Application of protocatechualdehyde in preparation of external medicine for preventing or / and treating psoriasis

Abstract

The invention provides an application of protocatechualdehyde in preparation of an external medicine for preventing or / and treating psoriasis. The medicine is used for preventing or / and treating psoriasis, the medicine effect is clear, in-vitro cell experiments prove that the expression level of inflammatory factors such as IL-1alpha and CXCL9 is effectively reduced by inhibiting the phosphorylation of STAT3, the important value of the medicine in scientific research and clinical application is shown, and a new medicine selection is provided for clinic.

Description

Technical Field

[0001] The invention relates to use of protocatechuic aldehyde in preparing an external medicine for preventing or / and treating psoriasis. Background Art

[0002] Psoriasis, also known as psoriasis, is a skin disease characterized by chronic inflammation of the skin. It is mainly manifested by the appearance of red patches on the skin surface, covered with silvery white scales. These lesions are more common on the scalp, knees, elbows and trunk, but may also appear in other parts of the body. The symptoms of psoriasis may be accompanied by itching and pain, which can have a negative impact on the patient's quality of life in severe cases. Although the exact cause of psoriasis is not yet fully understood, it is generally believed that it is related to genetic factors, immune system dysfunction, environmental influences and the use of certain drugs. At present, there is no complete cure for psoriasis, and the existing preventive and / or therapeutic drugs are mostly preparations containing hormones, which have certain side effects. Therefore, drug development based on natural products shows broad research potential.

[0003] Protocatechnic aldehyde (PA), scientifically known as 3,4-dihydroxybenzaldehyde, is one of the main degradation products of salvianolic acid B, a water-soluble component of Salvia miltiorrhiza. It has a wide range of pharmacological activities, including anti-atherosclerosis, myocardial protection, anti-thrombosis, neuroprotection, anti-septic, anti-viral, and anti-fibrosis. Its mechanism of action has been gradually deepened; however, it also has certain cardiotoxicity (Zhang Cuiying, Progress in Pharmacological Research on Protocatechnic Aldehyde, Chinese Journal of Experimental Traditional Chinese Medicine, Vol. 19, No. 23, December 2013). At present, there is no literature report on the use of protocatechnic aldehyde for the prevention and / or treatment of psoriasis. Summary of the invention

[0004] The technical solution of the present invention is to provide a new use of protocatechuic aldehyde.

[0005] The invention provides use of protocatechuic aldehyde in preparing an external medicine for preventing and / or treating psoriasis.

[0006] The present invention provides use of protocatechuic aldehyde in preparing a STAT3 inhibitor.

[0007] Wherein, the drug is a drug that inhibits the expression of p-STAT3 (Y705), p-STAT3 (S727), IL-1α, and CXCL9.

[0008] Wherein, the drug is a drug that inhibits STAT3 phosphorylation.

[0009] The medicine is prepared into a commonly used pharmaceutical preparation by using protocatechuic aldehyde as an active ingredient and adding pharmaceutically acceptable excipients or auxiliary ingredients.

[0010] Wherein, the preparation is emulsion, film, gel, lotion, spray.

[0011] The drug of the present invention is used to prevent and / or treat psoriasis, has clear efficacy, and in vitro cell experiments have shown that by inhibiting the phosphorylation of STAT3, the expression levels of inflammatory factors such as IL-1α and CXCL9 are effectively reduced, showing its important value in scientific research and clinical application, and providing a new drug option for clinical use. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Photos of the back of a psoriasis-like mouse model treated with protocatechuic aldehyde;

[0013] Figure 2 HE sections of mouse back;

[0014] Figure 3 Analysis of mouse back skin thickness and PASI score;

[0015] Figure 4 Analysis diagram of immunohistochemistry results;

[0016] Figure 5 Schematic diagram of Western Blot results;

[0017] Figure 6 Schematic diagram of RT-PCR results. DETAILED DESCRIPTION

[0018] Experimental Example 1 Effect of protocatechuic aldehyde on IMQ-induced psoriasis-like mouse model

[0019] 1 Materials

[0020] 1.1 Experimental instruments and consumables

[0021] Serial number name Manufacturer 1 Imiquimod cream Sichuan Mingxin Pharmaceutical 2 IHC Kits Zhongshan Jinqiao PV-9000 3 Hematoxylin stain Zhongshan Jinqiao ZLI-9610 4 Neutral resin Biosharp Bl704A 5 Urea cream Shanghai Xiaofang Pharmaceutical 6 Hydrocortisone Butyrate Tianjin Jinyao Pharmaceutical 7 Protocatechuic aldehyde Sigma-Aldrich

[0022] 1.2 Immunohistochemistry antibodies

[0023] Serial number name Manufacturer 1 Anti-Phospho-STAT3(Y705)(ET1603-40) Huaan Bio 2 IL-1Alpha Rabbit PolyAb(16765-1-AP) proteintech 3 STAT3 Rabbit PolyAb(10253-2-AP) proteintech 4 Anti-CXCL9 antibody (ab290643) abcam Anti-Phospho-STAT3(S727)(ET1607-39) Huaan Bio

[0024] 1.3 Experimental animals

[0025] SPF grade 6-8 week old male BALB / cJGpt mice were purchased from Chengdu Yaokang Biotechnology Co., Ltd. The temperature of the animal room was 24±1℃, and the mice were free to eat.

[0026] 1.3.1 Drug preparation

[0027] Protocatechuic aldehyde working solution: Take out 400 μM protocatechuic aldehyde stock solution from -20℃ refrigerator, take 21.74 μL and mix it evenly with urea cream to prepare a cream containing 600 ng, totaling 2 g; take 7.25 μL and mix it evenly with urea cream to prepare a cream containing 200 ng, totaling 2 g. Mark them separately and store them in a 4℃ refrigerator.

[0028] Blank matrix: Mix DMSO and 2 g urea cream evenly as blank cream, mark and store in a 4°C refrigerator.

[0029] 2 Experimental methods

[0030] 2.1 Establishment of IMQ-induced psoriasis-like mouse model

[0031] Thirty mice were housed under standard conditions in a constant temperature and humidity environment for 3 days to adapt to the environment, and then randomly divided into 6 groups: (1) 5 healthy control group (Ct), (2) 5 model group (imiquimod group, referred to as IMQ), (3) 5 blank control group (imiquimod + urea cream containing DMSO, namely IMQ + UC), (4) 5 low-concentration experimental group (imiquimod + 200ng / g protocatechuic aldehyde, namely IMQ + 0.2ngPA), (5) 5 high-concentration experimental group (imiquimod + 600ng / g protocatechuic aldehyde, namely IMQ + 0.2ngPA), (6) 5 positive control group (hydrocortisone butyrate, namely IMQ + HB). The hair on the back of the mice was removed with an electric shaver. Except for the healthy control group, 5% IMQ was evenly applied on the back of the mice in the other 5 groups every day to establish an IMQ-induced psoriasis-like inflammation model for 9 days. The backs of the mice were photographed on the 9th day.

[0032] 2.2 Treatment

[0033] Starting from the 5th day, the healthy control group was treated with DMSO-containing urea cream on the back of mice 3 times a day; the model group was treated with 5% IMQ on the back of mice 3 times a day; the blank control group was treated with 5% IMQ on the back of mice, and 2 hours later, DMSO-containing urea cream was applied to the back of mice 3 times a day; the positive control group was treated with 5% IMQ on the back of mice, and 2 hours later, hydrocortisone butyrate was applied to the back of mice 3 times a day; the treatment group was treated with 5% IMQ on the back of mice, and 2 hours later, urea cream containing different concentrations of protocatechuic aldehyde was applied to the back of mice 3 times a day for 4 consecutive days. The back of mice was photographed 4 days later ( Figure 1 ), the mice were killed by cervical dislocation, and skin injury samples were collected and divided into 4 parts, 1 part was fixed in formalin solution, and 3 parts were frozen in liquid nitrogen for later use.

[0034] 2.3H&E

[0035] After 24 hours of collecting the injured sample, the formalin solution was discarded and 70% ethanol was added for soaking. After paraffin embedding, H&E staining was performed and the sample was observed and imaged under an optical microscope ( Figure 2 ) and measured the thickness of the ear epidermis of mice in different experimental groups, and calculated the PASI score of each mouse. GraphPad Prism 8 software was used for data analysis ( Figure 3 ).

[0036] 2.4 Immunohistochemistry

[0037] Prepare ear tissue sections, xylene, anhydrous ethanol, PBS and other solutions of mice in the control group, model group and treatment group according to the following procedures:

[0038] 1) Baking: Place the tissue slices in a 60°C oven for 3 h.

[0039] 2) Dewaxing: Take the slices out of the oven and immediately soak them in No. 1 100% xylene for 10 min and then soak them in No. 2 100% xylene for 10 min.

[0040] 3) Alcohol washing: Take out the slices from No. 2 xylene and soak them in No. 1 anhydrous ethanol for 5 minutes, then soak them in No. 2 anhydrous ethanol for 5 minutes; soak them in 95% ethanol for 5 minutes; soak them in 70% ethanol for 5 minutes; soak them in 50% ethanol for 5 minutes. Place the slices on a shaker and wash them with PBS for 10 minutes, changing the PBS every 5 minutes.

[0041] 4) Antigen repair: Place the slices in a 1000mL beaker, add 800mL of citric acid antigen repair solution, seal with plastic wrap, heat in a microwave oven on medium-high heat until boiling, then turn to medium heat and boil for 35 minutes. After boiling, cool naturally to room temperature. Wash with PBS for 15 minutes, and replace PBS every 5 minutes.

[0042] 5) Inactivation of endogenous peroxidase: Add reagent 1 (blocking agent for inactivating endogenous peroxidase) in the kit onto the tissue, incubate at 37°C for 10 min, wash with PBS for 15 min, and replace PBS every 5 min.

[0043] 6) Blocking: Add 5% BSA blocking solution and block at 37°C for 30 min. After blocking, remove the blocking solution.

[0044] 7) Incubation with primary antibodies: dilute the antibodies STAT3 (1:1000), p-STAT3 (1:1000), IL-1α (1:500), and CXCL9 (1:200) with 5% BSA and drop them on the tissue sections. Place them in a humidified box at 4°C overnight. Wash with PBS for 9 minutes the next day, and change PBS every 3 minutes.

[0045] 8) Incubate with secondary antibody: Add reagent 2 (reaction enhancement solution) in the kit to the tissue section, incubate at 37°C for 30 minutes, wash with PBS for 6 minutes, and replace PBS every 2 minutes. Add reagent 3 (enhanced enzyme-labeled goat anti-mouse / rabbit IgG polymer), incubate at 37°C for 1.5 hours, wash with PBS for 6 minutes, and replace PBS every 2 minutes.

[0046] 9) DAB color development: dilute 20× DAB concentrate to 1× with DAB substrate solution, mix well, and place away from light. Add color development solution drops on the tissue, observe under a microscope, and control the color development time by yourself.

[0047] 10) Hematoxylin re-staining: Add filtered hematoxylin staining solution to the slice, rinse slowly with water for 5 minutes after 1-2 seconds, and observe the staining under a microscope.

[0048] 11) Sealing: Soak the slices in 50% ethanol for 3 minutes; 70% ethanol for 3 minutes; 95% ethanol for 3 minutes; No. 2 anhydrous ethanol for 3 minutes; No. 2 100% xylene for 3 minutes. Add neutral resin to the slices and cover with a coverslip to avoid bubbles. After the neutral resin is air-dried, observe under a microscope and take photos for preservation. Figure 4 ).

[0049] 3 Statistical analysis

[0050] GraphPad Prism 8 software was used to analyze the experimental results. The data were expressed as mean ± standard deviation (SD). After ANOVA analysis of variance, the significance level was tested at α = 0.05 (P < 0.05 was considered to be statistically significant, otherwise it was considered to be insignificant). "*" indicates P < 0.0015, "**" indicates P < 0.0002, and "****" indicates P < 0.0001.

[0051] 4 Experimental results

[0052] like Figure 1 As shown, after continuous application of imiquimod cream for 4 days, the mouse skin showed obvious psoriasis phenotype and pathological characteristics.

[0053] like Figure 1 , Figure 2 As shown in the results, protocatechuic aldehyde significantly improved the epidermal thickness and scaling in the IMQ-induced psoriasis-like mouse model. Figure 3The thickness of the epidermis on the back of mice showed that the epidermis thickness of the model group and the blank control group was significantly increased compared with the healthy control group. At the same time, after treatment with different concentrations of PA, the epidermis thickness showed a significant concentration dependence. Compared with the positive group treated with the marketed drug hydrocortisone butyrate, high concentrations of PA had better therapeutic effects.

[0054] like Figure 4 As shown in the figure, the expression levels of p-SATA3, STAT3, IL-1α, and CXCL9 in the epidermis of mice with IMQ-induced psoriasis-like dermatitis were significantly increased. After treatment with protocatechuic aldehyde, the levels of p-SATA3, IL-1α, and CXCL9 were significantly decreased, but STAT3 did not change significantly, indicating that protocatechuic aldehyde downregulated the expression of inflammatory factors in the STAT3 pathway by inhibiting the phosphorylation of STAT3.

[0055] Experimental Example 2 Effect of protocatechuic aldehyde on keratinocytes HaCaT

[0056] 1 Materials and methods

[0057] 1.1 Materials

[0058] 1.1.1 Cells

[0059] Human immortalized keratinocytes (HaCaT cells) are derived from the Center for Tumor Biology and Innovative Drugs of Chengdu University. HaCaT cells are human immortalized epidermal cells and are immortalized keratinocytes of normal human skin derived from non-tumor sources.

[0060] 1.1.2 Preparation of crude extract

[0061] Weigh 13.8 mg of protocatechuic aldehyde powder and dissolve it in 1 mL of DMSO to prepare 100 mM protocatechuic aldehyde. Take 50 μL of each aliquot into 20 epoxies and store at -20°C for later use to prevent the drug from being ineffective due to repeated freezing and thawing. Take the 100 mM stock solution and dilute it into 200 μM, 100 μM, and 50 μM working solutions, 10 μL each, and store at -20°C for later use.

[0062] 1.1.3 Main reagents

[0063] DMEM high glucose medium (WISNT INC), fetal bovine serum (WISNT INC), PBS (WISNT INC), trypsin (WISNT INC), dimethyl sulfoxide (Solarbio), anhydrous ethanol (Chengshi).

[0064] 1.1.4 Main instruments and consumables

[0065] Cell culture incubator (Thermo scientific), biological safety cabinet (Thermo scientific), upright microscope (Nikon Eclipse Ni-U), high-speed refrigerated centrifuge (Eppendorf 5425R), real-time fluorescence quantitative PCR instrument (BIO-RAD), cell culture dish (NEST), 24-well plate (WHB).

[0066] 1.1.5 Solution preparation

[0067] Complete cell culture medium: DMEM high glucose medium (84%), fetal bovine serum (15%), penicillin-streptomycin double antibody solution (1%).

[0068] Cell freezing medium: complete cell culture medium (90%), DMSO (10%).

[0069] 1.2 Experimental methods

[0070] 1.2.1 HaCaT cell culture and cell recovery

[0071] 1.2.1.1 Cell recovery

[0072] 1) Before the experiment, irradiate the biosafety cabinet with UV light for 30 minutes and take out the culture medium from the 4°C refrigerator in advance to restore it to room temperature.

[0073] 2) Take the cryotube out of -80℃, wipe the outside of the cryotube with 75% ethanol, and place it in a clean bench to return to room temperature. Prepare consumables such as cell culture dishes, pipettes, and serological pipettes, and mark the culture dishes with a marker.

[0074] 3) Pipette 7 mL of complete cell culture medium into a culture dish, then use a pipette to transfer the thawed cell freezing solution into the culture dish, and gently tap the edge of the culture dish to mix the cell components evenly.

[0075] 4) Place the culture dish in a cell culture incubator at 37°C and 5% CO2 for culture.

[0076] 5) Take out the culture dish every day and observe the cell growth status under a microscope, and replace the cell culture medium in time. When the cell density reaches about 80%, process and freeze the cells in time.

[0077] 1.2.1.2 Cell seeding

[0078] 1) Observe the density and adherent growth state of HaCaT cells under a microscope. Before the experiment, irradiate the clean bench with ultraviolet light for 30 minutes, and take out the complete cell culture medium and sterile PBS solution from the 4°C refrigerator in advance to restore to room temperature.

[0079] 2) Aspirate the old culture medium in the culture dish, slowly add PBS along the wall, gently shake the culture dish to clean the cell surface, aspirate the PBS solution, and repeat twice.

[0080] 3) Add 1 mL of trypsin, cover the dish with a lid and gently shake the dish to allow the trypsin to cover the cells. Place the dish in a cell culture incubator and wait for 8 minutes before observing under a microscope.

[0081] 4) When the cells become round and fall off in a sand-like shape, immediately add 6 mL of complete medium to the culture dish to terminate the digestion reaction. Tilt the culture dish and gently blow the cell suspension with an electric pipette.

[0082] 5) During the digestion period, prepare a 24-well plate, add 0.5 mL of cell culture medium to each well, and mark the plate.

[0083] 6) Use an electric pipette to gently blow and mix the digested cell suspension, seed 2 drops of cell suspension into each well of a 24-well plate, then gently tap the plate to evenly distribute the cells in the plate, and place the 24-well plate in a cell culture incubator for culture.

[0084] 1.2.2 Cell Dosing

[0085] When the cell adhesion growth density is about 80%, the medium is replaced and the drug is added.

[0086] 1) IFN-γ (interferon-γ) induction: IFN-γ was taken out from the -80°C refrigerator with an initial concentration of 200 μg / mL, and immediately diluted with complete cell culture medium to a working concentration of 2 ng / mL, 0.5 mL per well, as the model group, and only complete culture medium was used as the blank control group.

[0087] 2) Protocatechuic aldehyde intervention: Step 1) After IFN-γ induction, take out the 200μM, 100μM, and 50μM protocatechuic aldehyde working solutions prepared in 1.1.2 from the -20℃ refrigerator. The working concentrations are 400nM, 200nM, and 100nM, respectively. Add 1μL of the corresponding protocatechuic aldehyde working solution to each well as the experimental group. At the same time, use the complete culture medium containing 1μL of DMSO as the blank control group. After adding, return to the cell culture incubator and continue to culture for 24h.

[0088] 1.2.3Western Blotting

[0089] 1.2.3.1 Protein extraction

[0090] 1) Preparation of protein lysis buffer: RIPA lysis buffer: PI: sodium glycerophosphate: NaF = 90:10:1:1 (volume ratio). After preparation, place in a 4°C refrigerator for later use.

[0091] 2) Loading buffer: 50 μL DTT and 950 μL bromophenol blue. Mix well and place in a -20°C refrigerator for later use.

[0092] 3) Take the 24-well plate out of the cell culture incubator, remove the complete cell culture medium, take out the protein lysis buffer, add 80 μL to each well, collect the protein lysis buffer into the corresponding marked EP tube after it becomes viscous, and then place it on ice. After all samples are collected, add 20 μL of loading buffer to each EP tube, heat at 100°C for about 10 minutes until the liquid in the tube is no longer viscous, and store it in a -20°C refrigerator.

[0093] 1.2.3.2 Electrophoresis

[0094] 1) Preparation of main reagents and operation steps 10% APS: Weigh 1 g of ammonium persulfate, dissolve it in pure water, prepare a 10 mL solution, and store it in a -20°C refrigerator for later use.

[0095] Electrophoresis buffer: Tris base 30g, glycine 144g, SDS 10g, dilute to 1L, place at room temperature for later use.

[0096] Transfer buffer: 28.8 g of glycine, 6 g of Tris base, 400 mL of methanol, dilute to 2 L, place at room temperature for later use.

[0097] 10×TBS solution: 88 g sodium chloride, 24 g Tris base, 13 mL concentrated hydrochloric acid, dilute to 1 L, place at room temperature for later use.

[0098] 1×TBST solution: Measure 100 mL of 10×TBS solution and mix with 1 mL of 20% Tween, dilute to 1 L, and place at room temperature for later use.

[0099] Blocking solution: Weigh 1 g of skim milk powder, dissolve it in 20 mL of 1× TBST solution, and place it at room temperature for later use.

[0100] Antibody diluent: Weigh 1 g of BSA, dissolve in 20 mL of 1×TBST, and place in a 4°C refrigerator for later use.

[0101] 2) Antibody preparation

[0102]

[0103] 3) Prepare 10% SDS-PAGE

[0104] Separation gel: Add the required reagents in a 50ml centrifuge tube in sequence, shake gently for 30 seconds, then inject into the fixed glass plate, seal with isopropanol, wait for about 30 minutes, and observe the interface to see a clear dividing line indicating that the gel has solidified.

[0105] Concentrated gel: Pour off the isopropanol on the separation gel, rinse with pure water 5 times and dry. Add the required reagents in a 50mL centrifuge tube in turn, shake gently for 30 seconds, and then inject into the glass plate until the liquid level is flush with the short plate of the glass plate, insert the comb horizontally, wait for about 30 minutes, and after the concentrated gel solidifies, pull out the comb, rinse the concentrated gel with distilled water, install it in the electrophoresis tank, and add electrophoresis buffer.

[0106] 4) Electrophoresis: Take out the sample from the -20℃ refrigerator before loading and boil it at 100℃ for 3min. The loading volume is 3μL, and the concentration gel uses a constant voltage of 80V. After the sample enters the separation gel, use a constant voltage of 120V until the blue mark is about 1cm away from the bottom of the gel, and then turn off the power.

[0107] 5) Transfer: Cut the filter paper and PVDF membrane in advance, activate the PVDF membrane with methanol, and soak it in pre-cooled transfer buffer. Remove the gel from the glass plate, cut off the excess part, and stack them neatly in the order of "blackboard-filter paper-gel-membrane-filter paper-white board", pay attention to eliminate the bubbles between the layers, merge the clips, put them in the transfer electrophoresis tank, add transfer buffer, and transfer at a constant current of 250mA at 4℃ for 1.5h.

[0108] 6) Blocking: After transfer, soak the membrane in blocking solution and incubate on a shaker for 1 hour at room temperature.

[0109] 7) Incubation with antibodies: After blocking, cut the PVDF membrane according to the target protein, transfer it to the incubation box, add the corresponding primary antibody, completely soak the membrane, incubate at 4°C overnight, and recover the primary antibody the next day. Wash with 1×TBST buffer for 5 min / time, wash 5 times, and replace new 1×TBST solution each time. After washing, add the secondary antibody to the incubation box, completely soak the membrane, incubate at room temperature for 1 hour, and wash with 1×TBST buffer for 5 min / time, wash 5 times, and replace new 1×TBST solution each time.

[0110] 8) Development: Add ECL luminescent liquid to the membrane, expose it in a protein immunoblotting instrument, save the file, and then soak the membrane in 1×TBST solution.

[0111] 1.2.4 RT-PCR

[0112] 1) RNA extraction: Pre-cool the centrifuge at 4°C, then take out the 24-well plate from the cell culture incubator, remove the complete culture medium in the well plate, and add TRIzol lysis solution, 250 μL per well. When the lysis solution becomes viscous, transfer it to the marked EP tube, add 50 μL chloroform, vortex and oscillate for 20 seconds, and then centrifuge at 4°C, 13000rpm, 15min. Pipette the upper colorless liquid into the enzyme-free EP tube, add 150 μL isopropanol, vortex and oscillate to mix evenly, and then precipitate at room temperature for 15min. After precipitation, centrifuge at 4°C, 13000rpm, 10min, and white precipitate can be seen at the bottom of the EP tube after centrifugation. After absorbing the supernatant, add 70% low-temperature alcohol for washing, centrifuge at 4°C, 12000rpm, 10min, absorb the supernatant, and repeat the washing twice. Place in a biosafety cabinet to air dry. After air drying, add 20 μL enzyme-free water to each sample to dissolve, and use an ultra-micro spectrophotometer to measure the RNA concentration.

[0113] 2) Reverse transcription: Dilute the RNA concentration to 300 ng / μL for later use. Reverse transcription kit system: 6.5 μL enzyme-free water, 2 μL 5×All-in-one qRT SuperMix, 0.5 μL Enzyme Mix, 1 μL RNA, mix well, put into PCR instrument, 50℃, 15min; 85℃, 5s for reverse transcription.

[0114] 3) RT-PCR: Take out the sybergreen mix and place it on ice for later use. The reaction system is 5μL sybergreen mix + 0.3μL F target primer + 0.3μL R target primer + 5μL template, and 3 replicate wells are set. The parameters of the real-time fluorescence quantitative PCR instrument are set as pre-denaturation at 95℃ for 15min; denaturation at 95℃ for 15s, annealing at 60℃ for 20s, extension at 72℃ for 45s, and 50 cycles.

[0115] Primer sequences:

[0116] IL-1αForward:CAACGGGAAGGTTCTGAAG

[0117] IL-1αReverse:GTATTTCACATTGCTCAGGAAG

[0118] CXCL9 Forward:AGCAGATGTGAAGGAACTG

[0119] CXCL9 Reverse:CGTTGAGATTTTCGAACTTTCAG

[0120] 18S Forward:TGACGGAAGGGCACCACCAG

[0121] 18S Reverse:GCACCACCACCCACGGAATC

[0122] 2 Experimental results

[0123] HaCaT cells were used as the research object. After three concentrations of protocatechuic aldehyde were applied to keratinocytes, the Western Blotting results after protein extraction, electrophoresis, wet transfer, incubation with primary antibody, secondary antibody, and development were as follows: Figure 5 shown.

[0124] Analysis of protein expression bands revealed that IFN-γ could induce high expression of STAT3, p-STAT3(Y705), p-STAT3(S727), IL-1α, and CXCL9 proteins in keratinocytes. After the action of protocatechuic aldehyde, the levels of p-STAT3(Y705), p-STAT3(S727), IL-1α, and CXCL9 proteins in the samples treated with protocatechuic aldehyde were reduced compared with those in the control group. The above results indicate that protocatechuic aldehyde has an inhibitory effect on the expression of p-STAT3(Y705), p-STAT3(S727), IL-1α, and CXCL9 in keratinocytes.

[0125] qRT-PCR results Figure 6 As shown in the figure, after the action of protocatechuic aldehyde, the mRNA levels of IL-1α and CXCL9 induced by IFN-γ were significantly reduced, indicating that protocatechuic aldehyde can effectively downregulate the transcriptional expression of inflammatory factors downstream of the STAT3 pathway by inhibiting the phosphorylation of STAT3. The data were analyzed using GraphPad Prism 8 software, with mean ± standard deviation (SD). After ANOVA analysis of variance, the significance level was tested at α = 0.05 (P < 0.05 was considered to be statistically significant, otherwise it was considered to be insignificant), and indicated by "*", "**" indicated P < 0.0015, "***" indicated P < 0.0002, and "****" indicated P < 0.0001.

Claims

1. Use of protocatechuic aldehyde in preparing external medicines for preventing and / or treating psoriasis.

2. Use of protocatechuic aldehyde in the preparation of STAT3 inhibitors.

3. The use according to claim 1 or 2, characterized in that: The drug is a drug that inhibits the expression of p-STAT3 (Y705), p-STAT3 (S727), IL-1α, and CXCL9.

4. The use according to claim 1 or 2, characterized in that: The drug is a drug that inhibits STAT3 phosphorylation.

5. The use according to any one of claims 1 to 4, characterized in that: The medicine is prepared into a commonly used pharmaceutical preparation by taking protocatechuic aldehyde as the active ingredient and adding pharmaceutically acceptable auxiliary materials or auxiliary ingredients.

6. The use according to claim 5, characterized in that: The preparation is emulsion, film, gel, lotion or spray.

Images