1% w / v HYG and then cultured for 7 to 14 days.

[0121] (4) Callus differentiation: The newly grown callus tissue was placed on differentiation medium (10 wt% Vitamin, 10 wt% Fe 2+ -EDTA, 2wt% 6-BA, 2wt% KT, 0.2wt% IAA, 0.2wt% NAA), cultured at 25°C for about 30 days, and then transferred to rooting medium (10wt% Vitamin, 10wt% Fe 2+ -EDTA), and transplanted after rooting. PCR detection was performed on the transgenic rice to screen for transgenic rice with HSP1 silencing gene. The results were as follows Figure 7 As shown, A is the result of identifying HSP1 transgenic rice by PCR, and B is the growth status of HSP1 transgenic rice and wild-type rice.

[0122] Depend on Figure 7 It can be seen that the HIGS transgenic lines that can express silencing HSP1 in rice were screened by PCR detection ( Figure 7 A), its growth phenotype showed no significant difference from that of the wild type ( Figure 7 Middle B).

[0123] Test Example 3

[0124] Evaluation of resistance of HSP1 transgenic rice to blast fungi and sheath blight for creating new disease-resistant varieties

[0125] The rice blast strain ZB25 (described in Sha G, et al. Genome editing of a rice CDP-DAGsynthase confers multipathogen resistance. Nature. 2023 Jun; 618(7967): 1017-1023. doi: 10.1038 / s41586-023-06205-2. Epub 2023 Jun 14. PMID: 37316672.) and the rice sheath blight pathogen Rhizoctonia solani strain (WH-1) (described in Hu B, et al. Repressed OsMESL expression triggers reactive oxygen species-mediated broad-spectrum disease resistance in rice. Plan t Biotechnol J. 2021 Aug; 19(8): 1511-1522. doi: 10.1111 / pbi.13566. Epub 2021 Apr) were used. 6. PMID: 33567155; PMCID: PMC8384603.) and rice false smut strain JS60-2 (described in Wang Y, et al. Gap-free nuclear and mitochondrial genomes of Ustilaginoidea virens JS60-2, a fungal pathogen causing rice false smut) were used to test the fungal resistance of the HIGS transgenic rice created by the HSP1 gene obtained in Example 4.

[0126] 1. Inoculate rice blast fungi on rice leaves at the seedling stage using the puncture method:

[0127] The rice blast fungus cultured on OTA medium for one week was cut into 5 mm pieces. 2 The leaves of HSP1 knockout rice (HSP1) and wild-type rice (WT) were punctured with small pieces of bacteria. The bacterial pieces were then placed on the wounds of the rice leaves, sealed with tape, and placed in a greenhouse for observation of disease. At least six strains of HSP1 transgenic rice (HSP1) and wild-type rice were inoculated. 14 days after inoculation, the length of the lesions was counted. The results are as follows: Figure 8 As shown in A.

[0128] 2. Inoculate the rice sheath blight strain on the leaves of rice seedlings using the puncture method:

[0129] The sheath blight fungi cultured on PDA medium for 2 days were cut into 5 mm 2 The leaves of HSP1 transgenic rice (HSP1) and wild-type rice (WT) were punctured with small pieces of bacteria, and then the bacterial pieces were placed on the wounds of the rice leaves. The wounds were sealed with tape and placed in a greenhouse for observation of disease. At least 6 strains of HSP1 transgenic rice (HSP1) and wild-type rice were inoculated. 14 days after inoculation, the area of ​​the lesions was counted. The results are as follows: Figure 8 As shown in B.

[0130] according to Figure 8 It can be seen that compared with wild-type rice leaves, the resistance of HSP1 gene transgenic rice stably expressing strains to rice blast and sheath blight has been significantly improved, indicating that HSP1 gene transgenic rice can effectively inhibit the infection of rice blast and sheath blight.

[0131] 3. Inoculate the rice spikelets at the rice booting stage by injection: Cut the rice spikelets cultured on PSA medium for 2 days into 5mm pieces. 2 Small pieces of 200 μg of rice were placed in a potato sucrose liquid medium and shaken for 5 days. The bacterial solution was drawn up with a syringe and injected into the booting area of ​​HSP1 transgenic rice (HSP1) and wild-type rice (WT) respectively. The rice was placed in a greenhouse for disease observation. At least 6 strains of HSP1 knockout rice (HSP1) and wild-type rice were inoculated. 20 days after inoculation, the area of ​​lesions was counted. The results are as follows: Figure 9 shown.

[0132] according to Figure 9 It can be seen that compared with the panicle of wild-type rice, the resistance of HSP1 gene transgenic rice stably expressing strains to rice blast fungus has been significantly improved, indicating that HSP1 gene transgenic rice can effectively inhibit the infection of rice blast fungus.

[0133] Test Example 5

[0134] Field resistance testing and panicle blast analysis of HSP1 gene knockout rice lines to a spectrum of rice blast fungi in Enshi, Hubei.

[0135] In late June 2023, the HSP1 gene knockout rice and wild-type rice obtained in Example 4 were sown in the rice blast disease base in Xianfeng County, Enshi Tujia and Miao Autonomous Prefecture, Hubei Province. The incidence of HSP1 blast in the field was investigated in August and September, and the number of lesions on diseased leaves, rice plant height, and panicle disease characteristics were counted. The results are as follows: Figure 10As shown, in which WT in A represents the symptom diagram of wild-type rice sown in the rice blast disease nursery in Enshi, Hubei, and HSP1 represents the single-plant panicle blast symptom diagram of HSP1 gene knockout rice sown in the rice blast disease nursery in Enshi, Hubei; B is the statistical result of the number of lesions of rice blast fungus in diseased leaves of rice infected with rice blast fungus; C is the statistical result of the plant height of wild-type and HSP1 gene knockout rice in the field; D is a schematic diagram of diseased panicles of wild-type and HSP1 gene knockout rice infected with rice blast fungus in the field; E is the statistical result of the diseased panicle rate of wild-type and HSP1 gene knockout rice in the field; "****" indicates significant p-value < 0.0001.

[0136] Figure 10 The results showed that HSP1 gene knockout plants can effectively inhibit the occurrence of rice blast in field disease nurseries and reduce the damage caused by the blast fungus. At the same time, they have good field resistance at both the seedling and booting stages.

[0137] Test Example 6

[0138] Statistics of agronomic traits of HSP1 gene knockout rice lines in the field.

[0139] In mid-December 2023, the HSP1 gene knockout rice and wild-type rice obtained in Example 4 were sown in the field rice base in Yingzhou Town, Sanya City, Hainan Province. In April 2024, the agronomic traits of the field HSP1 gene knockout strains and wild-type were statistically analyzed. The grain length, grain width and panicle characteristics were compared, and the growth status was as follows: Figure 11 The comparison results of grain length, grain width and ear characteristics are shown in Figure 12 As shown, ns indicates no significant difference.

[0140] Figures 11 and 12 The statistical results shown showed that there were no significant differences in panicle shape, grain length, and grain width between HSP1 gene knockout rice and wild-type rice.

[0141] As can be seen from the above examples, the rice broad-spectrum disease-resistance gene HSP1 obtained by the screening method provided by the present invention has a simple sequence, can be stably transformed in monocotyledonous rice, and has significant disease resistance effects against rice blast, sheath blight and false smut, while having no effect on rice growth and fruiting, and does not affect rice yield.

[0142] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Plant broad-spectrum disease resistance genes HSP1 The application of a gene in preventing and controlling rice diseases and / or enhancing rice resistance to pathogens is characterized in that: Insertion expression in rice using RNAi system HSP1 The highly conserved region of the gene, which is inserted into the rice HSP1 The method comprises: introducing an HSP1 silencing vector into a rice plant; the HSP1 silencing vector comprises a basic vector and a target sequence inserted into the basic vector; the target sequence comprises HSP1 A highly conserved region of a gene and a reverse complementary strand of the highly conserved region, HSP1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 1; the nucleotide sequence of the highly conserved region is shown in SEQ ID No. 3; The rice diseases include rice blast, sheath blight and false smut; The pathogens include rice blast fungus ( Magnaporthe oryzae ), Rhizoctonia solani ( Rhizoctonia solani ) and U. oryzae ( Ustilaginoidea virens ).

2. A method for enhancing the resistance of rice to pathogens, characterized in that: The steps include: using RNAi system to insert expression in rice HSP1 Highly conserved regions of genes; The insertion expression in rice HSP1 Methods for highly conserved regions of genes include: HSP1 The silencing vector is introduced into rice plants; HSP1 The silencing vector includes a basic vector and a target sequence inserted into the basic vector; the target sequence includes HSP1 A highly conserved region of a gene and a reverse complementary strand of the highly conserved region, wherein the nucleotide sequence of the highly conserved region is shown in SEQ ID No. 3, and the nucleotide sequence of the reverse complementary strand of the highly conserved region is shown in SEQ ID No. 4; The pathogens include rice blast fungus ( Magnaporthe oryzae ), Rhizoctonia solani ( Rhizoctonia solani ) and U. oryzae ( Ustilaginoidea virens ); described HSP1 The nucleotide sequence encoded by the gene is shown in SEQ ID No. 2.

Images