Preparation method and application of an umbilical cord extract

By optimizing the enzymatic lysis process using trypsin mutants, the problem of low enzymatic lysis efficiency of umbilical cord extracts in the prior art was solved, and the prepared extracts showed significant acceleration effects in skin repair.

CN119302994BActive Publication Date: 2025-07-22广州博士派生物科技有限公司
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411341809.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-25
Publication Date
2025-07-22
Estimated Expiration
2044-09-25

AI Technical Summary

Technical Problem

In the prior art, the enzymatic method of animal umbilical cord extract is inefficient and complicated, resulting in a low extraction rate and poor effect.

Method used

The animal umbilical cord was enzymatically dissolved by trypsin mutants, including homogenization, stirring, centrifugation, inactivation, filtration, ultrafiltration and lyophilization, and the enzymatic lysis process was optimized to improve the activity and stability of the extract.

Benefits of technology

The enzymatic lysis efficiency was improved, and the prepared umbilical cord extract significantly accelerated the skin repair effect in the mouse burn model, and completely healed 2 days in advance, which was better than the ordinary method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119302994B_ABST
    Figure CN119302994B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of animal umbilical cord extraction, and particularly relates to a preparation method and application of an animal umbilical cord extract. By using a trypsin mutant to prepare the umbilical cord extract, the present invention not only improves the enzymatic hydrolysis efficiency, but also the obtained umbilical cord extract is significantly superior to ordinary enzymolysis products in terms of skin repair effect. In the repair of a mouse burn model, the recovery rate of the mouse skin is 2 days earlier than that of the ordinary umbilical cord extract. The umbilical cord extract prepared by the method provided by the present invention is expected to be widely used in wound or skin repair.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal umbilical cord extraction, and specifically relates to a preparation method and application of an animal umbilical cord extract. Background Art

[0002] A large number of studies have shown that animal umbilical cord proteins, umbilical cord peptides, umbilical cord extracts, and umbilical cord extracts all have good effects in repairing tissue damage, promoting metabolism, delaying skin aging, regulating body immunity, anti-cancer, liver protection, etc., and have excellent antioxidant activity. They are commonly used in clinical practice to treat oxidation-induced diseases, and their antioxidant activity is mainly regulated by proteins.

[0003] The umbilical cord extract contains umbilical cord stem cell exosomes, which contain natural components such as small molecule peptides, free amino acids, vitamin A groups, organic acids, inorganic acids, etc. that are indispensable for healthy skin, as well as up to hundreds of active nutrients and signal substances required for regulating cell growth. It plays a key role in comprehensively conditioning the skin, improving skin quality, and preventing aging, and can quickly repair the skin barrier and restore the state of young and healthy vitality.

[0004] Currently, extracts from animal tissues are usually prepared by enzymatic hydrolysis. For example, the invention patent with the publication number CN105420325B discloses a method for preparing umbilical cord polypeptide by one-step enzymatic hydrolysis using trypsin. The invention patent with the publication number CN101773522B discloses a method for preparing porcine intestinal mucosa extract by two-step enzymatic hydrolysis. First, trypsin is used to enzymatically hydrolyze porcine intestinal mucosa, and then the enzymatic hydrolysis product is enzymatically hydrolyzed using papain.

[0005] However, the extracts prepared by the above methods have defects such as low extraction rate and poor extract effect. Summary of the Invention

[0006] The first aspect of the present invention provides a preparation method of umbilical cord extract. In order to overcome the problems of low enzymatic hydrolysis efficiency and complex process in the prior art using enzymatic hydrolysis, a mutant of trypsin is used to enzymatically hydrolyze animal umbilical cords. The specific steps include:

[0007] (1) Take animal umbilical cord tissue and homogenize it;

[0008] (2) Add an aqueous solution of trypsin or its mutant to the homogenized tissue obtained in step (1) to form a mixed solution, then stir and centrifuge to collect the supernatant;

[0009] (3) Inactivate microorganisms and trypsin: Inactivate the supernatant obtained in step (2) and collect the inactivated supernatant;

[0010] (4) Filter and ultrafilter the extract: Filter the supernatant obtained in step (3) to remove pathogens;

[0011] (5) Ultrafilter the filtrate obtained in step (4), and the ultrafiltration conditions are: inlet pressure 0.5 - 1.2 MPa, outlet pressure -0.5 - -1.2 MPa, and temperature 4 - 15 °C;

[0012] (6) Lyophilize and preserve the extract: Freeze the filtrate obtained in step (5) to -40 °C to -45 °C within 3 - 6 hours and vacuum dry it.

[0013] Preferably, the animal umbilical cord is sourced from pigs, cows, sheep, etc.;

[0014] Preferably, the trypsin can be from any commercially available product. More preferably, the wild-type amino acid GenBank ID of the trypsin is 1AVW_A, which contains 223 amino acids.

[0015] More preferably, its amino acid sequence is as shown in SEQ ID NO:1, and its specific sequence is

[0016]

[0017] Preferably, its nucleotide sequence is as shown in SEQ ID NO:2, and its specific sequence is:

[0018]

[0019] More preferably, the trypsin is a mutant, and can be selected from one or more of N31K, S92D, and I161L;

[0020] Preferably, the amino acid sequence of the mutant N31K is as shown in SEQ ID NO:3, and its specific sequence is

[0021]

[0022] Preferably, the amino acid sequence of the mutant N31K / S92D is as shown in SEQ ID NO:4, and its specific sequence is

[0023]

[0024] Preferably, the amino acid sequence of the mutant N31K / I161L is as shown in SEQ ID NO:5, and its specific sequence is

[0025]

[0026]

[0027] Preferably, the concentration of the trypsin or variant is 5 - 20 g / L, more preferably 10 - 20 g / L.

[0028] Preferably, in step (1), the umbilical cord tissue is cleaned with water before homogenization. More preferably, the cleaned umbilical cord tissue is soaked in povidone iodine and then deiodinated with alcohol after being taken out.

[0029] Preferably, the centrifugation in step (2) is carried out at 5000 - 10000 r / min for 10 - 15 min.

[0030] Preferably, it is inactivated in a water bath at 60°C - 85°C for 30 - 40 minutes;

[0031] On the other hand, the present invention provides an umbilical cord extract obtained by the above method. The extract obtained by this method has high activity and strong stability, and has a wide range of application scenarios.

[0032] On the other hand, the present invention provides an application of the above umbilical cord extract. Experiments in a mouse model show that the umbilical cord extract has good effects in skin wound healing and is expected to be widely used in products for skin repair and scar removal. Description of the Drawings

[0033] Figure 1 Western electrophoresis of enzyme mutants. Among them, band 1 is the N31K / S92D enzyme mutant, and band 2 is the N31K / I161L enzyme mutant.

[0034] Figure 2 Enzyme activity detection chart. Among them, 1 - 6 are the enzyme activities of trypsin WT and mutants N31K, S92D, I161L, N31K / S92D, and N31K / I161L respectively.

[0035] Figure 3 Burn skin healing rate of mice in different treatment groups.

[0036] Figure 4 HE staining map of skin tissue. Histological observation results of scalded skin tissues of mice in different treatment groups at 5d and 11d. A: blank group; B: extract 1 group; C: extract 2 group; D: extract 3 group. Detailed Embodiments

[0037] The present invention will be further described below in conjunction with the drawings and specific embodiments, but the protection scope of the present invention is not limited thereto.

[0038] In the following embodiments, various processes and methods not described in detail are all conventional methods well known in the art. The sources, trade names of the reagents used, and those for which it is necessary to list their components are indicated when they first appear. For the same reagents used later, without special instructions, they are the same as the content indicated for the first time; for the reagents, materials, etc. involved, if not otherwise specified, they are obtained through commercial channels.

[0039] Preparation of Trypsin Mutant in Example 1

[0040] Screening of Trypsin Mutants In order to improve the enzyme activity of wild-type trypsin (GenBank: 1AVW_A, amino acid sequence is SEQ ID NO:1, and the coding nucleotide sequence is SEQ ID NO:2), the inventors screened a large number of mutations of amino acids near the enzyme active site through directed evolution technology.

[0041] The following PCR primers were designed:

[0042] F: GGC AATTCT AAATTGTGGGCGGCTATACCT (The underlined part is the recognition site of restriction endonuclease EcoRI, SEQ ID NO:6);

[0043] R: ATA GCGGCCGC AGCAGACCATTGCCGCCAAT (The underlined part is the recognition site of restriction endonuclease NotI, SEQ ID NO:7).

[0044] Using the trypsin gene (SEQ ID NO:2) as a template, the above primers were used for PCR amplification with the GeneMorph II Random Mutagenesis PCR Kit (Stratagene). The PCR products were recovered by gel electrophoresis, digested with EcoRI and NotI, and then ligated to the pET21a vector digested with the same enzymes. The ligation products were transformed into Escherichia coli BL21(DE3), and spread on LB + Amp plates. After culturing at 37°C in an inverted position, when transformants appeared, they were individually picked with toothpicks into 96-well plates. 150 μL of LB + Amp medium containing 0.1 mM IPTG was added to each well, and cultured at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended with buffer. The cells were lysed by repeated freezing and thawing to obtain an Escherichia coli cell lysate containing trypsin.

[0045] 50 μL of the lysate was taken out and transferred to two new 96-well plates. The trypsin activity and protein content were measured at 37°C respectively, and the specific activity of different mutants was calculated.

[0046] The experimental results showed that the mutant sites with significantly improved enzyme activity at 37°C were: N31K, S92D or I161L.

[0047] On this basis, trypsin mutants containing one or two combinations of the above mutation sites N31K, S92D or I161L were obtained.

[0048] Construction of Recombinant Strains in Example 2

[0049] The above-mentioned enzyme mutant nucleotides were all synthesized by Sangon Biotech (Shanghai) Co., Ltd. The wild type (wt) and its variants were successfully cloned into the plasmid pET-30a(+). Meanwhile, 6 His tags were added to the N-terminus of the gene during the construction of the expression plasmid. The successfully constructed recombinant plasmids were transformed into Escherichia coli BL21(DE3) cells, denoted as E.coli BL21(DE3) / pET-30a(+)-WT, E.coli BL21(DE3) / pET-30a(+)-mutN31K, E.coli BL21(DE3) / pET-30a(+)-mutS92D, E.coli BL21(DE3) / pET-30a(+)-mutI161L, E.coli BL21(DE3) / pET-30a(+)-mutN31K / S92D, and E.coli BL21(DE3) / pET-30a(+)-mutN31K / I161L. Single colonies of the recombinants were picked, cultured in the medium, identified by colony PCR, verified by restriction digestion and sequencing, and the wild-type and mutant engineering bacteria were selected and preserved.

[0050] Example 3 Expression and Enzyme Activity Assay of Trypsin

[0051] Three strains of each type were selected and cultured in liquid LB medium (containing 5 μg / mL erythromycin), statically cultured overnight at 30 °C. The next day, they were inoculated into 100 mL of liquid LB medium (containing 5 μg / mL erythromycin) at an inoculation amount of 5%. When the OD600 reached about 0.5 at 30 °C, 100 μL of 0.3 M CuSO4 filtered and sterilized was added in the ultra-clean workbench, and then statically cultured at 30 °C for 4 h and then at 16 °C for 24 h. 90 μL of the supernatant of the recombinant strain cell lysate was taken respectively, mixed with 30 μL of 4× Protein Loading Buffer, and boiled at 100 °C for 10 min. Centrifuged at 4 °C and 12 000 rpm for 5 min to collect the sample treatment solution, and purified by ion exchange chromatography.

[0052] Specifically, 10.0 mL of the trypsin and its mutant concentrate was passed through a HiTrap Q HP anion column pre-equilibrated with 10 mmol / L Tris-HCl (pH 8.0), and then linearly gradient eluted with 10 mmol / L Tris-HCl (pH 8.0) containing 1 mol / L NaCl. The enzyme activity was detected by colorimetry, and the purity of the gradient eluted protein solution was detected by SDS-PAGE gel electrophoresis.

[0053] As Figure 1As shown, SDS-PAGE was performed on the double mutant trypsin, and a clear and bright band of approximately 23.4 Kda was obtained, indicating that the above mutants were all successfully expressed and had a high purity.

[0054] As Figure 2 shown, the average extracellular enzyme activities of WT, N31K, S92D, I161L, N31K / S92D, and N31K / I161L (corresponding to the enzyme types in sequence Figure 2 ) were 225.6 U / mL, 255.1 U / mL, 245.3 U / mL, 276.8 U / mL, 332.7 U / mL, and 305.2 U / mL, respectively.

[0055] It can be Figure 2 seen that the enzyme activities of the mutants N31K and I161L were significantly increased compared with the wild type (P < 0.05), and the enzyme activities of the mutants N31K / S92D and N31K / I161L were significantly increased compared with the wild type (P < 0.01).

[0056] * indicates P < 0.05, and ** indicates P < 0.01.

[0057] The wild-type trypsin and the enzyme mutants N31K / S92D and N31K / I161L with higher enzyme activities were selected for the preparation of animal umbilical cord extracts.

[0058] Example 4 Preparation of Umbilical Cord Extracts

[0059] (1) Treatment of animal tissues: Collect porcine umbilical cord tissues. After cleaning with sterile pure water, cut the umbilical cord tissues into pieces of 1 cm 3 in size with sterile scissors under sterile conditions, transfer them to soak in iodophor for 2 minutes, then take them out and deiodinate with 75% (v / v) alcohol, rinse 3 times with sterile pure water, and homogenize mechanically under sterile conditions.

[0060] (2) Enzymolysis of the extract: Add an aqueous solution of trypsin or its mutant at 25 g / L with a volume 4 times that of the tissue homogenate obtained in step (1), then place it in a stirrer. After stirring for 24 hours, add the same volume of sterile pure water and mix well, centrifuge at 8000 r / min for 10 min, and collect the supernatant and store it at 5°C.

[0061] (3) Inactivation of microorganisms and trypsin: Inactivate the supernatant in step (2) in a water bath at 65°C for 30 minutes, and collect the inactivated supernatant.

[0062] (4) Filtration and sterilization of the extract: The supernatant after inactivation in step (3) is successively passed through filters with pore sizes of 100 μm, 50 μm, 20 μm, 100 nm, 50 nm, and 20 nm to remove pathogens. The filtration conditions are an inlet pressure of 0.9 MPa and a temperature of 8°C. Collect the filtrate.

[0063] (5) Ultrafiltration of the extract: The filtrate collected in step (4) is subjected to positive and negative pressures to pass through filter membranes with molecular weights of 50,000 Daltons and 5,000 Daltons respectively. Those less than 50,000 Daltons and greater than 5,000 Daltons are cytokines, and those less than 5,000 Daltons are composite polypeptides. Collect the filtrates separately. The filtration conditions are: an inlet pressure of 1.0 MPa, an outlet pressure of -1.0 MPa, and a temperature of 5°C. Store at low temperature.

[0064] Among them, the umbilical cord extract prepared using wild-type trypsin is extract 1, the umbilical cord extract prepared using the enzyme mutant N31K / S92D is extract 2, and the umbilical cord extract prepared using the trypsin enzyme mutant N31K / S161L is extract 3.

[0065] Example 5 Construction of a mouse burn model and exploration of the effect of umbilical cord extract

[0066] Select 40 C57 mice aged 6 - 8 weeks, randomly divide them into four groups (blank group, extract 1 group, extract 2 group, extract 3 group), with 10 C57 mice in each group. After depilation with 6% sodium sulfide dilution, a self-made burn and scald instrument is used. Adjust the temperature to 100°C, fix the unified iron head on the depilated area of the mouse back, and control the time to 5 s. Anesthetize with 5% chloral hydrate before creating the wound. Apply different drugs externally to the burn and scald wounds on the back every day. Take pictures and observe on the 3rd, 5th, 7th, 9th, 11th, 13th, and 15th days respectively, and analyze the burn and scald area and healing rate.

[0067] The healing rate of burn and scald = (original area - unhealed wound area) / original area.

[0068] The results are shown in Figure 3 . The burn and scald healing rates of the extract 2 - 3 groups approached 100% on the 9th day after injury, and the burn and scald healing rate of the blank group approached 100% on the 13th day. The extract 1 group was completely healed around the 11th day after injury. There was a significant difference in the healing rate between the extract 1 group and the blank group (P < 0.05). The healing time of the extract 2 - 3 groups was around 9 days. Compared with the blank group, the burn and scald healing rate during the healing process was significantly greater than that of the blank group (P < 0.01), and there was also a significant difference from the extract 1 group (P < 0.05), with the complete healing time advanced by about 2 days.

[0069] Samples were taken on the 5th day and the 11th day respectively. The burn and scald mice were sacrificed by cervical dislocation. During the operation, the Animal Ethics Protection Law was strictly followed. The mice were disinfected in 75% ethanol solution for 60 s, and then immediately transferred to a laminar flow hood. The burn and scald wounds on the back of the mice were separated using microsurgical scissors, about 0.3 cm away from the edge of the burn and scald wound. The free edge skin grafts were transferred to a surgical dissecting microscope and trimmed to be flat and regular, fixed with paraformaldehyde for 24 hours, dehydrated with gradient concentrations of ethanol (70%, 80%, 90%, 95% and 100%), infiltrated with transparent wax, and embedded into tissue wax blocks.

[0070] HE staining: The paraffin sections were baked in an oven at 60 °C for 1 hour. The sections were successively placed in xylene I for 20 min, xylene II for 20 min, absolute ethanol I for 5 min, absolute ethanol II for 5 min, 75% ethanol for 5 min, and rinsed with tap water for 10 s. The sections were stained with hematoxylin solution for 4 min, rinsed with tap water for 10 s, differentiated with differentiating solution for 5 s, rinsed with tap water for 10 s, blued with bluing solution, and rinsed with running water for 10 s. The sections were successively dehydrated with gradient ethanol of 85% and 95% for 5 min each, and stained with eosin solution for 5 min. The sections were successively placed in absolute ethanol I for 5 min, absolute ethanol II for 5 min, absolute ethanol III for 5 min, xylene I for 5 min, and xylene II for 5 min for transparency, and sealed with neutral gum.

[0071] It can be seen from Figure 4 that in the blank group, at 5 days after scald, the damaged tissues were arranged loosely, with a large amount of pink-stained edema fluid between tissues, and obvious tissue structure and cell edema (HE, 300x). At 11 days after scald, a certain amount of newly formed capillaries and fibroblasts could be seen at the damaged tissue site (HE, 300x);

[0072] In extract 1 group, at 5 days after scald, the damaged tissues were arranged loosely, with pink-stained edema fluid and infiltrated inflammatory cells between tissues, and obvious tissue structure and cell edema (HE, 300x); at 11 days after scald, abundant newly formed capillaries, fibroblasts and infiltrated inflammatory cells could be seen at the damaged tissue site (HE, 300x);

[0073] In extract 2 group, at 5 days after scald, the damaged tissues were arranged loosely, with a small amount of pink-stained edema fluid and infiltrated inflammatory cells between tissues (HE, 300x); at 11 days after scald, a large number of capillaries and fibroblasts could be seen, and the granulation tissue was well-developed and healthy (HE, 300x).

[0074] In extract 3 group, at 5 days after scald, the damaged tissues were arranged loosely, with a small amount of pink-stained edema fluid and infiltrated inflammatory cells between tissues (HE, 300x); at 11 days after scald, a large number of capillaries and fibroblasts could be seen, and the granulation tissue was well-developed and healthy (HE, 300x).

[0075] That is, the healing of the burned skin of mice and the histological scores of the extract groups 2-3 were better than those of the blank group and the extract group 1 (P<0.05).

[0076] Therefore, the use of the above enzyme mutant to prepare umbilical cord extract in this application not only simplifies the preparation process and effectively improves the enzymatic hydrolysis efficiency, but also the prepared umbilical cord extract has a very obvious effect on the repair of burned tissues, and is significantly better than the extract obtained by the conventional method, and is expected to be applied in skin repair products.

[0077] The above embodiments only represent several implementation modes of this application, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of this application, several modifications and improvements can still be made, and these all belong to the protection scope of this application. Therefore, the protection scope of the patent of this application should be subject to the appended claims.

Claims

1. A method for preparing an umbilical cord extract, characterized in that, A trypsin mutant is used to enzymatically digest porcine umbilical cord tissue. The amino acid sequence of wild-type trypsin is shown in SEQ ID NO.

1. The mutant has the following mutations relative to the wild-type trypsin: N31K, S92D, S161L, N31K / S92D, or N31K / S161L.

2. The preparation method according to claim 1, characterized in that, The mutant is N31K / S92D or N31K / S161L.

3. The preparation method according to claim 1, wherein The amino acid sequence of the mutant is shown in SEQ ID NO.

4.

4. The preparation method according to claim 1, characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO.

5.

5. The preparation method according to claim 1, characterized in that, The preparation method includes the following steps: (1) Take animal umbilical cord tissue and homogenize it. (2) Add an aqueous solution of the trypsin mutant to the homogenized tissue obtained in step (1) to form a mixture, then stir, centrifuge, and collect the supernatant. (3) Inactivate the microorganism and the trypsin mutant: Inactivate the supernatant obtained in step (2) and collect the inactivated supernatant. (4) Filter the extract: Filter the supernatant obtained in step (3) to remove pathogens. (5) Ultrafilter the filtrate obtained in step (4). The ultrafiltration conditions are: inlet pressure 0.5 - 1.2 MPa, outlet pressure -0.5 - -1.2 MPa, and temperature 4 - 15°C. (6) Lyophilize and preserve the extract: Freeze the ultrafiltered filtrate obtained in step (5) to -40°C to -45°C within 3 - 6 hours and vacuum dry it.

6. The preparation method according to claim 5, wherein, The inactivation step is to inactivate in a water bath at 60°C - 85°C for 30 - 40 minutes.

7. The preparation method according to claim 5, characterized in that, The concentration of the trypsin mutant is 10 - 20 g / L.

Citation Information

Patent Citations

  • An animal intestinal mucosa extract, its preparation method and application

    CN101773522B

  • A method for preparing placental polypeptide

    CN105420325B

  • Preparation method of trypsin

    CN106754842A

  • Production of nerve growth factor (NGF) and of muteins thereof

    US20210079053A1