A SNP marker for identifying high-yield trait of queen bee royal jelly of western honeybee colony and application thereof

Abstract

The application relates to a SNP marker for identifying the royal jelly high-yield trait of an Apis mellifera colony and application thereof. The SNP marker is selected from NC_037641.1_10806386 and NC_037641.1_10806436. Adult worker bee individuals are randomly collected from an Apis mellifera colony to be detected, and genomic DNA is extracted as a template for a PCR amplification reaction to obtain a PCR reaction product; the obtained PCR reaction product is detected by agarose gel electrophoresis, and the PCR reaction liquid with a target band is sequenced; the sequencing result is analyzed, the gene frequency of the NC_037641.1_10806386 site or the NC_037641.1_10806436 site of the Apis mellifera colony to be detected is calculated, and whether the Apis mellifera colony to be detected is a royal jelly high-yield colony is determined. The application provides two SNP markers related to the royal jelly high-yield trait of the Apis mellifera from the molecular biology level, the two SNP markers are contained in a target fragment amplified by a same pair of specific primers, the royal jelly high-yield trait of the Apis mellifera colony can be scientifically, accurately and quickly identified, and the breeding cycle of the royal jelly high-yield Apis mellifera can be greatly shortened, and the breeding speed can be accelerated.

Description

TECHNICAL FIELD

[0001] The application relates to a method for identifying a high-yield trait of royal jelly of a bee colony, in particular to a SNP marker for identifying a high-yield trait of royal jelly of a bee colony of Apis mellifera and application thereof, and belongs to the technical field of biotechnology. BACKGROUND

[0002] Royal jelly is one of main products in the production of the bee industry in China, can regulate the development and grade differentiation of bees, and also has important health care value for human body. Royal jelly has important pharmacological effects in resisting Alzheimer's disease and regulating blood sugar; royal jelly has antibacterial effect, and the main active substance 10-HDA has inhibitory effect on Staphylococcus aureus, Escherichia coli and the like; 10-HDA also has the effects of inhibiting tumor cell proliferation and promoting cell apoptosis. Therefore, royal jelly is widely used in improving human health, medicine, health care products and cosmetics.

[0003] China is a large country in royal jelly production, and the yield of royal jelly accounts for more than 90% of the total amount in the world, and the annual production amount is about 4000t, which is closely related to the bee species bred in China. In 1910, Apis mellifera was introduced, and the royal jelly yield of each colony per year is about 0.5-1 kg, and the royal jelly yield is extremely low. In the last century, numerous scientists and beekeeping workers in China carried out breeding research and experiments on the bee species, collected royal jelly high-yield bee colonies in Hangzhou, Pinghu, Jiaxing, Tonglu, Shaoxing and Longyou and the like as breeding objects, and through directional breeding and group closed breeding for many years, using the technology of Taihu island isolation and artificial insemination of bees, a new Apis mellifera strain with excellent production performance and stable genetic traits, Apis mellifera 'Zhenongda No. 1', was bred, and the royal jelly yield of each colony per year is more than 10 kg, and the Apis mellifera 'Zhenongda No. 1' has the advantages of fast reproduction, strong honey collecting ability, strong disease resistance, high royal jelly yield, strong breeding ability and gentle nature, and then Pinghu royal jelly bee, Xiaoshan royal jelly bee and the like were bred. Therefore, the breeding of royal jelly high-yield bee species has attracted more and more attention, and brings great economic benefits.

[0004] For a long time, bee industry scientific and technological workers in China have been committed to the research on royal jelly high-yield bees, found the mechanism of royal jelly high-yield and many genetic markers related to the royal jelly high-yield trait, strengthened the breeding and selection of royal jelly high-yield bee species, and fully exerted the advantages of excellent bee species resources in China.

[0005] 1. Research on molecular genetic markers related to the royal jelly high-yield trait

[0006] In beekeeping, the high royal jelly production performance of a bee colony has always been a crucial factor for beekeepers. To more accurately and efficiently determine whether a bee colony is a high-yield royal jelly colony, scientists have conducted in-depth research using molecular genetic marker technology to identify molecular markers associated with high royal jelly production, thereby providing a scientific basis for bee breeding and selection.

[0007] Molecular genetic markers are an important tool in modern biotechnology. They explore the relationship between markers and target traits by analyzing specific sequences or gene polymorphisms in an organism's genome. In research on the high-yield trait of royal jelly in bees, researchers have widely applied several molecular genetic marker techniques, including random amplified polymorphic DNA-PCR (RAPD-PCR) analysis, microsatellite DNA analysis, and gene chip technology.

[0008] Researchers discovered a specific DNA sequence fragment, W316bp, in high-yielding bee strains such as "Zhejiang Agricultural University No. 1," Pinghu royal jelly bees, and Xiaoshan royal jelly bees. This fragment is prevalent in worker bees but absent in drones, suggesting a possible association with high royal jelly production. Experimental verification confirmed W316bp as a reliable molecular marker for this trait. Microsatellite DNA analysis provides another important molecular marker method; by analyzing microsatellite loci in different bee breeds, specific microsatellite markers associated with high royal jelly production were identified. The microsatellite markers in "Zhejiang Agricultural University No. 1" bees exhibit evolutionary specificity and are closely related to their high-yielding trait. With advancements in gene chip technology, researchers are able to screen for genes associated with high royal jelly production across a wider genomic range. Gene expression analysis of high- and low-yielding bee breeds revealed several differentially expressed genes involved in biological processes such as the olfactory system, nervous system, and glandular function in bees. In particular, several upregulated genes, such as dop2, SsRbeta, and hex71, are considered to be potential molecular markers for high royal jelly production.

[0009] While significant progress has been made in the study of molecular genetic markers associated with high royal jelly production, several challenges and limitations remain. Traditional molecular marker methods, such as RAPD-PCR and microsatellite analysis, have limitations in their narrow screening scope, failing to comprehensively cover all potential markers in the genome. Although gene chip technology can efficiently screen for potential molecular markers, its complexity and high cost limit its widespread application. Therefore, future research requires more mature and scientific molecular techniques to more comprehensively and accurately study the genetic basis of high royal jelly production. Finding a simple, reliable, and low-cost molecular marker method is crucial for the development of beekeeping. This will provide beekeeping with scientific breeding strategies, helping to improve the production efficiency of royal jelly and thus promoting the sustainable development of beekeeping.

[0010] 2. SNP technology

[0011] Single nucleotide polymorphisms (SNPs), often referred to as third-generation DNA molecular markers, refer to the differences in individual nucleotides between different alleles at the same locus. They commonly involve the substitution of a single nucleotide, frequently occurring between purine bases (A and G) and pyrimidine bases (C and T). SNP markers help distinguish between the genetic material of two individuals and are considered one of the most promising genetic markers. Currently, SNP information can be accurately obtained from the genome through steps such as extracting genomic DNA, randomly fragmenting it, adding adapters, sequencing, and bioinformatics analysis, allowing for the screening of SNP molecular markers associated with specific traits.

[0012] As a new generation of biotechnology, SNP technology has high practical value and its application in the field of human diseases is relatively mature and has made some progress. However, its research and application in the molecular markers for high royal jelly production in Western honeybees are still limited. Therefore, this method uses SNP technology to identify the high royal jelly production trait in adult worker Western honeybees. Based on this, high-yield royal jelly-producing bees can be accurately, efficiently, and quickly selected for breeding, and even lay a good foundation for cultivating higher-quality royal jelly-producing bee breeds through genetic means. Summary of the Invention

[0013] The purpose of this invention is to provide an SNP marker for identifying high royal jelly production traits in Western honeybee colonies and its application.

[0014] The objective of this invention is achieved through the following technical solution:

[0015] A SNP marker for identifying high royal jelly production in Western honeybee colonies, wherein the SNP marker is selected from NC_037641.1_10806386 and NC_037641.1_10806436, where NC_037641.1_10806386 is a T or C base at position 10806386 on chromosome 4 of Western honeybee, and NC_037641.1_10806436 is a T or G base at position 10806436 on chromosome 4 of Western honeybee.

[0016] A primer for detecting the above-mentioned SNP marker, wherein the forward primer sequence is 5'-TGTTCACTTGTCGAGTGCGAAG-3' and the reverse primer sequence is 5'-ACCAGCGATACTTAAGCGGACA-3'; the target fragment amplified by the primer is 688bp in size.

[0017] The above-mentioned SNP markers and primers are used to identify the high royal jelly production trait in Western honeybee colonies.

[0018] The application of the aforementioned SNP markers and primers in Western honeybee breeding.

[0019] A method for identifying high royal jelly production traits in Western honeybee colonies using the aforementioned SNP markers involves randomly collecting adult worker bees from the Western honeybee colony to be tested and extracting their genomic DNA; using the extracted genomic DNA as a template, performing a PCR amplification reaction using the primers described in claim 2 to obtain PCR reaction products; detecting the obtained PCR reaction products by agarose gel electrophoresis, and sequencing the PCR reaction solutions that show the target band; analyzing the sequencing results to calculate the gene frequency of the SNP marker sites in the Western honeybee colony to be tested;

[0020] Furthermore, the gene frequency at the NC_037641.1_10806386 locus of the tested Western honeybee colony was calculated. When the T allele frequency of the tested Western honeybee colony was significantly greater than the C allele frequency, the tested Western honeybee colony was a high-yield royal jelly colony; the term "significant" refers to a statistical P < 0.01.

[0021] Furthermore, the gene frequency at the NC_037641.1_10806436 locus of the tested Western honeybee colony was calculated. When the T allele frequency of the tested Western honeybee colony was significantly greater than the G allele frequency, the tested Western honeybee colony was a high-yield royal jelly colony; the term "significant" refers to a statistical P < 0.001.

[0022] The beneficial effects of this invention are:

[0023] This invention employs SNP markers (NC_037641.1_10806386; NC_037641.1_10806436) to identify high royal jelly production traits in Western honeybee colonies. The method has undergone rigorous screening and validation. The samples used in this study came from a high-yielding royal jelly-producing apiary and a low-yielding royal jelly-producing apiary in Yancheng, Jiangsu Province, my country, during the rapeseed flowering season. One hundred colonies of Western honeybees each from the high-yielding and low-yielding royal jelly-producing colonies were labeled as experimental colonies. Genomic DNA was extracted from the bee samples, and its purity, concentration, and integrity were tested. Library construction was performed on the qualified samples, and paired-end sequencing was performed using the Illumina Novaseq 6000PE150 sequencing platform. Data quality control and processing were performed on the sequencing data. After obtaining high-quality sequencing data for each high- and low-yielding royal jelly-producing sample after quality control, SNPs were detected using Samtools. The SNPs were obtained through θ... π Ratio(θ πHRJB / θ πLRJB The analytical methods initially screened out 20 SNPs associated with high royal jelly production. Samples of high- and low-yielding Western honeybees were collected and validated using PCR and DNA sequencing. NC_037641.1_10806386 and NC_037641.1_10806436 were selected as molecular markers associated with royal jelly production.

[0024] Significant advantages of this invention:

[0025] 1. The royal jelly production capacity of a bee colony is influenced by its genotype, and there are instances where specific alleles in high-yielding royal jelly colonies are significantly higher than those in low-yielding colonies. SNP marker (NC_037641.1_10806386) allele T gene frequency P T The differences between high-yield and low-yield royal jelly bee colonies were highly significant, with the T allele frequency being significantly higher in high-yield colonies than in low-yield colonies; the T allele frequency of the SNP marker (NC_037641.1_10806436) was also highly significant. T The differences between high-yield and low-yield royal jelly bee colonies were highly significant, with the T allele frequency being significantly higher in high-yield colonies than in low-yield colonies. Furthermore, both SNP sites were contained within the target fragment amplified by the same pair of specific primers. Therefore, this result allows for a convenient, rapid, and accurate identification of whether a bee colony possesses the capacity for high royal jelly production.

[0026] 2. Determining the royal jelly production capacity of a bee colony based on statistical indicators: Randomly collected worker bees from the colony were analyzed at the SNP locus (NC_037641.1_10806386) P. T >PC (P<0.01) indicates a high-yield bee colony for royal jelly. T <P C (P<0.01) indicates a low-yield royal jelly bee colony; at SNP locus (NC_037641.1_10806436) P T >P G (P<0.001) indicates a high-yield bee colony for royal jelly. T <P G Bee colonies with a royal jelly yield of P<0.001 are considered low-yield royal jelly bee colonies. Based on this, bee colonies with high royal jelly production can be selected to increase royal jelly production, thereby increasing beekeepers' income. The method of identifying high royal jelly production traits in bee colonies using SNP markers related to high royal jelly production, as described in this invention, can significantly improve efficiency.

[0027] 3. The method of this invention is currently mainly used in the laboratory to understand the high royal jelly production mechanism of bees at the molecular level, detect molecular genetic markers related to royal jelly production traits, and combine molecular genetic markers with bee breeding technology. This not only ensures the accuracy of selection, but also accelerates the speed of bee breeding, greatly improving the success rate of breeding high royal jelly-producing bee breeds. It can safely, effectively and quickly identify high royal jelly-producing bee breeds. Attached Figure Description

[0028] The attached figure shows a reference peak diagram for genotyping SNP markers associated with high royal jelly production in bees. Among them:

[0029] Figure 1 The SNP (NC_037641.1_10806386) marker genotype marked in the square box is homozygous TT, which is mainly found in high-yield royal jelly bee colonies;

[0030] Figure 2 The SNP (NC_037641.1_10806386) marker genotype marked in the box is homozygous CC, which is mainly found in low royal jelly production bee colonies;

[0031] Figure 3 The SNP (NC_037641.1_10806386) marker genotype marked in the Chinese box is heterozygous CT, and it appears in both high- and low-yield royal jelly bee colonies.

[0032] Figure 4 The SNP (NC_037641.1_10806436) marker genotype marked in the square box is homozygous TT, which is mainly found in high-yield royal jelly bee colonies;

[0033] Figure 5 The SNP (NC_037641.1_10806436) marker genotype marked in the box is homozygous GG, which is mainly found in low royal jelly production bee colonies;

[0034] Figure 6 The SNP (NC_037641.1_10806436) marker genotype marked in the Chinese box is heterozygous GT, and it appears in both high- and low-yield royal jelly bee colonies.

[0035] Figure 7 The average royal jelly yield is given by high-yielding royal jelly colonies (HRJB) and low-yielding royal jelly colonies (LRJB). Detailed Implementation

[0036] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.

[0037] Example 1: Screening of SNPs (Signature-Nutrient Markers) for High Royal Jelly Production in Bee Colonies

[0038] (1) Sample Collection: The samples used in this study came from a high-yield royal jelly apiary and a low-yield royal jelly apiary in Yancheng, Jiangsu Province, during the rapeseed flowering season in my country. First, for 120 colonies of Western honeybees in each of the high-yield and low-yield apiaries, the royal jelly yield of the colonies was recorded according to standard royal jelly measurement methods. The top 100 high-yield colonies and the bottom 100 low-yield colonies were selected based on their royal jelly yield from highest to lowest. Through the measurement and statistical analysis of royal jelly yield in the 100 high-yield and 100 low-yield colonies, the average royal jelly yield of the high-yield and low-yield colonies was 243.38g and 77.90g, respectively. Figure 7 The T-test analysis showed a significant difference in royal jelly production between the two bee colonies (P < 0.001). One worker bee was taken from each of 100 high-yield and 100 low-yield royal jelly colonies, and genomic DNA was extracted from the bee samples. The purity, concentration, and integrity of the DNA samples were then tested.

[0039] (2) SNP detection and filtering: Quality-compliant samples were used for library construction and paired-end sequencing on an Illumina Novaseq 6000PE150 sequencing platform. Data quality control and processing were performed on the sequencing data. After obtaining high-quality sequencing data for each royal jelly sample (high and low yield), SNPs were detected using Samtools and filtered using VCFtools software to ensure high SNP quality (filtering and selection conditions: VCFtools–maf0.05-max-missing 0.7-allow-extra-chr). Sites with a minimum allele frequency <0.05 and sites with a sample missing rate >30% were filtered out.

[0040] (3) Screening of SNPs related to high-yield traits of royal jelly: through θ π Ratio(θ πHRJB / θ πLRJB The analytical methods initially screened out 20 SNPs associated with high royal jelly production. Samples of high- and low-yielding Western honeybees were collected and validated using PCR and DNA sequencing. NC_037641.1_10806386 and NC_037641.1_10806436 were selected as SNP markers associated with royal jelly production.

[0041] Example 2:

[0042] A method for identifying high royal jelly production traits in Western honeybee colonies using SNP markers (NC_037641.1_10806386; NC_037641.1_10806436) comprises the following steps:

[0043] (1) Individual Bee Sampling: The samples used in this study came from a high-yield royal jelly apiary and a low-yield royal jelly apiary in Yancheng, Jiangsu Province, during the rapeseed flowering season in my country. Fifteen colonies of Western honeybees each were marked as experimental colonies in the apiary (they were from the Western honeybee colonies whose royal jelly production was measured in Example 1, and statistical analysis showed a significant difference in royal jelly production between the high-yield and low-yield colonies). From each experimental colony, 3-4 newly emerged adult worker bees were collected, randomly sampled, and frozen at -20℃ for later use.

[0044] (2) Extraction of DNA from bee samples (using the TIANGEN Genome Extraction Kit)

[0045] ① Place the abdominal samples of worker bees with high and low royal jelly production into 1.5 mL centrifuge tubes, add small magnetic beads and 200 μL of buffer GA, and grind them thoroughly into homogenate using a tissue homogenizer;

[0046] ② Add 20 μL of Proteinase K solution, mix well, and place in a 56℃ metal bath to dissolve tissue fragments for 1.5 h. Invert the container several times every 30 min to make the reaction more complete.

[0047] ③ Add 200 μL of buffer GB, mix thoroughly, and place in a 70°C metal bath for 10 min. The reaction solution will become clear and free of bubbles.

[0048] ④ Add 200 μL of anhydrous ethanol, shake well, and centrifuge at 12,000 rpm for 2 min at room temperature;

[0049] ⑤ Use a pipette to add the solution to the adsorption column, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid;

[0050] ⑥ Add 500 μL of GD buffering and 600 μL of PW rinsing solution in sequence, centrifuging at high speed each time and discarding the waste liquid.

[0051] ⑦ Place the adsorption column in a clean centrifuge tube, add 30 μL LEPC water, let stand for 5 min, centrifuge at high speed, and repeat this step twice;

[0052] ⑧ The concentration and OD value of the obtained DNA were detected using a NanoDrop 2000 UV spectrophotometer, the quality of the extracted DNA was detected using agarose gel electrophoresis, and finally it was stored at -20℃ for later use.

[0053] (3) The upstream and downstream primer sequences of the amplification products containing two SNPs (NC_037641.1_10806386; NC_037641.1_10806436) are as follows:

[0054] Primer-F: 5'-TGTTCACTTGTCGAGTGCGAAG-3'

[0055] Primer-R: 5'-ACCAGCGATACTTAAGCGGACA-3'

[0056] Dilute it to 10 μmol / μL and store at -20℃ after use.

[0057] (4) PCR detection: Using the DNA of each individual bee in step (2) as a template, PCR was performed using Primer-F and Primer-R as primers. The PCR reaction products were detected by agarose gel electrophoresis, and the PCR reaction solution with the target band was sequenced.

[0058] PCR reaction system (50 μL):

[0059] Mixture reaction mixture: 25 μL

[0060] Primer-F: 2μL

[0061] Primer-R: 2μL

[0062] Template: 1μL

[0063] ddH2O: 20μL

[0064] Reaction conditions:

[0065]

[0066] (5) Analysis of the sequencing results obtained from SNPs (NC_037641.1_10806386; NC_037641.1_10806436): The following are the reference sequences of the PCR product fragments marked by these two SNPs. The position of the SNP site (NC_037641.1_10806386) in the sequence is marked as follows: C / T The location of the SNP site (NC_037641.1_10806436) in the sequence is marked as follows: G / T .

[0067] 5'-TGTTCACTTGTCGAGTGCGAAGAAAATATCGTGATGGATATTTTGTGATTTTTTTTTTTAATTTCCTCGTCTAGAAAACATTACTAAACTATTTTTTTTGTTCCAAATACAATATTATTCAGTAAACTGATTCGATATTTATTTAATGTGTTCACTTGTTCACTTGTCGAATGTAAAAGAAAAGCTCATGATGGATATTTTGTGATTTTC TCGAAAAGATTATTAAACTATTTTTTTGTTTCCAGATGCAATATTATCCACAATAAACTAATTTGATATTTATTTATATGGAATAGGTGTTTTTGTTACTTGCAAAGAAAAGATCATGATAAATATTATGTGAGTTCTTTTGTTCTTTCTTTTTTGATTTCTTCAAAAAGATTTAACTATTAAACTATTTCTTTGTTCCAGATACAATATTAT C / T CAGTATTT ATTTGGGGATATATGAGTGCAAAGAAAAGATCAGATACTTT G / T TGAATAATAACACAAAT AACTTAACGAACGAATACTCTTTGCGATGCTTGAACCGACTTTTGAGATTCTTTTCATCGGGAATTTAATTTCTTTTTATCCTAAAAGATGATCAAAAGATCGTGAAATAGATATTTTGTGTTTCTTCGCCTAGAAAAAATTACTAAAATTATTTCTTTGTTCCAAATACATTTTACTGTCCGCT TAAGTATCGCTGGT-3'

[0068] Examine the PCR product sequencing peak diagram to locate the SNP marker (NC_037641.1_10806386) within the peak diagram. Genotype peak diagram standards are as follows: Figure 1 , Figure 2 and Figure 3 Mark the location, determine the genotype (homozygous TT, homozygous CC, or heterozygous CT) of each sample at that locus and count the results; and determine the position of the SNP marker (NC_037641.1_10806436) in the peak diagram, with the genotype peak diagram standard as follows. Figure 4 , Figure 5 and Figure 6 Mark the location, determine the genotype (homozygous TT, homozygous GG, or heterozygous GT) of each sample at that locus, and count the results.

[0069] (6) Identifying high royal jelly production traits in bee colonies using SNPs (NC_037641.1_10806386; NC_037641.1_10806436): The sequencing results from step (4) were sequence aligned using BioEdit software, and the peak types of the markers were statistically analyzed. The genotypes and gene frequencies were calculated, as shown in Tables 1 and 2. Based on the frequency P of the T allele in the SNP marker (NC_037641.1_10806386) in worker bee individuals randomly collected from the colony, T and the frequency of the C allele P C Whether there are significant differences between them can help identify high royal jelly production traits in bee colonies, where the frequency of the T allele in the bee colony is P. T Significantly greater than the C allele frequency P C At that time, this bee colony was a high-yield royal jelly colony; according to the frequency P of the T allele appearing in the SNP marker (NC_037641.1_10806436) T The frequency of the G allele P G To identify high royal jelly production traits in bee colonies, significant differences exist between them, when the frequency of the T allele in the bee colony is P. T Significantly greater than the frequency of the G allele P G At that time, this bee colony was a high-yield royal jelly bee colony.

[0070] Table 1. Distribution of different genotypes and gene frequencies of SNP (NC_037641.1_10806386)

[0071]

[0072] Table 2. Distribution of different genotypes and gene frequencies of SNP (NC_037641.1_10806436)

[0073]

[0074] Table 1 shows the results using χ²2 The chi-square test (χ²) is used to obtain the statistical value. 2 =7.434, P<0.01 indicates a significant difference between bee colonies with different royal jelly production capacities and different genotypes, which is statistically significant. This suggests that the royal jelly production capacity of bee colonies is affected by genotype. The P value of the high-yielding royal jelly group is... T Significantly greater than P C In the low-yield group, P T Significantly smaller than P C Table 2 uses χ² 2 The chi-square test (χ²) is used to obtain the statistical value. 2 =21.35, P<0.001 indicates that there is a highly significant difference between bee colonies with different royal jelly production capacities and different genotypes, which is statistically significant. This shows that the royal jelly production capacity of bee colonies is affected by genotype. The P value of the high-yielding royal jelly group is... T Significantly greater than P G In the low-yield group, P T Significantly smaller than P G Therefore, by statistically analyzing whether there are significant differences in the allele frequencies of the two SNPs, C and T, and G and T, in a bee sample, it can be determined whether the bee colony is a high-yield royal jelly colony.

[0075] The main reagents used in this invention are as follows (all chemical reagents are of analytical grade):

[0076] Anhydrous ethanol, isopropanol, chloroform, ultrapure water, Trans DNA Marker I, Trans DNA 2×EasyTaqPCR SuperMix, Trans DNA agarose, Trans DNA Galstain, Sangon Biotech 50×TAE electrophoresis buffer, Animal Genome Rapid Extraction Kit SK8222, upstream and downstream primers synthesized by [unspecified source], nuclease A.

[0077] The main instruments used in this invention are as follows:

[0078] Axygen 1.5mL centrifuge tubes, Axygen PCR tubes, microwave oven, electronic balance, shaker, mini centrifuge, water bath, micropipette, electrophoresis apparatus, ABI 96-well PCR instrument, Shanghai Peiqing Technology Co., Ltd. gel imaging analyzer, high-speed centrifuge, low-temperature freezer, autoclave, NanoDrop 2000, etc.

[0079] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A primer for detecting SNP markers, characterized in that: The forward primer sequence is 5'-TGTTCACTTGTCGAGTGCGAAG-3', and the reverse primer sequence is 5'-ACCAGCGATACTTAAGCGGACA-3'; the target fragment amplified by the primers is 688bp in size; The SNP markers are selected from NC_037641.1_10806386 and NC_037641.1_10806436. NC_037641.1_10806386 and NC_037641.1_10806436 are located in the following reference sequence: 5'-TGTTCACTTGTCGAGTGCGAAGAAAATATCGTGATGGATATTTTGTGATTTTTTTTTTTAATTTCCTCGTCTAGAAAACATTACTAAACTATTTTTTTTGTTCCAAATACAATATTATTCAGTAAACTGATTCGATATTTATTTAATGTGTTCACTTGT TCACTTGTCGAATGTAAAAGAAAAGCTCATGATGGATATTTTGTGATTTTCTCGAAAAGATTATTAAACTATTTTTTTGTTTCCAGATGCAATATTATCCACAATAAACTAATTTGATATTTATTTATATGGA ATAGGGTTTTTGTTTACTTGCAAAGAAAAGATCATGATAAATATTATGTGAGTTCTTTTGTTCTTTCTTTTTTGATTTCTTCAAAAAGATTTAACTATTAAACTATTTCTTTGTTCCAGATACAATATTAT C / T CAGTATTTATTTGGGGATATATGAGTGCAAAGAAAAGATCAGATACTTT G / T TGAATAATAACACAAATAACTTAACGAACGATACTCTTTGCGATGCTTGAACCGACTTTTGAGATTCTTTTCATCGGGAATTTAATTTCTTTTTATCCTAAAAGATGATCAAAAGATCGTGAAATAGATATTTTGTGTTTCTTCGCCTAGAAAAAATTACTAAATTATTTCTTTGTTCCAAATACATTTTACTGTCCGCTTAAGTATCGCTGGT-3', NC_037641.1_10806386 is located at the 424th base T or C from the 5' end of the reference sequence, and NC_037641.1_10806436 is located at the 474th base T or G from the 5' end of the reference sequence.

2. The application of the primers described in claim 1 in identifying the high-yield royal jelly trait in Western honeybee colonies.

3. The application of the primers described in claim 1 in the breeding of high-yield royal jelly traits in Western honeybees.

4. A method for identifying high royal jelly production traits in Western honeybee colonies using SNP markers, characterized in that: Adult worker bees were randomly collected from the Western honeybee colony to be tested, and their genomic DNA was extracted. Using the extracted genomic DNA as a template, a PCR amplification reaction was performed using the primers described in claim 1 to obtain the PCR reaction product; The obtained PCR reaction products were detected by agarose gel electrophoresis, and the PCR reaction solutions that showed the target band were sequenced. The sequencing results were analyzed to calculate the gene frequency of SNP marker sites in the honeybee colony to determine whether the honeybee colony was a high-yield royal jelly colony. When calculating the gene frequency at the NC_037641.1_10806386 locus in a tested Western honeybee colony, if the T allele frequency of the colony is significantly greater than the C allele frequency, then the colony is a high-yield royal jelly colony; "significant" refers to statistical significance. P <0.01; When calculating the gene frequency at the NC_037641.1_10806436 locus in a tested Western honeybee colony, if the T allele frequency of the colony is significantly greater than the G allele frequency, then the colony is a high-yield royal jelly colony; "significant" refers to statistical significance. P <0.001.

Images