A molecular marker related to feed conversion ratio in sheep and use thereof

CN119242809BActive Publication Date: 2026-08-11JINCHUAN GROUP CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411193520.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-28
Publication Date
2026-08-11
Estimated Expiration
2044-08-28

AI Technical Summary

Technical Problem

该专利利用限制性内切酶的特异性完成了等位基因的检测,其准确性有一定程度的保证,但其检测规模与效率大大受限,且随实验规模的扩大,其实验变量不易得到统一,实验准确性会随之下降

Benefits of technology

[0034]The beneficial effects of this invention are: it establishes a method for detecting molecular markers and polymorphic sites related to sheep feed conversion rate, which can determine the genotype of polymorphic sites in the sheep to be tested, and can be used to select sheep with AA homozygous genes as breeding sheep for breeding, in order to cultivate feed-saving sheep and improve the quality of sheep, which helps to improve the economic benefits of the breeding industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119242809B_ABST
    Figure CN119242809B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of sheep molecular marker screening and preparation technology, and relates to a molecular marker related to sheep feed conversion ratio and its application. The molecular marker uses primers designed based on the FABP7 gene sequence. DNA is extracted from sheep blood, and through PCR amplification, DNA sequencing, and sequence analysis, an A / G polymorphism site is found at position 255 of the amplified fragment. Further analysis using AQP... TM Primers were used to detect polymorphic loci in 821 Hu sheep, and a least-squares model was established. Association analysis between genotype and feed conversion ratio was performed, ultimately confirming that the FABP7 gene fragment amplified in this invention can serve as a molecular marker associated with sheep feed conversion ratio. The molecular marker of this invention can be used to breed new feed-saving, high-quality meat sheep breeds, providing genetic engineering methods for the genetic improvement of sheep feed conversion ratio, and has significant practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of sheep molecular marker screening and preparation technology, specifically involving FABP7 gene polymorphism as a molecular marker related to sheep feed conversion rate and its application. Background Technology

[0002] Chinese Invention Patent (CN109554489B) discloses a molecular marker related to sheep feed conversion ratio and its application. This invention provides a molecular marker related to sheep feed conversion ratio, along with its detection method and application. Through PCR amplification and sequence analysis of the sheep ZEB2 gene, a T / C polymorphism site was found at position 645 of the amplified fragment. Further PCR-RLPF was used to detect the polymorphism site in 137 Hu sheep, and a least-squares model was established. Association analysis between genotype and feed conversion ratio was performed, ultimately confirming that the amplified ZEB2 gene fragment can serve as a molecular marker related to sheep feed conversion ratio, and that the C allele is the dominant allele. The molecular marker of this invention can be used for the breeding of feed-saving sheep and the cultivation of new feed-saving high-quality meat sheep breeds, providing a genetic engineering means for the genetic improvement of sheep feed conversion ratio, and has significant practical application value. This patent utilizes the specificity of restriction endonucleases to detect alleles, ensuring a certain degree of accuracy. However, its detection scale and efficiency are greatly limited, and as the experimental scale expands, it becomes difficult to unify the experimental variables, leading to a decrease in experimental accuracy.

[0003] The FABP7 gene is expressed in the brain, liver, mammary gland, kidney, subcutaneous fat, and muscle of mammals (Shan Liling. Study on the interaction between differentially expressed proteins and RHDV in rabbit liver tissue [D]. Beijing: Chinese Academy of Agricultural Sciences, 2014: 25-26.). The FABP7 gene is highly expressed in neural stem cells and developing astrocytes. Polyunsaturated fatty acids (PUFAs) are key structural components of the brain and are essential for normal brain development. The cellular transport and physiological functions of PUFAs are closely related to fatty acid-binding proteins encoded by the intracellular lipid-binding protein gene family. FABP7 is a strong binder of ω-3 PUFAs, indicating that it plays a role in cell differentiation and proliferation by regulating lipid metabolism and signal transduction (Owada Y, Yoshimoto T, Kondo H. Spatio-temporally differential expression of genes for three members of fatty acid binding proteins in developing and mature ratbrains [J]. J Chem Neuroanat, 1996, 2(2): 113-122.). FABP7 is closely related to lipid metabolism, and its main function is to bind and transport PUFAs, which are essential for cell differentiation, synaptic activation, and the biosynthesis of photoreceptor membranes in early growth stages. In a genome-wide association study of Beijing Youji chickens, MLM and GLM models revealed the presence of the FABP7 gene near SNP sites that achieved genome-wide significance in both breast muscle weight and breast muscle percentage (Wu Dan. Genome-wide association study of body weight and carcass traits in Beijing Youji chickens [D]. Beijing: Chinese Academy of Agricultural Sciences, 2012: 38-39.). This suggests that FABP7 may be a candidate gene affecting body weight and carcass traits. However, research on FABP7's role in feed efficiency traits is relatively limited. Sheep feed conversion ratio is influenced by multiple genes with minor effects. This invention, through sequencing and analysis of the FABP7 gene, explores the correlation between different genotypes and sheep feed conversion ratio, aiming to provide a reference for sheep breeding and offer genetic engineering methods for cultivating superior sheep breeds in my country. Summary of the Invention

[0004] The purpose of this invention is to design and provide a technical solution for molecular markers related to sheep feed conversion rate and their applications.

[0005] The molecular marker of this invention was amplified from the sheep FABP7 gene, and its specific nucleotide sequence is shown in SEQ ID NO:1. By amplifying the DNA sequence of the sheep FABP7 gene and sequencing it, polymorphic sites of the FABP7 gene can be screened, thereby establishing a method for detecting molecular markers related to sheep feed conversion ratio. This molecular marker can also be applied to the breeding of new feed-saving, high-quality meat sheep breeds.

[0006] The technical solution of the present invention is as follows:

[0007] On the one hand, this invention provides a molecular marker related to sheep feed conversion ratio, which is obtained by amplifying the sheep FABP7 gene. Specifically, the nucleotide sequence of this molecular marker is shown in SEQ ID NO.1, i.e.

[0008] TCACTATTCGCTCAACCATTACTTTTTGAAAAATCAATTTGTTTGACTTCCATATCAGAAATCTGATCTGTACCTATTGCTATGTTCTGCATTTTGTTGGTGGTCTCAGTCTGTTGTTAGTCTGGATGGAGACAAACTTGTTCATGTACAGAAATGGGATGGCAAAGAAACAA ATTTTGTAAGAGAGATTAAGGATGGCAAAATGGTCATGGTAAGTAGAGCAATTCCCGATTCCTATTCCTGCTTCTCTCCTACCCCCCTCAAATTTCCCATTTCCTTCCTTGTCCCTCCTTCCCTCCTTTTCCCATCTTTCCTTTTCTAATAACATTAAGTCACTAGCAAGG

[0009] The R at position 255 represents either A or G. Because there is an A / G mutation at position 255 in the above sequence, the sheep FABP7 gene exhibits A / G polymorphism at this site.

[0010] Secondly, the present invention provides a primer pair for detecting the above-mentioned molecular marker. Any primer capable of specifically amplifying the molecular marker of the present invention or a fragment containing the above-mentioned polymorphic site is suitable for detecting the molecular marker. Preferably, the nucleotide sequence of the primer pair for detecting the molecular marker is:

[0011] Forward primer MF: TCACTATTCGCTCAACCATT (SEQ ID NO.2);

[0012] Reverse primer MR: CCTTGCTAGTGACTTAATGT (SEQ ID NO.3).

[0013] Furthermore, the primer pairs of this invention can be designed for both the sense and antisense strands of the molecular marker (AQP). TM SNP primer pairs, their AQP TM The nucleotide sequences of the SNP primer pair are as follows:

[0014] Forward primer A1 for detecting AlleleA:

[0015] GAAGGTGACCAAGTTCATGCTGATTCCTATTCCTGCTTCTTCTCCTA (SEQ ID NO. 4);

[0016] Forward primer A2 for detecting AlleleG:

[0017] GAAGGTCGGAGTCAACGGATTGATTCCTATTCCTGCTTCTTCTCCTG (SEQ ID NO. 5);

[0018] Universal reverse primer C: GGACAAGGAAGGAAATGGGAAATT (SEQ ID NO.6).

[0019] Thirdly, the present invention provides a kit for detecting the above-mentioned molecular markers, the kit comprising the primer pair of the second aspect of the present invention.

[0020] Fourthly, the present invention provides a method for detecting molecular markers related to sheep feed conversion ratio, wherein the nucleotide sequence of the molecular markers is shown in SEQ ID NO.1, and the method includes detecting the sheep FABP7 gene using the primer pairs or kit of the present invention. The detection method of the present invention includes the following steps:

[0021] a) Amplify sheep genomic DNA using the primer pairs of the present invention or a kit containing the primer pairs described above;

[0022] b) Identify the polymorphic sites in the amplification products obtained in step a).

[0023] In step b), the above-mentioned SNP genotyping methods include, but are not limited to, direct sequencing, probe method, gene chip method, and high-resolution melting curve method.

[0024] Given that the molecular marker sequence and polymorphic site of the present invention are known, designing corresponding probes for the polymorphic site and using the above-mentioned SNP genotyping method to detect the molecular marker and polymorphic site are both relatively conventional and mature techniques in the field. The probe designed for the polymorphic site can also be included in the kit of the third aspect of the present invention.

[0025] More specifically, the method for detecting molecular markers related to sheep feed conversion ratio using the above primer pairs in this invention includes the following steps:

[0026] a) Genomic DNA was extracted from sheep blood samples, and the sheep FABP7 gene was amplified by PCR using the primers shown in SEQ ID NO.2 and SEQ ID NO.3;

[0027] b) Sequencing and sequence analysis of the PCR amplification products were performed to determine the genotype by the base type of the polymorphic site.

[0028] Furthermore, the present invention also relates to the use of AQP TM A method for detecting molecular markers related to sheep feed conversion ratio using primer pairs includes the following steps:

[0029] a) Genomic DNA was extracted from sheep blood samples and amplified by high-throughput water bath PCR using the primer pairs shown in SEQ ID NO.4-6;

[0030] b) After amplification, fluorescence signals were detected and genotyping results were viewed using a C1000 Touch™ Thermal Cycler instrument.

[0031] Fifthly, the present invention provides the application of the detection method of the above-mentioned molecular markers, primer pairs or kits in the detection of sheep feed conversion rate, by detecting the molecular markers of the present invention in sheep to be tested and analyzing the types of polymorphic sites.

[0032] Sixthly, the present invention provides the application of the detection method of the above-mentioned molecular marker, primer pair or kit in sheep breeding. By using the primer pair or kit of the present invention to amplify and detect the FABP7 gene, the genotype of the sample to be tested can be determined, and the association analysis between its genotype and sheep feed conversion rate can be performed in the preliminary stage, providing a new molecular marker for molecular marker-assisted selection of sheep.

[0033] Association analysis between genotype and feed conversion ratio revealed that, for the same amount of feed consumed, sheep with the AA genotype gained more weight than those with the AG and GG genotypes.

[0034] The beneficial effects of this invention are: it establishes a method for detecting molecular markers and polymorphic sites related to sheep feed conversion rate, which can determine the genotype of polymorphic sites in the sheep to be tested, and can be used to select sheep with AA homozygous genes as breeding sheep for breeding, in order to cultivate feed-saving sheep and improve the quality of sheep, which helps to improve the economic benefits of the breeding industry.

[0035] This patent detects alleles by detecting the different fluorescence effects produced by primer amplification containing fluorescent probes. While ensuring a certain level of accuracy, it is easier to operate, greatly improves experimental efficiency, and reduces experimental costs as the scale of the experiment increases. Furthermore, the experiment is highly reproducible and verifiable. Attached Figure Description

[0036] Figure 1 Gel electrophoresis image of the sheep FABP7 gene fragment used as a molecular marker in this invention. Lane M: DL 2000Plus Marker; Lanes 1-12: FABP7 gene amplification results.

[0037] Figure 2 Sequencing results of the FABP7 gene mutation site in sheep in this invention.

[0038] Figure 3 The sheep FABP7 gene g.15690488A>G mutation site AQP in this invention. TM Genotyping results. The blue dot near the left represents the AA genotype, the green dot near the middle represents the AG genotype, and the orange dot near the right represents the GG genotype. Detailed Implementation

[0039] The present invention will now be described in detail with reference to examples. The scope of protection of the present invention is not limited to the specific embodiments described. The specific examples provided in the present invention are merely exemplary and do not constitute any limitation on the scope of the present invention. Modifications to the specific embodiments of the present invention or equivalent substitutions to some technical features made by those skilled in the art with reference to the description in the specification should also fall within the protection scope of the appended claims.

[0040] Example 1: Amplification of the FABP7 gene

[0041] (1) Primer design

[0042] Using sheep FABP7 gene DNA (GenBank accession number: NC_056061.1) as a template, a pair of primers MF and MR were designed using Oligo 7.0 software. The primer sequences are as follows.

[0043] FABP7:

[0044] MF: 5′-TCACTATTCGCTCAACCATT-3′ (SEQ ID NO.2),

[0045] MR: 5'-CCTTGCTAGTGACTTAATGT-3' (SEQ ID NO.3)

[0046] (2) Amplification and sequencing of the FABP7 gene

[0047] The total volume of the PCR reaction was 35 μL, including: 17.5 μL of 2×PCR Master Mix, 1.12 μL of 10 μmol / L upstream primer RF, 1.12 μL of 10 μmol / L downstream primer RR, 1.4 μL of DNA template, and 14 μL of ddH2O. The DNA template was genomic DNA extracted from sheep blood.

[0048] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 60 s, for 35 cycles, and a final extension at 72℃ for 10 min.

[0049] The PCR reaction products were detected by 1.5% agarose gel electrophoresis, and the results showed that a 347bp specific amplified fragment was obtained. Figure 1 The amplified PCR fragment was sequenced, and the sequencing results showed that the specific nucleotide sequence of the amplified fragment is shown in SEQ ID NO.1. A polymorphic site exists in the 255bp fragment, specifically an A / G polymorphism at the 255bp position of the amplified FABP7 gene fragment. Figure 2 ).

[0050] (3) DNA sequence homology retrieval and identification:

[0051] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of the sheep FABP7 gene DNA (GenBank accession number: NC_056061.1).

[0052] Example 2: Establishment of a Genotyping Detection Method

[0053] (1) Primer sequence design

[0054] AQP was designed targeting the A / G polymorphic sites in the amplified fragment in Example 1. TM Primer pairs, thereby enabling the specific detection of the polymorphic sites, the AQP TM The nucleotide sequences of the primer pair are as follows:

[0055] Forward primer A1 for detecting AlleleA:

[0056] GAAGGTGACCAAGTTCATGCTGATTCCTATTCCTGCTTCTTCTCCTA (SEQ ID NO. 4);

[0057] Forward primer A2 for detecting AlleleG:

[0058] GAAGGTCGGAGTCAACGGATTGATTCCTATTCCTGCTTCTTCTCCTG (SEQ ID NO. 5);

[0059] Universal reverse primer C: GGACAAGGAAGGAAATGGGAAATT (SEQ ID NO.6).

[0060] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd., and AQP was used. TM Each primer pair was diluted to 100 μmol / L and mixed in a volume ratio of 12:12:30:46 (primer A1: primer A2: primer C: sterile water) for later use.

[0061] (2) Extracted genomic DNA and quality control.

[0062] Genomic DNA can be extracted from sheep blood using a DNA extraction kit. The extracted genomic DNA is then tested for quality using 1% agarose gel electrophoresis and Nanodrop 2100. The acceptable DNA requirements are: (1) Agarose gel electrophoresis shows a single DNA band without significant diffusion; (2) Nanodrop 2100 detection shows A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. This is based on the AQP of Beijing Jiacheng Biotechnology Co., Ltd. TM The detection technology and genome size calculations determined the DNA usage to be 2–50 ng / sample. The extracted genomic DNA was then diluted to a concentration of 2–50 ng / μL to serve as a DNA template.

[0063] (3) Genotyping

[0064] First, let's look at the above AQP. TM Each primer in the primer pair (100 μmol / L) was mixed with sterile water in a volume ratio of 12:12:30:46 (primer A1: primer A2: primer C: sterile water) to prepare a primer mixture for later use.

[0065] Then, using a pipette, add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of diluted DNA template (2–50 ng / μL) to each well of a 384-well plate. After adding the primer mixture, seal the plate, centrifuge with shaking, and place it on a C1000Touch™ Thermal Cycler instrument for PCR amplification.

[0066] The specific procedure is as follows:

[0067] Pre-denaturation at 95℃ for 10 minutes;

[0068] 95℃, 20 seconds (denaturation) — 61℃-55℃, 40 seconds (annealing & extension), amplification for 10 cycles, with a decrease of 0.6℃ per cycle;

[0069] 95℃, 20 seconds (denaturation) — 55℃, 40 seconds, continue amplification for 34 cycles.

[0070] After amplification, fluorescence signals were detected and genotyping was performed using a C1000 Touch™ Thermal Cycler instrument at 37°C. Specific results are as follows: Figure 3 As shown in the figure. With HEX as the x-axis and FAM as the y-axis, each graph in the figure represents a sample of the test material. The blue square near the left indicates that the locus is homozygous genotype "AA"; the green triangle near the middle indicates that the locus is heterozygous genotype "AG"; and the orange dot near the right indicates that the locus is homozygous genotype "GG".

[0071] (4) Application of the molecular markers of the present invention in the association analysis of marker traits of sheep feed conversion rate

[0072] The experiment examined the polymorphism of 821 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct a correlation analysis between genotype and feed conversion ratio.

[0073] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0074] Among them, Yijkl Here are the observed trait values, μ is the population mean, and Genotype. i For genotype effect, P j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijlmk They are mutually independent and follow N(0, σ). 2 )distributed.

[0075] Genotyping results showed that among the 821 individuals, 46 had the AA genotype, 429 had the AG genotype, and 346 had the GG genotype. The results of the genotype-trait association analysis are shown in Table 1.

[0076] Table 1. Association analysis between FABP7 gene polymorphism and feed conversion ratio in sheep.

[0077]

[0078] Note: Different lowercase superscripts in the same row indicate significant differences (P<0.05), while the same superscript indicates no significant differences (P>0.05).

[0079] The results showed that the FABP7 g.15690488A>G mutation site was significantly associated with the feed conversion ratio of sheep (P<0.05). The FCR120180 of AA genotype individuals was 6.746±1.124, which was significantly lower than that of AG (7.212±1.195) and GG (7.342±1.487) individuals (P<0.05). AA individuals consumed 0.466 and 0.596 kg less feed per kg of weight gain compared to AG and GG individuals, respectively.

[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of a pair of primers for detecting a molecular marker in the preparation of a product for identifying feed conversion rate in sheep, characterised in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO:1, wherein R at 255bp is A or G, and this mutation leads to A / G polymorphism of the molecular marker; Association analysis between genotype and feed conversion ratio revealed that, for the same amount of feed consumed, sheep with the AA genotype gained more weight than those with the AG and GG genotypes.

2. Use of a pair of primers for molecular tagging as claimed in claim 1 in the preparation of a product for identifying feed conversion efficiency in sheep, characterised in that, The primer pair for detecting the molecular marker is a PCR primer pair. The nucleotide sequence of the forward primer is shown in SEQ ID NO:2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

3.

3. Use of a pair of primers for molecular tagging as claimed in claim 1 in the preparation of a product for identifying feed conversion efficiency in sheep, characterised in that, The primer pair for detecting the molecular marker is AQP TM SNP primer pair, the AQP TM SNP primer pair: The nucleotide sequence of the forward primer A1 used to detect AlleleA is shown in SEQ ID NO:4, the nucleotide sequence of the forward primer A2 used to detect AlleleG is shown in SEQ ID NO:5, and the nucleotide sequence of the universal reverse primer C is shown in SEQ ID NO:6.

Citation Information

Patent Citations

  • A molecular marker associated with sheep feed conversion ratio and its application

    CN109554489B