Construction method and application of mouse expressing heavy-chain antibody IgG1

Abstract

The invention discloses a construction method and application of a mouse for expressing a heavy-chain antibody IgG1, and relates to the technical field of biology. The mouse capable of expressing the heavy-chain antibody IgG1 is constructed by the method provided by the invention, does not contain an immunoglobulin light-chain gene and a gamma1-CH1 exon, can generate the IgG1 type heavy-chain antibody, and is relatively high in expression quantity and strong in antigen affinity. The invention also provides an application of a mouse expressing the heavy-chain antibody IgG1 in production of a nano antibody. The invention provides a new thought and method for further modifying and transforming transgenic mice expressing more heavy-chain antibodies, and effectively solves the problems of low heavy-chain antibody expression quantity, weak antigen affinity and weak immune response of the existing mice.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for constructing a mouse expressing heavy chain antibody IgG1 and an application thereof. Background Art

[0002] Traditional antibody molecules are composed of two identical heavy chains and two identical light chains. Heavy chain antibodies (HcAb), also known as single-chain antibodies, are a special type of antibody molecules that contain only two identical heavy chains and naturally lack light chains. Heavy chain antibodies exist in the immune systems of camels, sharks, and humans with certain diseases. The variable region of heavy chain antibodies can be expressed alone to form a single domain antibody with a size of nanometers, also known as nanobody (Nb). Compared with traditional antibodies, nanobodies have the advantages of small molecular weight, strong stability, and high affinity, and have broad application prospects in biomedicine and other fields.

[0003] At present, most nanoantibodies are obtained from camelids, but the cost of raising camelids is high, and the immune response of different individuals to antigens varies greatly. These problems have largely limited and hindered the development and application of nanoantibodies. Compared with camelids, laboratory model animals mice and rats have the advantages of low cost, convenient breeding, and fast reproduction. Existing studies have shown that by knocking out the CH1 exon of the endogenous γ2a and γ1 genes of mice and rats, IgG2a or IgG1 heavy chain antibodies can be produced in small animals. However, the expression levels of these heavy chain antibodies are low, and the immune response of these small animals when immunized with different antigens is weak, and the antigen affinity of the screened nanoantibodies is also weak. Therefore, it is necessary to construct a small animal model that can effectively express heavy chain antibodies, improve the expression of heavy chain antibodies, and thus improve the immune response ability of heavy chain antibodies. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention provides a method for constructing a mouse expressing heavy chain antibody IgG1 and its application. The mouse expressing heavy chain antibody IgG1 constructed by the present invention can produce IgG1 type heavy chain antibodies with high expression levels and strong antigen affinity, which provides new ideas and methods for further modifying and transforming transgenic mice expressing more diverse heavy chain antibodies, and effectively solves the problems of low heavy chain antibody expression, weak antigen affinity and weak immune response of existing mice.

[0005] To achieve the above-mentioned purpose, the technical solution adopted by the present invention to solve the technical problem is: to provide a method for constructing a mouse expressing heavy chain antibody IgG1, comprising the following steps: mating HG1 mice with light chain knockout mice to obtain intermediate generation mice, and mating the intermediate generation mice with each other to obtain mice expressing heavy chain antibody IgG1, namely HG1ΔL mice.

[0006] Furthermore, HG1 mice do not contain the γ1-CH1 exon.

[0007] Furthermore, light chain knockout mice contain no endogenous immunoglobulin light chain genes.

[0008] Furthermore, the intermediate generation mice were mated with each other until homozygous offspring were obtained.

[0009] A mouse expressing heavy chain antibody IgG1 was constructed using the above-mentioned method for constructing a mouse expressing heavy chain antibody IgG1.

[0010] Furthermore, mice expressing heavy chain antibodies IgG1 do not contain immunoglobulin light chain genes and the γ1-CH1 exon.

[0011] The use of the above-mentioned mouse expressing heavy chain antibody IgG1 in the production of nanoantibodies.

[0012] Furthermore, phage display technology was used to screen nanoantibodies with high affinity to specific antigens from immunized mice.

[0013] The present invention has the following beneficial effects:

[0014] 1. The HG1ΔL mice provided by the present invention can produce IgG1 heavy chain antibodies with high expression levels after knocking out the light chain gene and the CH1 exon of the γ1 gene, and the expression levels of other immunoglobulin subtypes are significantly reduced, which provides new ideas and methods for further modifying and transforming transgenic mice that express more diverse heavy chain antibodies.

[0015] 2. HG1ΔL mice can produce a high immune response to specific antigens, thereby producing antigen-specific IgG1 heavy chain antibodies. This mouse model can effectively screen nanoantibodies, reducing the economic cost of nanoantibody screening. Nanoantibodies with strong antigen specificity and affinity can be obtained through screening, and the stability and neutralizing activity of nanoantibodies are high, which provides strong support for the development and application of nanoantibodies and broadens the source of animals for nanoantibody preparation. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of the immunoglobulin heavy chain and light chain knockout sites in HG1ΔL mice;

[0017] Figure 2This is the PCR result for genotyping HG1ΔL mice;

[0018] Figure 3 The Western Blot results of IgG1 under non-reducing conditions and reducing conditions are shown;

[0019] Figure 4 The Western Blot results of Igκ under non-reducing conditions and reducing conditions are shown;

[0020] Figure 5 The Western Blot results of other immunoglobulins under non-reducing conditions are shown;

[0021] Figure 6 The Western Blot results of other immunoglobulins under reducing conditions are shown;

[0022] Figure 7 This is a comparison chart of the ELISA test results of the expression of serum immunoglobulins in different mice at resting state;

[0023] Figure 8 The figure shows the flow cytometry results of total B cells (B220+) in the bone marrow of HG1ΔL mice and wild-type mice;

[0024] Fig. 9 Statistical graphs of the proportion and number of total B cells in the bone marrow of HG1ΔL mice and wild-type mice;

[0025] Fig.10 IgM in the bone marrow of HG1ΔL mice and wild-type mice + IgD - ) and mature (IgM + IgD + ) B cell flow cytometry results;

[0026] Fig.11 IgM in the bone marrow of HG1ΔL mice and wild-type mice + IgD - ) Statistical graph of B cell ratio and cell number;

[0027] Fig.12 Mature IgM in the bone marrow of HG1ΔL mice and wild-type mice + IgD + ) Statistical graph of B cell ratio and cell number;

[0028] Fig.13 Frequency analysis plots were used for the wild-type and HG1ΔL mouse IgG1 VH gene families;

[0029] Fig.14Frequency analysis plots were used for the wild-type and HG1ΔL mouse IgG1 JH gene families;

[0030] Fig.15 This is the statistical diagram of the amino acid length distribution of HG1ΔL mouse IgG1 CDR3;

[0031] Fig.16 This is a trend chart of the titer change of antigen-specific IgG1 antibodies in the sera of wild-type and HG1ΔL mice after immunization with African swine fever antigen;

[0032] Fig.17 The titer change trend of antigen-specific IgG1 antibodies in the serum of wild-type and HG1ΔL mice after immunization with African swine fever antigens with different adjuvants;

[0033] Fig.18 This is an information diagram of the CDR region of the monoclonal antibody sequence specific for African swine fever virus antigen;

[0034] Fig.19 This is the Western Blot result of E165R antigen-specific nanobody;

[0035] Fig. 20 This is the Coomassie Brilliant Blue staining image of the E165R antigen-specific nanobody after prokaryotic expression and purification;

[0036] Fig.21 This is a dot blot result of the E165R antigen-specific nanobody;

[0037] Fig. 22 This is the ELISA result of E165R antigen-specific nanobody;

[0038] Fig.23 This is a comparison of the binding ability of E165R antigen-specific nanoantibodies to antigens at high temperatures. DETAILED DESCRIPTION

[0039] The principles and features of the present invention are described below, and the examples are only used to explain the present invention and are not used to limit the scope of the present invention. If no specific conditions are specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0040] Example 1 Construction of HG1ΔL mice and knockout sites

[0041] (1) Construction of HG1ΔL mice

[0042] The mice used in this study were specific pathogen-free SPF mice. All mice were housed in standard IVC cages in a controlled animal facility with a temperature of approximately 25°C and a humidity of approximately 60%, with free access to food and water, and maintained under SPF conditions with a 12-h light / dark cycle. The animal experiments were approved by the Animal Care and Use Committee of China Agricultural University.

[0043] The HG1 mice constructed earlier in our laboratory were crossed with Igλ - / - Igκ - / - Mice acquire γ1 + / - Igλ + / - Igκ + / - Intermediate generation mice, after mating with each other for many generations, homozygous γ1 was obtained - / - Igλ - / - Igκ - / - Mice, namely HG1ΔL mice.

[0044] (2) Immunoglobulin heavy chain and light chain knockout sites in HG1ΔL mice

[0045] The composition of the immunoglobulin heavy and light chain loci in HG1ΔL mice is shown in Figure 1 shown.

[0046] Depend on Figure 1 It can be seen that VH, DH, and JH represent the heavy chain V gene, D gene, and J gene, respectively, and Cμ-Cα represents the heavy chain constant region gene, of which Cγ1 lacks 352bp including the CH1 exon. The Igκ light chain has only one constant region, Cκ, and 416bp including the constant region have been deleted. The Igλ light chain has four constant regions, Cλ1-Cλ4, and a large fragment of 138.5Kb has been deleted from the upstream of the first constant region to the downstream of the last constant region. HG1ΔL mice are homozygous mice with three gene knockouts obtained by mating HG1 mice with light chain knockout mice.

[0047] Example 2 Identification of HG1ΔL Mouse Genotype

[0048] (1) Obtaining HG1ΔL mice and extracting the mouse tail genome

[0049] 1) Cut an appropriate amount of mouse tail tissue and place it in a 1.5 mL centrifuge tube, add 600 μL DNA extraction solution and 20 μL egg yolk.

[0050] White enzyme K (10 mg / mL), invert to mix, place in a 55°C metal bath and shake at 600 rpm overnight (about 10 h);

[0051] 2) Add 200 μL of saturated NaCl solution to the digestion solution, invert and mix, a white precipitate will appear in the solution, and then incubate at 4°C

[0052] Centrifuge at 13000 rpm for 10 min;

[0053] 3) Take the supernatant after centrifugation and add it to a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol and mix well. Centrifuge at 13,000 rpm for 10 min at room temperature. When a precipitate appears at the bottom of the tube, discard the supernatant.

[0054] 4) Add 600 μL 75vt% ethanol to wash the precipitate, centrifuge at 13000 rpm for 10 min, discard the supernatant, and repeat this step once;

[0055] 5) Open the centrifuge tube, dry it at room temperature, and then add 50 μL of double distilled water to dissolve the DNA;

[0056] 6) The concentration of DNA was measured by NanoDrop 3000 UV spectrophotometer, and then the DNA was stored at -20°C.

[0057] (2) Genotype identification

[0058] The mouse genotype was identified by PCR. The upstream primer for the γ1 gene was designed in the upstream intron of the γ1-CH1 exon, and the downstream primer was designed in the intron between the CH1 exon and the hinge region. The PCR system is shown in Table 1, and the amplification program is shown in Table 2. The genotype identification results are shown in Figure 2 shown. Figure 2 In the figure, KO represents HG1ΔL mice, WT represents wild-type mice, H represents heterozygous mice, NC represents blank control, and M represents a 100 bp DNA marker.

[0059] The primer sequences are as follows:

[0060] HGI-F: ATGGCCTCAGGTCTCATCTG

[0061] HG1-R:CGATCTTCTGGGCTGAGATC

[0062] Igλ-Com-F:GGGAAGGCATAACCCTGGT

[0063] Igλ-WT-R:GGGCACTTCTTGCCTTATGAA

[0064] Igλ-KO-R:GGCCTTGGATAACCTCAGGAT

[0065] Igκ-WT-F:GTGAGGCCACTCACAAGACA

[0066] Igκ-KO-F:TCGCCTTCTTGACGAGTTCT

[0067] Igκ-Com-R: GGTGGATTTCAGGGCAACTA

[0068] Table 1 PCR system

[0069] Reagents system 2×Taq PCR Mix 12.5 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 template 1 ddH2O 9.5 Total 25

[0070] Table 2 PCR amplification program

[0071]

[0072]

[0073] Depend on Figure 2 It can be seen that since the CH1 exon was completely deleted on both chromosomes of HG1ΔL mice, a band of about 290bp can be amplified. Heterozygous mice showed two PCR amplification bands of different lengths, one about 290bp and the other about 590bp. In heterozygous mice, the γ1-CH1 exon was successfully gene-edited on one chromosome, resulting in the exon being deleted, while the other chromosome remained unchanged. In wild-type mice, since no changes were made to the CH1 region, the PCR amplification results showed a DNA band of about 590bp, which is consistent with the expected length of the unedited genome. In order to detect the knockout of Igλ, a common upstream primer was designed upstream of Igλ-JH2, and the downstream primers were designed at both ends of the knockout sequence. HG1ΔL mice can detect a band of about 640bp, while wild-type mice can detect a band of about 510bp, and heterozygous mice can detect two bands of 640bp and 510bp. Three primers were also designed to detect Igκ knockout. The upstream primers were designed on the knockout sequence and the non-knockout sequence, and the common downstream primer was designed downstream of the constant region. The results showed that HG1ΔL mice detected a band of about 180 bp, wild-type mice detected a band of about 380 bp, and heterozygous mice also detected two bands. Genomic level detection confirmed that HG1ΔL mice knocked out the γ1-CH1 domain and light chain genes.

[0074] Example 3 Detection of immunoglobulin expression in HG1ΔL mice

[0075] (1) Detection of IgG1 heavy chain antibodies

[0076] To detect whether the γ1 gene can be normally translated to produce IgG1 heavy chain antibodies, the serum of HG1ΔL mice was collected and wild-type and HG1 mice were used as controls. Western Blot experiments were performed to detect its expression in the serum of HG1ΔL mice. Wild-type mouse serum was diluted 50 times with PBS, HG1ΔL mouse and HG1 mouse serum was diluted 25 times with PBS, goat anti-mouse IgG1-HRP antibody was diluted 10,000 times, and 1mM DTT was used as a reducing agent. The results are shown in Figure 3 As shown, the left figure is the Western Blot result of IgG1 under non-reducing conditions, and the right figure is the Western Blot result of IgG1 under reducing conditions. KO represents HG1ΔL mice, HG1 represents HG1 mice, and WT represents wild-type mice.

[0077] Depend on Figure 3 It can be seen that under non-reducing conditions, since HG1ΔL mice lack the CH1 domain and light chain, only heavy chain dimers are produced, and the molecular weight is about 100kDa, which is consistent with the expected size. The molecular weight of the wild type is about 180kDa. Under reducing conditions, the disulfide bonds connecting immunoglobulin molecules are destroyed, and the heavy chain exists alone. The size of IgG1 in HG1ΔL mice is about 40kDa, which is consistent with the characteristics of the lack of CH1 domain. Wild-type mice can detect normal bands of about 55kDa. HG1 mice lack the CH1 domain, and the heavy chain cannot covalently bind to the light chain. The molecular weight is consistent with that of HG1ΔL mice, which proves that IgG1 heavy chain antibodies can be normally expressed in the serum of HG1ΔL mice. Through further comparative analysis, it was found that under the same sample amount, the gray value of the detection band of HG1ΔL mice was larger than that of HG1 mice, which preliminarily indicated that the content of IgG1 heavy chain antibodies in HG1ΔL mice was higher than that in HG1 mice.

[0078] (2) Light chain antibody detection

[0079] There are two main types of light chains in mice: Igκ light chain and Igλ light chain. Igκ light chain accounts for the vast majority of the total light chain in mice, and more than 95% of the light chains are Igκ type. Western Blot was used to detect the presence of Igκ light chain in wild-type mice, light chain-deficient mice, and HG1ΔL mice. Goat anti-mouse Igκ polyclonal antibody was used for detection. Wild-type mouse serum was diluted 100 times with PBS, and HG1ΔL mice and IgL - / - Mouse serum was diluted 20 times with PBS, and goat anti-mouse Igκ-HRP antibody was diluted 10,000 times. Figure 4As shown, the left figure is the Western Blot result of Igκ under non-reducing conditions, and the right figure is the Western Blot result of Igκ under reducing conditions. KO represents HG1ΔL mice, HG1 represents HG1 mice, and WT represents wild-type mice.

[0080] Depend on Figure 4 It can be seen that no Igκ light chain was detected in HG1ΔL mice and light chain-deficient mice under either non-reducing or reducing conditions. Under non-reducing conditions, the disulfide bonds of wild-type mice were not broken, so the immunoglobulins detected were in the form of tetramers with a molecular weight of about 180 kDa. Under reducing conditions, the molecular weight of the light chain was about 25 kDa.

[0081] (3) Detection of expression forms of other immunoglobulins

[0082] Western Blot was used to detect the expression of other immunoglobulins IgG2b, IgG2c, IgG3, and IgM in wild-type mice and HG1ΔL mice. Wild-type mouse serum was diluted 100 times with PBS, HG1ΔL mouse serum was diluted 20 times with PBS, and goat anti-mouse IgG2b, IgG2c, IgG3, and IgM antibodies with HRP were diluted 10,000 times. The results are shown in Figure 5-6 As shown. Among them, Figure 5 In the figure, from left to right are the Western Blot results of IgG2b, IgG2c, IgG3 and IgM under non-reducing conditions. Figure 6 In the figure, from left to right are the Western Blot results of IgG2b, IgG2c, IgG3, and IgM under reduced conditions. KO represents HG1ΔL mice, and WT represents wild-type mice.

[0083] Depend on Figure 5-6 It can be seen that the molecular weight of the IgG3 band detected under non-reducing conditions is about 100 kDa, which is consistent with the expected size of the heavy chain dimer in the absence of light chains. In the absence of light chains, heavy chain-only antibodies will be spontaneously produced, so even if the CH1 domain of IgG3 is not missing, a band of about 40 kDa is still detected under reducing conditions. No clear bands were detected for IgM, IgG2b, and IgG2c in HG1ΔL mice, probably because the expression levels were too low.

[0084] Example 4 Detection of immunoglobulin expression in HG1ΔL mice

[0085] In order to explore the effect of the deletion of γ1-CH1 exon and light chain on the expression of immunoglobulins in HG1ΔL mice, the immunoglobulin subtypes in mouse serum were quantitatively determined by enzyme-linked immunosorbent assay (ELISA), and the immunoglobulin expression levels of HG1ΔL mice and wild-type mice in the non-immunized state were compared. The experimental subjects were 6-7 week-old mice, 20 mice of each type, and serum was obtained by centrifugation after blood collection. The serum of wild-type and HG1ΔL mice was diluted by different multiples, and the immunoglobulin subtypes in the serum detected included IgM, IgG3, IgG1, IgG2b, IgG2c and IgA. When detecting IgM, IgG3, IgG1, IgG2b, and IgA, the wild-type and HG1 mice were diluted 4000 times, the HG1ΔL mice were diluted 2000 times, and the wild-type mice, HG1 mice, and HG1ΔL mice were diluted 1000 times when detecting IgG2c. Twenty mice were tested in each group, and two-tailed t-test was used for statistical analysis (Mean±SD). ** indicates p<0.01, *** indicates p<0.001, **** indicates p<0.0001, and ns indicates no statistical difference. Figure 7 shown. Figure 7 Figures AF are the ELISA test results of IgM, IgG3, IgG1, IgG2b, IgG2c and IgA expression in mouse serum, respectively. KO represents HG1ΔL mice, HG1 represents HG1 mice, and WT represents wild-type mice.

[0086] Depend on Figure 7 It can be seen that the expression of IgG1 in HG1ΔL mice was not significantly different from that in wild-type mice, and was significantly higher than that in HG1 mice. This result seems inconsistent with the transcriptional level, which may be caused by changes in post-transcriptional regulation. The levels of IgM, IgG3, IgG2b and IgA in the serum of HG1ΔL mice were significantly lower than those in wild-type mice and HG1 mice, and the expression levels of these immunoglobulin subtypes were consistent with the results of the transcriptional level. The increased expression of proteins such as IgM and IgG2b in HG1 mice may be a supplement to the reduced expression of IgG1. After the γ1-CH1 exon and light chain were knocked out in HG1ΔL mice, other antibody subtypes could not be expressed normally or their expression levels were greatly reduced. IgG1 became the antibody type with the highest expression level in serum again, reducing the dose compensation effect of other antibody subtypes, which is consistent with the previous results of significant decreases in transcriptional and expression levels in Q-PCR and Western Blot.

[0087] In summary, IgG1 in HG1ΔL mice exists in the form of heavy chain antibodies, and there is no light chain band in HG1ΔL mice, which once again proves that HG1ΔL mice completely knock out the γ1-CH1 exon and light chain. ELISA experiments verified that the expression of IgG1 at the protein level was not significantly different from that of wild-type mice, while the expression of other immunoglobulins was significantly reduced. Compared with HG1 mice, after the γ1-CH1 domain and light chain of mice were knocked out at the same time, the dosage compensation effect of other immunoglobulin subtypes was reduced, and the expression of IgG1 antibodies was increased.

[0088] Example 5 Detection of B cell development in the bone marrow of HG1ΔL mice

[0089] In the earliest stage of B cell development in the bone marrow, cells begin to rearrange their heavy chain genes. At this time, the cells are called progenitor B cells (pro B cells). After the heavy chain is successfully rearranged, the cells develop into pre-B cells (pre Bcells), which will express μ heavy chain and pre-B cell receptor (pre-BCR) on the cell surface. After the light chain gene is successfully rearranged, the cells begin to express IgM. At this time, the cells are called immature B cells (Immature B cells), and eventually differentiate into mature B cells (Mature B cells) that co-express IgD and IgM. Ten HG1ΔL mice and wild-type mice aged 6-7 weeks were selected as experimental subjects. Their bone marrow B cells were obtained by dissection and stained with specific antibodies. The development of B cells in the bone marrow was detected using flow cytometry. The results are shown below. Figure 11-15 The experimental results were obtained from three independent experiments, and statistical analysis was performed using a two-tailed t-test (Mean±SD). **** represents p<0.0001. Figure 8 In the figure, the left figure shows the flow cytometry results of total B cells (B220+) in the bone marrow of wild-type mice, and the right figure shows the flow cytometry results of total B cells (B220+) in the bone marrow of HG1ΔL mice. Fig. 9 In the figure, the left figure shows the statistical analysis results of the proportion of total B cells in the bone marrow of HG1ΔL mice and wild-type mice, and the right figure shows the statistical analysis results of the total B cell number in the bone marrow of HG1ΔL mice and wild-type mice. Fig.10 The left picture shows immature (IgM + IgD - ) and mature (IgM + IgD + ) B cell flow cytometry results. The right figure shows immature (IgM + IgD - ) and mature (IgM + IgD + )B cell flow cytometry results. Fig.11The left picture shows immature (IgM) in the bone marrow of HG1ΔL mice and wild-type mice + IgD - ) B cell ratio statistics. The right figure shows the immature (IgM + IgD - )B cell number statistics. Fig.12 The left picture shows the mature (IgM) in the bone marrow of HG1ΔL mice and wild-type mice + IgD + ) B cell ratio statistics. The right figure shows the mature (IgM + IgD + )B cell number statistics.

[0090] Depend on Figure 8-12 It can be seen that the proportion and number of total B cells in the bone marrow of HG1ΔL mice are significantly lower than those of wild-type mice, and the proportion and number of immature B cells and mature B cells are also significantly lower than those of wild-type mice. There are almost no mature B cells in the bone marrow of HG1ΔL mice. This shows that the knockout of γ1-CH1 exon and light chain has a great impact on the development of B cells in the bone marrow of HG1ΔL mice.

[0091] Example 6 Analysis of the usage frequency of heavy chain variable region genes in HG1ΔL mice

[0092] First, we analyzed the usage frequency of variable region genes. According to the IMGT database, there are 16 mouse VH gene families, 4 relatively conservative JH gene families, and high connection diversity at both ends of the DH gene, which cannot be accurately compared with the reference genome. Therefore, we only analyzed the usage frequency of VH and JH genes. Figure 16-17 Each experimental group contained mixed samples of 3 HG1ΔL and WT mice. Fig.13 In the figure, V1-V14 represent 14 VH gene families in mice. Fig.14 In the figure, J1-J4 represent the four JH gene families in mice.

[0093] Depend on Figure 13-14It can be seen that the comparison results of the usage frequency of IgG1VH and JH gene families between wild-type mice and HG1ΔL mice show significant differences in usage frequency. The IGHV1 family occupies an absolute dominant position in wild-type mice, with a usage frequency of about 70%, and its usage frequency is greatly reduced in HG1ΔL mice, accounting for only about 6%. For other IGHV families, such as IGHV2, IGHV3, IGHV4, IGHV5, IGHV6 and IGHV8, HG1ΔL mice also show a decrease in usage frequency compared to wild-type mice. The frequency of use of IGHV9 and IGHV10 families in HG1ΔL mice is significantly higher than that in wild-type mice. The frequency of use of IGHV9 reaches more than 50%, and IGHV10 accounts for about 30%. Most IgG1 antibodies in HG1ΔL mice use these two families, indicating that compared with wild-type, the frequency of use of IgG1 anti-heavy chain antibody VH families in HG1ΔL mice has changed significantly, and there is a preference for the use of VH families in the formation of heavy chain antibodies. There are also significant differences in the use of JH genes between HG1ΔL mice and wild-type mice. The frequency of use of IGHJ2 and IGHJ3 families in HG1ΔL mice has increased significantly, among which IGHJ2 family has the highest frequency of use in HG1ΔL mice, accounting for about 53%, while IGHJ2 accounts for about 25% in wild-type mice. The frequency of use of IGHJ3 family in HG1ΔL mice is about twice that in wild-type mice, and the frequency of use of IGHJ1 and IGHJ4 families in HG1ΔL mice is significantly lower than that in wild-type mice. It was further shown that in the formation of IgG1 heavy chain antibodies, the use of the JH family also showed obvious preference.

[0094] Example 7 Analysis of Characteristics of the CDR3 Region of the HG1ΔL Mouse Heavy Chain

[0095] The amino acid length of the HG1ΔL mouse IgG1 CDR3 region was analyzed. Fig.15 And as shown in Table 3.

[0096] Table 3 Statistics of amino acid length of HG1ΔL mouse IgG1 CDR3

[0097] Sample name Average length of CDR3 (amino acids) WT-IgG1 10.30±2.21 HG1ΔL-IgG1 8.41±2.48

[0098] From Table 3 and Fig.15It can be seen that the most frequently used CDR3 length in the heavy chain variable region of HG1ΔL mice is 8 amino acids, which may be related to the enrichment of a certain sequence. The average length of IgG1CDR3 in HG1ΔL mice is about 8.41±2.48 amino acids, while the average length of IgG1 CDR3 in wild-type mice is about 10.30±2.21 amino acids, which may be caused by the enrichment of 8 amino acid sequences. Compared with wild-type mice, the proportion of CDR3 lengths between 15-21 amino acids in HG1ΔL mice has increased significantly, which may be because the IgG1 heavy chain antibodies in HG1ΔL mice mimic the heavy chain antibodies of camelids in CDR3 length to compensate for the reduced antigen binding ability and structural instability that may be caused by the loss of light chains.

[0099] Example 8 Detection of humoral immune response ability of HG1ΔL mice

[0100] Seven African swine fever virus antigens, namely E165R, P17, P22, P30, P34, P54, and P72, were used to perform multiple immunization experiments on HG1ΔL mice and wild-type mice to detect the concentration of antigen-specific IgG1 antibodies in their serum. The first immunization was subcutaneous injection, and the second to sixth immunizations were intraperitoneal injections. The first three immunizations were 100μg / 100μL each, and the last three immunizations were 200μg / 100μL. The results of antigens E165R, P17, P22, P30, P34, and OVA are shown in the figure. Fig.16 shown. Fig.16 Figures AF show the titers of antigen-specific IgG1 antibodies in the sera of wild-type and HG1ΔL mice after immunization with E165R, P17, P22, P30, P34, and OVA antigens, respectively. The sera of wild-type mice and HG1ΔL mice were diluted 2000 times, the goat anti-mouse heavy chain IgG1-HRP antibody was diluted 10000 times, and the antigen coating amount was 2μg / mL. Mice do not produce immune responses to antigens P54 and P72, so manganese ion adjuvants and Freund's adjuvants were used to stimulate the production of specific antibodies in mice, respectively. The results are shown in Fig.17 shown. Fig.17 Figures AB and CD show the response trends of IgG1-specific antibodies to P54 and P72 antigens immunized with Freund's adjuvant, respectively. 2+ Response trend of IgG1-specific antibodies to adjuvanted P54 and P72 antigens.

[0101] Depend on Fig.16It can be seen that the immune response caused by E165R and P34 antigens was higher, the antigen-specific IgG1 content of HG1ΔL mice was not significantly different from that of wild-type mice, and the antigen-specific IgG1 titer also increased significantly after immunization with P30 and OVA antigens but was only about half of that of the wild-type. After immunization with P17 and P22 proteins, HG1ΔL mice had no immune response and the antigen-specific IgG1 content was almost zero.

[0102] Depend on Fig.17 It can be seen that no matter whether Freund's adjuvant or manganese adjuvant was used, HG1ΔL mice did not have an immune response after immunization with P54 protein, but a higher immune response was produced after immunization with P72 protein. However, the concentration of antigen-specific IgG1 was higher after immunization with Freund's adjuvant, indicating that the use of Freund's adjuvant is more effective than the use of manganese ion adjuvant.

[0103] Example 9 Screening of Nanobodies Specific to HG1ΔL Mouse Antigen

[0104] The variable region genes of IgG1 antibodies in immunized HG1ΔL mice were amplified by nested PCR technology, and then the amplified variable region gene libraries were inserted into phages and expressed, and highly specific nanoantibodies were screened by binding to specific antigens.

[0105] (1) Construction of phage display immune library

[0106] In order to ensure that the amplification results of the variable region of the IgG1 heavy chain antibody obtained from the HG1ΔL mouse are completely derived from the target antibody and can cover all variable region families upstream of the IgG1 heavy chain antibody as much as possible, the present invention designed 12 upstream degenerate primers and 5 second-round amplification upstream degenerate primers based on the mouse heavy chain V region sequence library published on the IMGT website, and amplified using nested PCR technology. The PCR system is the same as Table 1. The PCR program is the same as Table 2.

[0107] The upstream degenerate primer sequences for amplification of the 12 IgG1 heavy chain variable regions are as follows:

[0108] MHV1:ATGAAATGCAGCTGGGGCATSTTCTTC

[0109] MHV2:ATGGGATGGAGCTRTCATSYTCTT

[0110] MHV3:ATGAAGWTGTGGTTAAACTGGGTTTTT

[0111] MHV4:ATGRACTTTGGGYTCAGCTTGRTTT

[0112] MHV5:ATGGGACTCCAGGCTTCAATTTAGTTTCCTT

[0113] MHV6:ATGGCTTGTCYTTRGSGCTRCTCTTCTGC

[0114] MHV7:ATGGRATGGAGCKGGRGTCTTTMTCTT

[0115] MHV8:ATGAGAGTGCTGATTCTTTTGTG

[0116] MHV9:ATGGMTTGGGTGTGGAMCTTGCTTATTCCTG

[0117] MHV10:ATGGGCAGACTTACCATTCTCATTCCTG

[0118] MHV11:ATGGATTTTGGGCTGATTTTTTTTATTG

[0119] MHV12:ATGATGGTGTTAAGTCCTCTGTACC

[0120] The downstream primer sequences for IgG1 variable region amplification are as follows:

[0121] IgG1-CH2-R TGAACGGAAAGTGCTGTTGA

[0122] First, the first round of amplification was performed using an upstream primer located at the upstream leader peptide coding sequence of the heavy chain variable region and a downstream primer located on the CH2 exon of IgG1. In the second round of amplification, an upstream primer covering the entire variable region sequence and a downstream primer starting from the first base of the Hinge domain were used to ensure that the target region could be amplified specifically, and an SfiⅠ restriction site and a protective base were added to the 5' end of the second round primers.

[0123] The sequences of the five upstream degenerate primers for the second round of HG1ΔL mouse amplification of the IgG1 heavy chain variable region are as follows:

[0124] MHVF1-Sfi

[0125] I:ATGCCATGACTGTggcccaggcggccGAGGTGAAGCTTCTCGAGTCTGG

[0126] MHVF2-Sfi

[0127] I:CATGCCATGACTGTggcccaggcggccSAGGTSCAGCTGMAGGAGTCWGGMHVF3-Sfi

[0128] I:CATGCCATGACTGTggcccaggcggccGAGGTCCAGCTGCAACAATCTGG

[0129] MHVF4-Sfi

[0130] I:CATGCCATGACTGTggcccaggcggccSAGGTYCARCTKCAGCAGYCTGG

[0131] MHVF5-Sfi

[0132] I:CATGCCATGACTGTggcccaggcggccGARGTGAAGCTTGWGGAGTCTGG

[0133] The downstream primers for amplifying the variable region are as follows:

[0134] IgG1-Hin-Sfi I:ACTCGCggccggcctggccACAACCACAATCCCTGGGGCAC

[0135] In order to ensure the accuracy and diversity of the library, the products of the first round of amplification were purified and recovered respectively, and the same concentration was used as a template for amplification using the primers of the second round. Then, the products of the second round of amplification were mixed according to the concentration, purified by gel cutting, and connected to the T vector for sequencing to verify the integrity and accuracy of the sequence.

[0136] The invention amplifies the variable regions of IgG1 heavy chain antibodies in the E165R, P30, P34, P72 and Omicron antigen groups with high immune responses, and also screens the P54 antigen group without immune responses as a negative control, wherein the E165R and P54 antigens are mixed immunizations, and the P30 and P34 antigens are mixed immunizations. The construction of the immune library selects three individuals with high specific IgG1 antibody concentrations, extracts their spleen RNAs respectively, and reversely transcribes them into cDNAs as amplification templates, and then performs three technical repetitions for each individual during each amplification. Since only two individuals react when immunized with the Omicron antigen, only these two individuals are selected for the construction of the antibody library. The selected phage vector is pComb3XSS, and the variable region library and the vector are respectively digested with SfiⅠ restriction endonuclease, and the digestion products are recovered and purified. In order to optimize the ratio of the ligation reaction to improve efficiency and success rate, the enzyme-digested variable region library was ligated with pComb3XSS using T4 ligase at different molar ratios of 1:3, 1:5 and 1:7. The ligation product was then transformed into ER2738 bacteria, and single clones were randomly selected for colony PCR detection of positive rates. It was found that the 1:7 ligation ratio had the highest positive rate, so this ratio was selected for large-scale ligation experiments. The ligation product was transformed into ER2738 competent cells by electroporation, and the library capacity after electroporation should reach 10 8 And above can ensure diversity and coverage. The library capacity of the phage library for four groups of different antigens was calculated and the positive rate was evaluated. 24 clones were randomly selected from each phage library plate, and then these clones were verified by colony PCR and sequencing analysis. The results are shown in Table 4.

[0137] Table 4 Phage library capacity and positive rate

[0138] Fungus Library Reservoir capacity (cfu / μL) Positive rate E165R and P54 libraries <![CDATA[7×10 9 ]]> 100％ Omicron Library <![CDATA[5×10 8 ]]> 80％ P30 and P34 libraries <![CDATA[3.2×10 8 ]]> 80％ P72 Library <![CDATA[1.1×10 8 ]]> 92％

[0139] As shown in Table 2, the four specific phage libraries have reached the qualified level. In the four different phage libraries, the positive rate of the selected monoclonal amplification is greater than 85%, and the sequencing results also show that the sequences are diverse, indicating that the library quality is good.

[0140] (2) Screening of African swine fever virus antigen-specific nanoantibodies

[0141] In order to increase the number of useful phages in the phage library, a rescue operation was performed by adding M13KO7 helper phage, and the phage library was titered. Then, the variable region fragments in three phage libraries specific for African swine fever virus antigens were affinity screened. Four rounds of screening were performed according to the adsorption-elution-amplification screening process. During the screening process, the amount of coated antigen decreased round by round. The first two rounds used polar elution, and the last two rounds used competitive elution. High-affinity positive phage clones were screened by creating selection pressure. After each round of screening, the screening effect was evaluated by measuring the titer of the phage library after elution and amplification, and calculating the enrichment rate. The phage library screening sequence is shown in Table 5.

[0142] Table 5 Phage library screening sequence

[0143]

[0144] After four rounds of affinity screening, variable region fragments with high antigen-specific affinity were enriched. After the third and fourth rounds of screening, 23 phage monoclonal clones and one blank clone were randomly selected for phage competition ELISA to detect the binding ability of the screening product with the antigen. If the absorbance value of the antigen well is higher than that of the competition well and the blank control well, it means that the screening product has the ability to bind to the antigen. The clone with a higher absorbance value in the antigen well and a lower absorbance value in the competition well is a positive clone. Using the above method, 32, 0, 41, 45, and 42 monoclonal nanoantibodies with obvious binding activity were screened for E165R, P54, P30, P34, and P72 antigens, respectively. After sequencing, it was found that there were only 8, 4, 4, and 3 different sequences of E165R, P30, P34, and P72 antigen-specific monoclonal antibodies, respectively. The sequence information is shown in the figure below. Fig.18 shown. Fig.18 In FIG. 4 , FIG. AD shows the CDR region information of the E165R, P30, P34 and P72 antigen-specific monoclonal antibody sequences, respectively.

[0145] Example 10 Affinity and sensitivity detection of antigen-specific nanobodies

[0146] (1) Prokaryotic expression and purification of African swine fever virus-specific nanobodies

[0147] The prokaryotic expression vector used was the pComb3XSS vector, which has 6×His and HA tags that can be used for subsequent purification and detection. Therefore, it is only necessary to pick the screened phage monoclonal strain, extract the plasmid, and transform the plasmid verified by sequencing into the E. coli BL21 competent cells. The four strains (numbered E3-4, E3-6, E3-14, and E3-21) in the E165R library obtained by screening were expressed and purified. First, a small-scale induction experiment was carried out to explore the optimal expression temperature and induction time. The expression of the nanoantibody was detected by Western Blot in the E. coli culture fluid after a small amount of expression combined with an anti-His tag antibody. The results are shown in the figure. Fig.19 shown.

[0148] Depend on Fig.19 It can be seen that the size of the nanobody is about 17 kDa. When the induction temperature of E3-4, E3-6, E3-14 and E3-21 antibodies was induced at an IPTG induction concentration of 1 mM for 12 h, the expression level of soluble protein was high and the expression level in inclusion bodies was low. Therefore, this condition was selected for subsequent large-scale expression and purification.

[0149] The E. coli expression system was used to induce the expression of nanoantibodies in large quantities on a 500 mL scale. Because the nanoantibodies have His tags, they can be specifically affinity purified by Ni columns. The bacteria after large-scale expression need to be broken to obtain the bacterial supernatant containing the nanoantibodies. The Ni column was washed with a washing solution containing 20 mM imidazole, and then eluted with imidazole solutions of different concentrations (50 mM, 100 mM and 250 mM) to finally obtain purified monoclonal nanoantibodies. The Coomassie Brilliant Blue staining results of nanoantibodies E3-4, E3-6, E3-14 and E3-21 are shown in the figure. Fig. 20 shown. Fig. 20 Figures AD are the Coomassie brilliant blue staining results of nanobodies E3-4, E3-6, E3-14 and E3-21 after prokaryotic expression and purification.

[0150] Depend on Fig.23 It can be seen that after purification, a single target protein of about 17 kDa can be obtained, and the main band is clear, the content of impurity proteins is low, and the antibody purity and expression level are high.

[0151] Example 11 Detection of Nanobodies

[0152] (1) Dot Blot detection of nanoantibodies

[0153] In order to evaluate the specific binding ability of nanoantibodies to specific antigens, the E165R antigen-specific nanoantibodies E3-4, E3-6, E3-14 and E3-21 were detected by dot hybridization. The pure antigen was diluted to different concentrations and spotted on the nitrocellulose membrane as a substrate. The purified nanoantibody was used as the primary antibody to incubate the nitrocellulose membrane. Because the nanoantibody has His and HA tags, and the antigen itself has a His tag, an anti-HA antibody with an HRP tag was used as the secondary antibody for hybridization. The results are shown in Figure 2. Fig.21 shown. Fig.21 In the figure, Figure AD shows the dot blot hybridization results of E165R antigen-specific nanoantibodies E3-4, E3-6, E3-14 and E3-21, respectively.

[0154] Depend on Fig.21 It can be seen that through the dot hybridization experiment, it was successfully verified that the purified African swine fever-specific nanoantibodies were able to produce obvious spots in the experiment, which directly reflects the high specificity and strong affinity of these nanoantibodies to the target antigens, indicating that these nanoantibodies show good effects in recognizing and binding to African swine fever-specific antigens.

[0155] (2) ELISA detection of nanoantibodies

[0156] The binding ability of E165R antigen-specific nanoantibodies to antigens was evaluated using the ELISA method. Different antigens were used as coating substrates, and the antigens were diluted to 2μg / mL, 1μg / mL, and 500ng / mL for coating. The purified nanoantibodies were diluted according to gradient concentrations and added to the enzyme-labeled wells for incubation. Since the antigen itself has a His tag, the secondary antibody was selected for hybridization with anti-HA antibody. The results are shown in Figure 2. Fig. 22 shown. Fig. 22 Figures AD are the ELISA results of E165R antigen-specific nanoantibodies E3-4, E3-6, E3-14 and E3-21, respectively.

[0157] Depend on Fig. 22 It can be seen that the ELISA results show that when the concentration of African swine fever-specific nanoantibodies is 0.06 μg / mL, the absorbance value of the target well can also reach 0.2, indicating that these four antibodies have high antigen specificity and sensitivity.

[0158] (3) BLI detection of nanobodies

[0159] BLI technology is used to detect the affinity between nano antibodies and specific antigens. The affinity of antibodies is usually expressed by the equilibrium dissociation constant KD (M), which is the ratio of the dissociation rate constant Koff (S-1) to the association rate constant Kon (M-1S-1). The KD value reflects the stability of the binding between the antibody and the antigen. The lower the KD value, the stronger the binding ability of the antibody to the antigen, the slower the dissociation, and the more stable the binding between the antibody and the antigen. By comparing the KD values ​​of different nano antibodies, their affinity for specific antigens can be accurately evaluated, and nano antibodies with the best affinity can be effectively screened out. The KD values ​​of most antibodies are between 10-6M and 10-9M, and the KD of high-affinity antibodies is less than 10-9M, or even less than 10-12M. The present invention uses a SA sensor based on streptavidin-biotin coupling, which uses biotinylated antigens to interact with the sensor surface coupled with streptavidin, thereby achieving efficient and highly specific antigen capture. The antigens were modified by biotin labeling technology and these biotinylated antigens were fixed on the surface of the SA sensor. In this experiment, 30 μg / mL biotinylated antigens were used for immobilization. The antibodies were gradient diluted to different concentrations, and then the affinity was compared by measuring the equilibrium dissociation constant of the antibody and antigen. The test results are shown in Table 6.

[0160] Table 6 Antigen affinity test results of antigen-specific nanobodies

[0161] serial number KD(M) <![CDATA[Koff(S -1 )]]> <![CDATA[Kon(M -1 S -1 )]]> <![CDATA[Full R 2 ]]> <![CDATA[Full X 2 ]]> E3-4 <![CDATA[3.35×10 -9 ]]> <![CDATA[2.17×10 -4 ]]> <![CDATA[6.47×10 4 ]]> 0.9877 1.6590 E3-6 <![CDATA[3.19×10 -9 ]]> <![CDATA[3.45×10 -4 ]]> <![CDATA[1.08×10 5 ]]> 0.9694 4.0232 E3-14 <![CDATA[2.18×10 -9 ]]> <![CDATA[2.87×10 -4 ]]> 1.32×105 0.9696 3.5240 E3-21 <![CDATA[4.28×10 -8 ]]> <![CDATA[3.23×10 -4 ]]> <![CDATA[7.54×10 3 ]]> 0.9934 4.1675

[0162] As shown in Table 6, the KD values ​​of African swine fever antigen-specific nanoantibodies basically reached 10 -9 M, although the KD value of antibody E3-21 is slightly lower, it also reaches 10 -8 M, indicating that the antibody binds tightly to the antigen, and a smooth dissociation curve indicates that the dissociation is slow and the binding is stable.

[0163] (3) Stability testing of nanobodies

[0164] First, the method of treating at high temperature for different time periods was adopted, and the nanoantibodies were treated at 85°C for 0min, 5min, 15min, 25min, 35min, 45min and 60min respectively. After high temperature treatment, the nanoantibodies were restored to room temperature, and then added to the ELISA plate that had been coated with specific antigens and blocked, and incubated at 37°C for 1h. Thereafter, HRP-labeled anti-HA secondary antibodies were added for further incubation, and then the OD450 value was measured. Then, the method of treating at different temperatures for 5min was adopted, and 7 portions of diluted antibodies were taken and incubated at 7 temperatures (4°C, 20°C, 40°C, 60°C, 75°C, 85°C and 95°C) for 5min, respectively. After being taken out, they were restored to room temperature, and the subsequent methods were the same as above. The results are as follows Fig.23 shown.

[0165] Depend on Fig.23 It can be seen that even after high-temperature treatment at 95°C for 5 minutes, the antigen binding ability of most nanobodies has almost no significant change, and they can still maintain a considerable antigen binding ability compared to when they were not treated. This shows the extremely high thermal stability of the tested nanobodies, indicating that they can maintain their functions unchanged under extreme environmental conditions. Among them, E3-21 retains about 40% of its antigen binding ability, and nanobodies E3-4, E3-6 and E3-14 still have more than 70% of their antigen binding ability.

[0166] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for constructing a mouse expressing heavy chain antibody IgG1, characterized in that: The method comprises the following steps: mating HG1 mice with light chain knockout mice to obtain intermediate generation mice, and mating the intermediate generation mice with each other to obtain mice expressing heavy chain antibody IgG1.

2. The method for constructing a mouse expressing heavy chain antibody IgG1 according to claim 1, characterized in that: The HG1 mouse does not contain the γ1-CH1 exon.

3. The method for constructing a mouse expressing heavy chain antibody IgG1 according to claim 1, characterized in that: The light chain knockout mouse contains no endogenous immunoglobulin light chain genes.

4. The method for constructing a mouse expressing heavy chain antibody IgG1 according to claim 1, characterized in that: The intermediate generation mice were mated with each other until homozygous offspring were obtained.

5. A mouse expressing heavy chain antibody IgG1 constructed by the method for constructing a mouse expressing heavy chain antibody IgG1 according to any one of claims 1 to 4.

6. The mouse expressing heavy chain antibody IgG1 according to claim 5, characterized in that The mouse lacks the immunoglobulin light chain gene and the γ1-CH1 exon.

7. Use of the mouse expressing heavy chain antibody IgG1 according to claim 5 in producing nanobodies.

Images