A cdksnap3 gene snp molecular marker related to yellow-feathered broiler feed conversion rate and application thereof

By screening CDK5RAP3 gene SNP molecular markers in yellow-feathered broilers and detecting homozygous individuals with the GG genotype, the problem of the lack of effective genetic molecular markers in existing technologies has been solved. This has enabled efficient screening and breeding with low feed conversion rates, reduced breeding costs, and improved economic benefits.

CN119220703BActive Publication Date: 2026-06-26SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411593059.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-08
Publication Date
2026-06-26
Estimated Expiration
2044-11-08

AI Technical Summary

Technical Problem

The lack of effective genetic molecular markers related to feed conversion rate in yellow-feathered broilers in existing technologies makes it difficult to efficiently screen and breed chickens with low feed conversion rates, which affects breeding costs and economic benefits.

Method used

A molecular marker for the CDK5RAP3 gene located on chromosome 27 of chicken is provided, with a mutation site of A/G. Homozygous individuals with the genotype GG are detected by PCR technology to screen for yellow-feathered broiler chickens with the excellent trait of low feed conversion ratio.

Benefits of technology

This enables efficient screening and breeding of yellow-feathered broilers with low feed conversion rates, reducing feed consumption during production and improving the company's economic benefits and competitiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119220703B_ABST
    Figure CN119220703B_ABST
Patent Text Reader

Abstract

The application discloses a CDK5RAP3 gene SNP molecular marker related to yellow-feathered broiler feed conversion rate and application thereof, and belongs to the field of animal genetics and breeding and molecular biology. The SNP molecular marker polymorphism is A / G, is located at the 369307th site of chicken chromosome 27, and has an RS number of rs738324012. The application provides a SNP molecular marker related to yellow-feathered broiler feed conversion rate in a CDK5RAP3 gene on chicken chromosome 27, the marker indicates that there is a significant difference in feed conversion rate between yellow-feathered broilers with different genotypes, and the marker can be used for efficiently screening individuals or parent yellow-feathered broilers with excellent low feed conversion rate properties; when the marker is applied to yellow-feathered broiler breeding, yellow-feathered broilers with low feed conversion rate can be quickly bred, feed consumption in the production process can be effectively reduced, and economic benefits and competitiveness of enterprises can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of animal genetics and breeding and molecular biology, specifically to a CDK5RAP3 gene SNP molecular marker related to feed conversion rate in yellow-feathered broilers and its application. Background Technology

[0002] Feed efficiency, as a crucial economic trait, has always been a key focus for poultry farming enterprises both domestically and internationally. Chicken meat, with its advantages of low fat, high protein, and low price, and the absence of religious restrictions, is the world's most consumed meat product, and its demand continues to rise. For the broiler industry, feed accounts for a large proportion of breeding costs, and the feed conversion ratio of commercial chickens largely determines the industry's economic benefits.

[0003] Reducing feed conversion ratio is crucial for improving economic efficiency; therefore, identifying and utilizing novel genes associated with feed conversion ratio in yellow-feathered broilers is of great significance for chicken genetic breeding. Based on high-density SNP data covering the entire genome and phenotypic records of large populations, genome-wide association analysis (GWAS) can accurately locate candidate genes controlling traits. Although this technology still has some limitations, it has been widely used for identifying candidate genes for complex human diseases and locating key genes for important economic traits in livestock and poultry. Using GWAS to screen for SNP molecular markers associated with feed conversion ratio in yellow-feathered broilers provides a feasible approach for the genetic breeding of chicken growth traits, which is of great significance to the poultry industry.

[0004] High-throughput sequencing technology was used to reveal the genetic regulatory mechanisms of feed conversion ratio, select potential molecular markers for specific phenotypes, and improve the accuracy of trait genetic prediction. Specifically, by performing association analysis between feed conversion ratio phenotypes and genomic data, significant SNP loci affecting feed conversion ratio in yellow-feathered broilers were identified, and effective SNP markers were determined, providing a powerful tool for early trait selection and accelerating the genetic breeding process. However, there are currently no reports on genetic molecular markers related to feed conversion ratio in poultry. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a CDK5RAP3 gene SNP molecular marker related to feed conversion ratio in yellow-feathered broilers and its application, thereby solving the problem of the lack of development and utilization of existing genetic molecular markers related to feed conversion ratio in yellow-feathered broilers.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] A CDK5RAP3 gene SNP molecular marker associated with feed conversion ratio in yellow-feathered broilers was identified. The SNP molecular marker polymorphism was A / G, located at position 369307 on chromosome 27 of chicken, and the RS number was rs738324012.

[0008] Furthermore, the mutation sites and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, where R is the A>G mutation site, and when R is G, it is a yellow-feathered broiler with low feed conversion ratio;

[0009] SEQ ID NO.1: 5'-GACGTCAGCCTCCTCCTCCATCTCCACCAGGCGC TGTGCCAGGAACAGCTCCAGCTGTGGGGAAAAGGACGCCGTGAGGGGAAGGGGCGGCCAAAACCCACCCGACATGGGGAGGGTGCCCGAGCCGTCCCAGTGCTGCTCACCTCCATGAGCTCATCGATGAATTGGTTCCGTGTCGCAGCATTCTCCAGCAGTGTCAGRGCATCGGAGCCACGGGCA ACTGCCTCGGGTTCTGGGGGATGAGTGGGGTCAGCAGGGAAGGGAGCTCTGCGGTCTCTGCACGCTGGAACCCGACTGTCCCCTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATCTGTGCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGTGAT-3'.

[0010] A primer for detecting the above-mentioned SNP molecular marker, the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3;

[0011] Forward primer: 5'-CTCCAGCTGTGGGGAAAAGGAC-3' (SEQ ID NO.2);

[0012] Reverse primer: 5'-CAGGACAATGGCATTGACTGGG-3' (SEQ ID NO.3).

[0013] A kit for detecting the above-mentioned SNP molecular markers, the kit comprising the above-mentioned primers.

[0014] The above-mentioned SNP molecular markers, primers, or kits are used in screening individuals or parents of yellow-feathered broilers with excellent traits of low feed conversion ratio.

[0015] A method for screening individuals or parents of yellow-feathered broilers with excellent traits of low feed conversion ratio involves using PCR technology to amplify and sequence the SNP molecular markers of the individuals to be tested, and screening to obtain homozygous individuals with the SNP molecular marker genotype GG.

[0016] Furthermore, PCR amplification was performed using the primers or kits described above.

[0017] Furthermore, the PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

[0018] Furthermore, the PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.

[0019] The present invention has the following beneficial effects:

[0020] This invention provides a SNP molecular marker located in the CDK5RAP3 gene on chromosome 27 of chicken that is associated with feed conversion ratio in yellow-feathered broilers. This marker indicates that there are significant differences in feed conversion ratio among different genotypes of yellow-feathered broilers. It can be used to efficiently screen individuals or parent yellow-feathered broilers with the excellent trait of low feed conversion ratio. When applied to the breeding of yellow-feathered broilers, it can quickly breed yellow-feathered broilers with low feed conversion ratio, which can effectively reduce feed consumption in the production process and improve the economic benefits and competitiveness of enterprises. Attached Figure Description

[0021] Figure 1 Manhattan plot of SNP molecular markers in Example 1;

[0022] Figure 2 This is a sequencing diagram of the SNP molecular marker genotype in Example 2. Detailed Implementation

[0023] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0024] Example 1: Screening of SNP molecular markers

[0025] 1872 healthy yellow-feathered broiler chickens were selected and fed together until 56 days of age. From 56 days of age, they were transferred to individual cages for feeding, and the experiment ended at 98 days of age. Daily feed intake, initial body weight, and final body weight were recorded for each chicken, and feed conversion ratio was calculated using the following formula:

[0026]

[0027] In the formula, FCR is the feed conversion ratio; W f For feed consumption; W a To increase the weight of living organisms.

[0028] A lower FCR value indicates a lower feed conversion ratio, meaning less feed is consumed for the same production capacity, i.e., feed conservation. DNA was extracted from each sample, and the DNA samples underwent quality testing. DNA concentration was measured using a Qubit Fluorometer, and DNA fragment size and degradation were determined using agarose gel electrophoresis. Simplified genome sequencing was performed using high-throughput yield assays. Sequencing data underwent quality control and filtering to remove low-quality reads and potential false positive BNPs. Feed conversion ratio was used as a phenotype and correlated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html), and the analysis model is as follows:

[0029] y = Xb + Zu + m + e;

[0030] In the model, y represents the true value of the trait record, X represents the fixed-effects association matrix, b represents the fixed-effects vector, the fixed effects include batch effects and three principal component effects, Z represents the additive genetic effects association matrix, u represents the individual additive genetic effects vector, e represents the residual, and u ~ N(0, Gσ) 2 α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ 2 α σ 2 ε α represents the variance of the additive genetic effect and the variance of the residuals, respectively, and m represents the SNP marker effect.

[0031] Based on the association analysis results, a SNP molecular marker associated with the feed conversion ratio trait in yellow-feathered broilers was identified. This molecular marker is located on chromosome 27 of yellow-feathered broilers. Figure 1 The Manhattan diagram is shown.

[0032] The mutation site and upstream and downstream sequences of this SNP molecular marker are as follows:

[0033] SEQ ID NO.1: 5'-GACGTCAGCCTCCTCCTCCATCTCCACCAGGCGC TGTGCCAGGAACAGCTCCAGCTGTGGGGAAAAGGACGCCGTGAGGGGAAGGGGCGGCCAAAACCCACCCGACATGGGGAGGGTGCCCGAGCCGTCCCAGTGCTGCTCACCTCCATGAGCTCATCGATGAATTGGTTCCGTGTCGCAGCATTCTCCAGCAGTGTCAGRGCATCGGAGCCACGGGCA ACTGCCTCGGGTTCTGGGGGATGAGTGGGGTCAGCAGGGAAGGGAGCTCTGCGGTCTCTGCACGCTGGAACCCGACTGTCCCCTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATCTGTGCCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGTGAT-3';

[0034] R represents the A>G mutation site. When R is A, chickens have a lower feed conversion rate. 5'- and -3' represent the 5' end and 3' end of the nucleotide sequence, respectively.

[0035] Example 2: Validation of SNP molecular markers

[0036] The SNP molecular markers obtained in Example 1 were validated in another yellow-feathered broiler population, totaling 1773 healthy yellow-feathered broiler individuals. All experimental chickens were fed together until 56 days of age, and then transferred to individual cages for feeding from 56 days of age. The experiment ended at 98 days of age. The daily feed intake, initial body weight, and final body weight of each chicken were recorded, and the feed conversion ratio was calculated. 150 individuals with low feed conversion ratio (FCR < 3.0) and 150 individuals with high feed conversion ratio (FCR > 3.0) were selected, and blood samples were taken for DNA extraction. The average FCR of the 150 individuals with low feed conversion ratio was 2.7 ± 0.23, and the average FCR of the individuals with high feed conversion ratio was 3.4 ± 0.35.

[0037] Using the extracted DNA as a template, forward and reverse primers were added to perform a PCR reaction.

[0038] Forward primer: 5'-CTCCAGCTGTGGGGAAAAGGAC-3' (SEQ ID NO.2);

[0039] Reverse primer: 5'-CAGGACAATGGCATTGACTGGG-3' (SEQ ID NO.3).

[0040] The PCR amplification reaction system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL.

[0041] The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.

[0042] The sequencing results were analyzed, and the genotype of each individual was recorded according to the sequencing peak diagram of each sample, such as... Figure 2 As shown, the corresponding locus in the sequencing map of genotype AA shows only one peak, indicating the same allele, both being A; the corresponding locus in the sequencing map of genotype AG shows two peaks, indicating different alleles, one A and one G; the corresponding locus in the sequencing map of genotype GG shows only one peak, indicating the same allele, both being G. One-way ANOVA using SPSS 26.0 was used to analyze the relationship between the genotype and allele of the SNP molecular marker and feed conversion ratio, and the results are shown in Tables 1 and 2. For this SNP molecular marker, the genotype frequency and allele frequency showed highly significant differences between the low feed conversion ratio group and the high feed conversion ratio group (P < 0.01). In the low feed conversion ratio group, the frequency of the G allele was higher than that of the A allele, and the frequency of the GG genotype was significantly higher than that of the AA and AG genotypes, indicating that individuals with the GG genotype at locus 201 had a better feed conversion ratio phenotype than individuals with the AG and AA genotypes. Further evidence shows that the polymorphism of the screened molecular markers is significantly correlated with the feed conversion ratio trait, which are SNP sites associated with the feed conversion ratio trait and can be used for breeding of yellow-feathered broilers with low feed conversion ratio traits.

[0043] Table 1. Statistical table of distribution differences of SNP molecular marker genotypes between low and high feed conversion ratios.

[0044] chromosome site genotype High FCR (%) Low FCR (%) <![CDATA[Chi-square value X 2 (P)]]> chr27 3693075 AA 53(35.3%) 28(18.7%) 9.541 AG 47(31.3%) 38(25.3%) <![CDATA[7.1×10 -4 ]]> GG 50(33.4%) 84(56%) <![CDATA[8.5×10 -4 ]]>

[0045] Table 2. Statistical table of distribution differences of SNP molecular marker alleles between low and high feed conversion ratios.

[0046] chromosome site genotype High FCR (%) Low FCR (%) <![CDATA[Chi-square value X 2 (P)]]> chr27 3693075 A 153(51%) 94(31.3%) 10.343 G 147(49%) 206(68.7%) <![CDATA[3.2×10 -5 ]]>

[0047] Example 3: A method for assisting molecular breeding of yellow-feathered broiler chickens with low feed conversion ratio using SNP molecular marker alleles.

[0048] This embodiment provides a method for assistive molecular breeding of yellow-feathered broiler chickens for low feed conversion ratio using the above-mentioned kit for detecting SNP molecular markers, including the following steps:

[0049] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.

[0050] (2) Amplification was performed using the DNA extracted in step (1) as a template via a kit. The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL. The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, for 35 cycles; and 72℃ extension for 5 min.

[0051] (3) The PCR products obtained in step (2) were sequenced using the Sanger sequencing method.

[0052] (4) Based on the genotyping results, homozygous individuals with the SNP molecular marker chr27-3693075 as the GG genotype were selected for breeding to reduce feed conversion rate and feed cost. Individuals with this marker were selected to join the core breeding population, which can achieve rapid homozygosity of the alleles related to this trait and provide technical support for accelerating the progress of genetic selection.

[0053] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer combination or kit for amplifying the CDK5RAP3 gene SNP molecular marker associated with feed conversion ratio in yellow-feathered broilers, used in screening individuals or parents of yellow-feathered broilers with the desirable trait of low feed conversion ratio, characterized in that, The SNP molecular marker polymorphism is A / G, and the RS number is rs738324012. When the SNP is G, it indicates a yellow-feathered broiler with low feed conversion ratio. The kit includes the primer combination.

2. The application according to claim 1, characterized in that, The mutation sites and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, where R is the A>G mutation site. When R is G, it is a yellow-feathered broiler with low feed conversion ratio.

3. The application according to claim 1, characterized in that, The forward primer sequence of the primer combination is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.

3.

4. A method for screening individuals or parents of yellow-feathered broilers with the superior trait of low feed conversion ratio, characterized in that, The SNP molecular markers described in any one of claims 1-3 of the individuals to be tested were amplified and sequenced using PCR technology, and homozygous individuals with the SNP molecular marker genotype GG were screened.

5. The method for screening individuals or parents of yellow-feathered broilers with the excellent trait of low feed conversion ratio according to claim 4, characterized in that, PCR amplification was performed using the primer combination or kit described in any one of claims 1-3.

6. The method for screening individuals or parents of yellow-feathered broilers with the excellent trait of low feed conversion ratio according to claim 4, characterized in that, The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

7. The method for screening individuals or parents of yellow-feathered broilers with the excellent trait of low feed conversion ratio according to claim 4, characterized in that, The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.