Novel recombinant herpes zoster vaccine as well as preparation and application thereof

Abstract

The invention belongs to the field of biomedicine, and particularly discloses a herpes zoster vaccine as well as a preparation method and application thereof. The invention provides a herpes zoster vaccine. A fusion protein in the herpes zoster vaccine comprises a VZV-gE protein, an Fc and an optional antigen epitope with a cellular immune activation effect. The adjuvant can be a combination of an MF59 adjuvant and a CpG1009 adjuvant, and enhances humoral immunity and cellular immunity at the same time. The vaccine formed by the fusion protein in cooperation with an innovative adjuvant system can induce generation of strong cellular immunity and humoral immunity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically, to a new antigen, a related adjuvant and application thereof in preparing a herpes zoster vaccine composition. Background Art

[0002] Herpes zoster (HZ) is an infectious skin disease caused by the reactivation of latent varicella-zoster virus (VZV). During primary infection, VZV enters local lymph nodes through the respiratory mucosa and replicates. Lymphocytes infected with the virus then enter the blood circulation through the lymphatic circulation and infect peripheral blood mononuclear leukocytes. The virus spreads to the skin through the bloodstream, and the clinical manifestation is chickenpox. After chickenpox is cured, the virus lurks in the cranial ganglia, dorsal root ganglia of the spinal cord, autonomic neurons or intestinal neurons. When the body's resistance is reduced, the latent virus is reactivated, replicates, and migrates along the peripheral nerves to the skin, and the clinical manifestation is herpes zoster.

[0003] Herpes zoster is common in middle-aged and elderly people, often manifested as a unilateral rash along the area innervated by the sensory nerves, accompanied by neuropathic pain. The most common complication is postherpetic neuralgia (PHN). With the increasing trend of aging population in my country, the incidence of herpes zoster has shown a significant upward trend. The prevention and treatment of herpes zoster has become an important public health issue. Vaccination against herpes zoster is the most effective means to prevent the disease.

[0004] People who have been vaccinated with the attenuated strain of VZV (OKA strain) or who have been naturally infected with VZV can obtain protective immunity. The live attenuated vaccine of the OKA strain has been approved by the US FDA, the China Food and Drug Administration, the European Union and other institutions for children to prevent wild-type varicella virus infection in children. The high-dose live attenuated vaccine of the OKA strain has been approved by the US FDA and the European Union for the prevention of herpes zoster in the elderly over 50 years old, which can effectively prevent or reduce their risk of intercostal neuralgia and other diseases caused by herpes zoster virus. At present, more than 60 countries and regions including the European Union and the United States have recommended that people with normal immune function aged ≥50 years be vaccinated with Zostavax to prevent herpes zoster and postherpetic neuralgia (PHN). The vaccination method is a single dose of vaccine (0.65mL, containing 19400PFU virus) injected subcutaneously in the deltoid area of ​​the upper arm. Adverse reactions such as headache and local injection reaction occasionally occur after vaccination with this vaccine. According to large-scale multicenter clinical trials, the incidence of herpes zoster in people with normal immune function aged 50 to 59 years was reduced by 69.8%, while the incidence of herpes zoster, PHN and disease burden in people aged ≥60 years were reduced by 51.3%, 66.5% and 61.1%, respectively. The preventive efficiency of Zostavax gradually decreases with the age of the vaccine recipient. In addition, people with severe immunosuppression and pregnant women are not suitable for vaccination.

[0005] Shingrix (Chinese trade name: Xin An Li Shi) is a recombinant subunit vaccine for herpes zoster developed by GSK. It produces an effective immune response in the body through varicella-zoster glycoprotein E (gE) antigen and AS01B adjuvant. Clinical data show that Shingrix is ​​97% effective in people aged 50 to 69, and the effectiveness in people over 70 is still as high as 91%; Shingrix is ​​more effective than Zostavax. However, recombinant proteins need to be added with a well-performing adjuvant system to effectively stimulate the body to produce sufficient cellular and humoral immune responses to achieve a protective effect. The adjuvant system AS01 selected by Shingrix contains MPL and QS21, which can cause extensive side effects during clinical use, mainly manifested as: injection site reactions (pain, redness and swelling), muscle pain, fatigue, headache, chills, fever, nausea, vomiting, diarrhea or abdominal pain. According to current clinical data, local adverse reactions in subjects aged 50 years and above are pain (78.0%), redness (38.1%) and swelling (25.9%); general adverse reactions in subjects aged 50 years and above are myalgia (44.7%), fatigue (44.5%), headache (37.7%), chills (26.8%), fever (20.5%) and gastrointestinal symptoms (17.3%). Therefore, the need to prepare a VZV vaccine with fewer side effects and better immune protection is particularly urgent.

[0006] Some recombinant subunit vaccines for herpes zoster have been developed in existing research, but there are problems such as poor protein activity and unsatisfactory immune effect. Therefore, it is necessary to develop an improved VZV vaccine in this field. Summary of the invention

[0007] To solve the above problems, the present invention discloses a novel MF59 / CpG1009 adjuvant recombinant herpes zoster vaccine and its preparation and application. By using the fusion protein disclosed in the present invention as an antigen and the MF59 / CpG1009 adjuvant combination as an adjuvant, a recombinant herpes zoster vaccine with high safety and effectiveness is provided.

[0008] In some aspects, the present invention provides a fusion protein comprising varicella-zoster virus (VZV) glycoprotein gE protein and the Fc region (CH2 and CH3 constant regions of the heavy chain) of human immunoglobulin IgG.

[0009] In some aspects, the fusion protein further comprises a chimeric epitope having a cellular immune activation effect, wherein the chimeric epitope comprises one or more selected from the following:

[0010] (a) Activatable CD4 from ORF9 of VZV + A T cell epitope comprising the amino acid sequence shown in SEQ ID NO: 1;

[0011] (b) Activatable CD4 from IE62 of VZV + A T cell epitope comprising the amino acid sequence shown in SEQ ID NO: 2;

[0012] (c) Activatable CD4 from IE63 of VZV + A T cell epitope comprising the amino acid sequence shown in SEQ ID NO: 3;

[0013] (d) Activatable CD8 from ORF9 of VZV + A T cell epitope comprising the amino acid sequence shown in SEQ ID NO:4;

[0014] (e) Activatable CD8 from ORF29 of VZV + The T cell epitope comprises the amino acid sequence shown in SEQ ID NO:5.

[0015] In some embodiments, the chimeric epitope comprises a portion operably linked in any of the following forms:

[0016] (CD4 + T)ORF9-IE62-IE63-(CD8+ T)ORF9-ORF29;

[0017] (CD4 + T)ORF9-IE63-IE62-(CD8 + T)ORF9-ORF29;

[0018] IE62-(CD4 + T)ORF9-IE63-(CD8 + T)ORF9-ORF29;

[0019] IE62-IE63-(CD4 + T)ORF9-(CD8 + T)ORF9-ORF29;

[0020] IE63-(CD4 + T)ORF9-IE62-(CD8 + T)ORF9-ORF29;

[0021] IE63-IE62-(CD4 + T)ORF9-(CD8 + T)ORF9-ORF29;

[0022] (CD4 + T)ORF9-IE62-IE63-ORF29-(CD8 + T)ORF9;

[0023] (CD4 + T)ORF9-IE63-IE62-ORF29-(CD8 + T)ORF9;

[0024] IE62-(CD4 + T)ORF9-IE63-ORF29-(CD8 + T)ORF9;

[0025] IE62-IE63-(CD4 + T)ORF9-ORF29-(CD8 + T)ORF9;

[0026] IE63-(CD4 + T)ORF9-IE62-ORF29-(CD8 + T)ORF9;

[0027] IE63-IE62-(CD4 + T)ORF9-ORF29-(CD8+ T)ORF9.

[0028] In some embodiments, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO: 1-5 in sequence, preferably, the chimeric epitope comprises the amino acid sequence shown in any one of SEQ ID NO: 6-17, and more preferably, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO: 6.

[0029] In some embodiments, the chimeric epitope comprises a portion operably linked in any of the following forms:

[0030] (CD4 + T)ORF9-IE62-IE63;

[0031] (CD4 + T)ORF9-IE63-IE62;

[0032] IE62-(CD4 + T)ORF9-IE63;

[0033] IE62-IE63-(CD4 + T)ORF9;

[0034] IE63-(CD4 + T)ORF9-IE62;

[0035] IE63-IE62-(CD4 + T)ORF9.

[0036] In some embodiments, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO: 1-3 in sequence, preferably, the chimeric epitope comprises the amino acid sequence shown in any one of SEQ ID NO: 18-23, and more preferably, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO: 18.

[0037] In some embodiments, the chimeric epitope comprises a portion operably linked in any of the following forms:

[0038] (CD8 + T) ORF9+ORF29;

[0039] ORF29+(CD8 + T)ORF9.

[0040] In some embodiments, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO:4-5 in sequence, preferably, the chimeric epitope comprises the amino acid sequence shown in any one of SEQ ID NO:24-25, and more preferably, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO:24.

[0041] In some embodiments, the gE protein comprises:

[0042] (a) the amino acid sequence shown in SEQ ID NO: 26;

[0043] (b) A tag such as a His tag is connected to the N-terminus or / and the C-terminus of the amino acid sequence of (a);

[0044] (c) an amino acid sequence of a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in any of (a) and (b);

[0045] (d) an amino acid sequence that is at least 95% (e.g., at least 96%, 97%, 98% or 99%) identical to the amino acid sequence shown in any one of (a) and (b).

[0046] In some embodiments, wherein from N-terminus to C-terminus, the fusion protein comprises portions operably linked in any of the following ways:

[0047] gE-Fc, Fc-gE, gE-chimeric epitope-Fc, chimeric epitope-gE-Fc, chimeric epitope-Fc-gE or gE-Fc-chimeric epitope, the fusion protein may be in the form of a dimer.

[0048] In some embodiments, wherein:

[0049] The gE protein comprises the amino acid sequence shown in SEQ ID NO: 26; and

[0050] The chimeric epitope comprises, in order:

[0051] (a) the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence shown in SEQ ID NO: 3, the amino acid sequence shown in SEQ ID NO: 4, and the amino acid sequence shown in SEQ ID NO: 5;

[0052] (b) the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence shown in SEQ ID NO: 2, and the amino acid sequence shown in SEQ ID NO: 3; or

[0053] (c) the amino acid sequence shown in SEQ ID NO:4 and the amino acid sequence shown in SEQ ID NO:5.

[0054] In some embodiments, the various epitopes of the chimeric epitope, between the gE protein and the chimeric epitope, or between the gE protein and Fc, or between the chimeric epitope and Fc are directly connected or connected via a linker sequence, and the linker sequence is selected from SGS, SGG, GGGGS, EAAAK, AAY, GPGPG, KK and RVRR, preferably, the linker sequence is AAY, GPGPG or EAAAK.

[0055] In some embodiments, the Fc region is a human IgG1, IgG2, IgG3, or IgG4 Fc region or a variant thereof.

[0056] In some embodiments, the Fc region comprises:

[0057] (a) the amino acid sequence shown in SEQ ID NO: 27; or

[0058] (b) an amino acid sequence that is at least 98% identical to the amino acid sequence shown in SEQ ID NO: 27;

[0059] (c) A tag such as a His tag is connected to the N-terminus or / and the C-terminus of the amino acid sequence of (a) or (b); or

[0060] (d) An amino acid sequence of a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in any of (a), (b) and (c).

[0061] In some aspects, the present invention provides a composition comprising a fusion protein disclosed herein and a pharmaceutically acceptable carrier and / or adjuvant.

[0062] In some embodiments, the adjuvant comprises MF59 adjuvant and CpG ODN adjuvant.

[0063] In some embodiments, the CpG ODN adjuvant is a CpG 1009 adjuvant, for example, the CpG1009 adjuvant has a nucleic acid sequence as shown in SEQ ID NO: 28; preferably, the phosphate backbones in the nucleic acid sequence as shown in SEQ ID NO: 28 are all thio-modified.

[0064] In some embodiments, wherein in a unit dose:

[0065] The content of the fusion protein is between 5 and 100 μg, preferably between 50 and 100 μg;

[0066] The content of the CpG1009 adjuvant is between 20 and 3000 μg.

[0067] In some embodiments, the ratio between the total volume of the fusion protein antigen plus the CpG1009 adjuvant and the volume of the MF59 adjuvant is 1:1.

[0068] In some embodiments, the composition is a vaccine composition, more specifically a shingles vaccine composition.

[0069] In some aspects, the invention provides nucleic acid molecules encoding the fusion proteins disclosed herein.

[0070] In some aspects, the invention provides vectors, such as baculovirus vectors, comprising the nucleic acid molecules disclosed herein.

[0071] In some aspects, the invention provides a host cell comprising a nucleic acid molecule disclosed herein or a vector comprising the nucleic acid molecule, optionally the host cell is an insect cell.

[0072] In some aspects, the present invention provides a method for preparing the fusion protein disclosed herein, comprising the following steps:

[0073] - culturing the host cell transfected with the vector disclosed herein under appropriate conditions;

[0074] - isolating the fusion protein from the supernatant of the host cell;

[0075] In some aspects, the present invention provides a method for preparing a herpes zoster vaccine, comprising the step of mixing the fusion protein disclosed herein with an adjuvant, optionally wherein the adjuvant comprises MF59 and CpG1009.

[0076] In some aspects, the present invention provides a use of the fusion protein disclosed herein or a nucleic acid molecule encoding the fusion protein in the preparation of a vaccine composition for preventing or reducing varicella-zoster virus infection in a subject.

[0077] In some aspects, the present invention provides a use of the fusion protein disclosed herein or a nucleic acid molecule encoding the fusion protein in the preparation of a medicament for preventing or alleviating a disease or condition associated with varicella-zoster virus in a subject.

[0078] In some embodiments, the subject is a human or non-human animal, preferably a human.

[0079] In some embodiments, the disease associated with the varicella-zoster virus is selected from the group consisting of chickenpox, herpes zoster, and postherpetic neuralgia.

[0080] In some aspects, the present invention provides use of the fusion protein disclosed herein in the preparation of a medicament for inducing a body to produce humoral immunity and / or cellular immunity against herpes zoster virus.

[0081] In some aspects, the present invention provides the use of the fusion protein disclosed herein in producing antibodies against herpes zoster virus. The antibody can be a polyclonal antibody, a monoclonal antibody or a recombinant antibody.

[0082] In some aspects, the present invention provides a combination of MF59 adjuvant and CpG1009 adjuvant for use in preparing a vaccine composition for preventing or alleviating varicella-zoster virus infection in a subject. The combination of MF59 adjuvant and CpG1009 adjuvant can be used to improve the immunogenicity of antigens in herpes zoster vaccine compositions. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] Figure 1 The arrangement of the internal elements of epitope 1, epitope 2, and epitope 3 are exemplified.

[0084] Figure 2 The SDS-PAGE detection results of antigen gE-Fc, gE-epitope 1-Fc, gE-epitope 2-Fc, epitope 1-gE-Fc, epitope 2-gE-Fc, and epitope 3-gE-Fc are shown, and Mark is a reference for molecular weight.

[0085] Figure 3 Shown are the results of humoral immunity detection in C57BL / 6 mice 14 days after the second immunization.

[0086] Figure 4 The cellular immunity (CD4 + T cell) test results; "*" indicates cytokine positive CD4 + The number of T cells increased by 30% to 100%, "**" indicates an increase of 1 to 2 times, and "***" indicates an increase of more than 2 times.

[0087] Figure 5 The cellular immunity (CD8 + T cell) test results; "*" indicates cytokine positive CD8 + The number of T cells increased by 30% to 100%, "**" indicates an increase of 1 to 2 times, and "***" indicates an increase of more than 2 times. DETAILED DESCRIPTION

[0088] In the present invention, unless otherwise stated, all scientific and technical terms used herein have the same meaning as those generally understood by those skilled in the art. All patents, patent applications and other publications cited herein are incorporated by reference in their entirety. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. If the definition proposed herein conflicts with the definition proposed in the patents, patent applications and other publications incorporated herein by reference, the definition proposed herein shall prevail.

[0089] Unless the context requires otherwise, terms in the singular shall include the plural, and terms in the plural shall include the singular. More specifically, as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to "a protein" includes multiple proteins; reference to "a cell" includes mixtures of cells, etc. In this application, the use of "or" means "and / or" unless otherwise stated. In addition, the use of the term "comprising" and other forms (such as "including" and "containing") is not restrictive. In addition, the ranges provided in the specification and the appended claims include endpoints and all values ​​between the endpoints.

[0090] As used herein, the term "vector" refers to a nucleic acid vector into which a polynucleotide can be inserted. When a vector allows a polynucleotide sequence inserted therein to express a protein, the vector is called an expression vector. The vector can express the genetic material elements carried in a host cell by transformation, transduction or transfection into the host cell. Vectors are well known to those skilled in the art, including but not limited to plasmids, bacteriophages, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC); bacteriophages such as lambda phages or M13 phages and animal viruses. Animal viruses that can be used as vectors include but are not limited to retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, papovaviruses (such as SV40). The vector may contain multiple elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may contain an origin of replication.

[0091] "Percent (%) amino acid sequence identity" relative to a reference polypeptide sequence is defined as the percentage of the amino acid residues in the candidate sequence and the identical amino acid residues in the reference polypeptide sequence after the sequences are aligned (and gaps are introduced if necessary) to obtain the maximum percentage sequence identity, and any conservative substitutions are not considered as part of the sequence identity. Sequence alignments can be performed using various methods in the art to determine the percentage amino acid sequence identity, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or DNASTAR software. Those skilled in the art can determine the appropriate parameters for measuring the alignment, including any algorithm required to obtain the maximum alignment for the full length of the compared sequences. When the percentage of sequence identity is mentioned in this application, if not otherwise specifically stated, these percentages are calculated relative to the full length of the longer sequence. Calculations relative to the full length of the longer sequence are applicable to both nucleic acid sequences and polypeptide sequences.

[0092] As used herein, the term "Fc" has the same meaning as used with respect to antibodies, and refers to the following portion of an antibody, which includes the second (CH2) and third (CH3) constant regions of the first heavy chain that are bound to the second and third constant regions of the second heavy chain via a disulfide bond. The Fc region may also include part or all of the hinge region. The Fc region of an antibody is responsible for various effector functions such as ADCC, ADCP, and CDC, but does not have antigen binding function. In this article, the term "Fc" includes wild-type Fc and Fc variants, with different mutations for a variety of purposes. The variant may include one or more amino acid residue modifications, such as substitutions, in the Fc region.

[0093] As used herein, the term "operably linked" (or represented by "-") refers to the juxtaposition of two or more biological sequences of interest (with or without a spacer or linker or intervening sequence) so that they are in a relationship that allows them to function in the intended manner. When used in relation to polypeptides, it refers to the connection of polypeptide sequences in a manner that allows the connected product to have the intended biological function. The operably linked can be a direct connection between the two parts, or a connection through a linker such as a peptide linker.

[0094] The term "vector" as used herein refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. Some vectors are capable of directing the expression of a nucleic acid to which they are operably linked.

[0095] As used herein, the terms "CpG oligodeoxyribonucleotide", "CpG ODN" and "CpG immunostimulatory nucleic acid" are used interchangeably and refer to oligonucleotides containing at least one unmethylated cytosine-guanine dinucleotide motif. CpG oligodeoxyribonucleotides include multiple classes of CpG ODN, such as class A, class B, class C or class P CpG ODN, such as Bode et al., 2011, Expert Rev Vaccines, 10(4): described in 499-511.

[0096] As used herein, the terms "subject" and "patient" are used interchangeably and refer to any living organism, including humans and animals.

[0097] As used herein, the term "fusion protein" refers to a polypeptide having two (or more) parts operably linked together, wherein each part is a polypeptide having different properties. The two parts can be directly linked by a single peptide bond, or connected by a peptide linker containing one or more amino acid residues. In some embodiments, the fusion protein is a fusion protein of a VZV-gE protein, an Fc region, and an antigenic epitope having a cellular immune activation effect. In some embodiments, the fusion protein is a fusion protein of a VZV-gE protein and an Fc region.

[0098] Varicella-zoster virus (VZV) and gE antigen

[0099] Varicella-zoster virus belongs to the genus Herpesvirus, family Herpesviridae A. The VZV genome has 71 genes encoding 67 different proteins, including 6 glycoproteins (gpⅠ~gpⅥ), which are now uniformly named gE, gB, gH, gI, gC and gL. Among them, gE is the most abundant in the viral envelope and is the most important glycoprotein recognized by the host immune system. It is encoded by the ORF68 gene and is located in the short fragment region of the VZV genome. The natural gE protein (such as NCBI ID Q9J3M8.1, AQT34120.1, AGY33616.1, AEW88548.1) is usually 623 amino acids in length and consists of a hydrophobic transmembrane region, an intracellular region, and an extracellular region. The extracellular region contains 537 amino acids, including a signal peptide region of 30 amino acids at the N-terminus. The antigenic epitopes of gE protein are mainly distributed in the extracellular region. The studies of Vafai et al. and Forghani et al. showed that gE protein contains at least 3 different antigenic epitopes, located at amino acid positions 109-123, 160-316, and 101-161, respectively.

[0100] The natural gE protein can be subjected to a variety of truncations or modifications to prepare the gE antigen for the vaccine. In some embodiments, the gE protein contained in the fusion protein is a natural gE protein (1-623) or a fragment thereof. In some embodiments, the gE protein is a truncated gE protein, for example, truncated at the N or C terminus, for example, 10, 20, 30, 40, 50, 60, 70 or more amino acids are truncated from the N terminus and / or the C terminus. The truncated gE protein preferably truncates the signal peptide (1-30) at the N terminus. In some embodiments, the truncated gE protein is the extracellular region of the natural gE protein, preferably truncates the signal peptide (1-30) at the N terminus. In some embodiments, the truncated gE protein comprises amino acids 31-546 of the natural gE protein (as shown in SEQ ID NO:26).

[0101] Chimeric epitopes with cellular immune activation

[0102] There are also multiple genes encoding functional proteins in the VZV genome, and the encoded proteins are potentially immunogenic. Studies have found that 10 ORFs in the VZV genome (i.e., gB, gE, immediate early (IE) 61, IE62, IE63, ORF4, ORF9, ORF10, ORF19 and ORF29 proteins) can induce VZV-specific T cell-mediated responses. In addition, studies have shown that a variety of cell-mediated immune responses to viral proteins will be produced in the human body after natural infection with VZV, and the immune response has specificity for specific viral proteins, and the protein has multiple epitopes that can be recognized by T cells. The antigenic epitope of the protein can be any antigenic epitope of the protein disclosed in the prior art that has an immune activation effect. The present invention therefore provides a chimeric epitope comprising epitopes derived from at least two, at least three, at least four, at least five or more proteins selected from IE61, IE62, IE63, ORF4, ORF9, ORF10, ORF19 and ORF29 proteins. The chimeric epitope may also comprise epitopes derived from proteins that can activate CD8 + CD8 + The epitopes of antigens recognized by T cells and derived from those that can activate CD4 + CD4 + The epitope of the antigen recognized by T cells. Because some proteins, such as ORF9 protein, also contain + T cells and CD8 + T cell activation epitopes, so according to the needs of activation, different epitopes on the protein can be selected for the construction of chimeric epitopes. Other proteins, such as IE62 and IE63, only involve CD4 +T cell activation, while ORF29 is only involved in CD8 + T cell activation.

[0103] As used herein, "CD4 + T ORF9" or "ORF9(CD4 + T)" refers to the ability to activate CD4 + T cells and can be + The antigen epitope from the ORF9 protein recognized by T cells, "CD8 + T ORF9" or "ORF9(CD8 + T)” refers to the ability to activate CD8 + T cells and can be + Antigenic epitopes from the ORF9 protein recognized by T cells.

[0104] In some embodiments, the chimeric epitope comprises one or more (e.g., 2, 3, 4, or all 5) selected from the following:

[0105] (a) Activatable CD4 derived from ORF9 + T cell epitope, namely ORF9 (CD4 + T), for example, as shown in SEQ ID NO: 1;

[0106] (b) Activatable CD4 derived from IE62 + T cell epitope, IE62 (CD4 + T), for example, as shown in SEQ ID NO: 2;

[0107] (c) Activatable CD4 from IE63 + T cell epitope, IE63 (CD4 + T), for example, as shown in SEQ ID NO: 3;

[0108] (d) Activatable CD8 derived from ORF9 + T cell epitope, namely ORF9 (CD8 + T), for example, as shown in SEQ ID NO: 4;

[0109] (e) Activatable CD8 derived from ORF29 + T cell epitope, namely ORF29 (CD8 + T), for example, as shown in SEQ ID NO:5.

[0110] In some embodiments, the chimeric epitope comprises all five epitopes (a)-(e) for simultaneously activating CD4 + T cells and CD8 +T cells, and can be connected in any manner. This type of chimeric epitope is also referred to herein as "epitope 1". The five epitopes contained therein may have amino acid sequences shown in SEQ ID NOs: 1-5, respectively. Epitope 1 may have an amino acid sequence as shown in any one of SEQ ID NOs: 6-17. Specifically, the chimeric epitope may include a combination of epitopes connected in any of the following ways:

[0111] (CD4 + T)ORF9-IE62-IE63-(CD8 + T)ORF9-ORF29;

[0112] (CD4 + T)ORF9-IE63-IE62-(CD8 + T)ORF9-ORF29;

[0113] IE62-(CD4 + T)ORF9-IE63-(CD8 + T)ORF9-ORF29;

[0114] IE62-IE63-(CD4 + T)ORF9-(CD8 + T)ORF9-ORF29;

[0115] IE63-(CD4 + T)ORF9-IE62-(CD8 + T)ORF9-ORF29;

[0116] IE63-IE62-(CD4 + T)ORF9-(CD8 + T)ORF9-ORF29;

[0117] (CD4 + T)ORF9-IE62-IE63-ORF29-(CD8 + T)ORF9;

[0118] (CD4 + T)ORF9-IE63-IE62-ORF29-(CD8 + T)ORF9;

[0119] IE62-(CD4 + T)ORF9-IE63-ORF29-(CD8 + T)ORF9;

[0120] IE62-IE63-(CD4 +T)ORF9-ORF29-(CD8 + T)ORF9;

[0121] IE63-(CD4 + T)ORF9-IE62-ORF29-(CD8 + T)ORF9;

[0122] IE63-IE62-(CD4 + T)ORF9-ORF29-(CD8 + T)ORF9;

[0123] Among them, IE63 represents an epitope derived from IE63 protein; IE62 represents an epitope derived from IE62 protein; ORF29 represents an epitope derived from ORF29 protein; (CD4 + T) ORF9 represents the protein derived from ORF9 and can activate CD4 + T cell epitope; (CD8 + T) ORF9 represents the protein derived from ORF9 and can activate CD8 + T cell epitopes.

[0124] In some embodiments, the chimeric epitope comprises three epitopes (a)-(c) for activating CD4 + T cells, and can be connected in any manner. This type of chimeric epitope is also referred to herein as "epitope 2". The three epitopes contained therein can have the amino acid sequences shown in SEQ ID NOs: 1-3 respectively. Epitope 2 can have the amino acid sequence shown in any one of SEQ ID NOs: 18-23. Specifically, the chimeric epitope can include a combination of epitopes connected in any of the following ways:

[0125] (CD4 + T)ORF9-IE62-IE63;

[0126] (CD4 + T)ORF9-IE63-IE62;

[0127] IE62-(CD4 + T)ORF9-IE63;

[0128] IE62-IE63-(CD4 + T)ORF9;

[0129] IE63-(CD4 + T)ORF9-IE62;

[0130] IE63-IE62-(CD4 + T)ORF9;

[0131] In some embodiments, the chimeric epitope comprises two epitopes of (d)-(e) for activating CD8 + T cells, and can be connected in any manner. This type of chimeric epitope is also referred to herein as "epitope 3". The two epitopes contained therein can have the amino acid sequences shown in SEQ ID NO:4-5 respectively. Epitope 3 can have the amino acid sequence shown in any one of SEQ ID NO:24-25. Specifically, the chimeric epitope can include a combination of epitopes connected in any of the following ways:

[0132] (CD8 + T) ORF9+ORF29;

[0133] ORF29+(CD8 + T)ORF9.

[0134] In the chimeric epitope, various epitopes can be directly connected or operably connected through a linker. The linker can be a flexible or non-flexible linker conventionally used in the art, or a linker for epitope connection. In some embodiments, the linker is a peptide linker having any of the following sequences: SGS, SGG, GGGGS, EAAAK, AAY, GPGPG, KK and RVRR, preferably, the linker sequence is AAY, GPGPG or EAAAK.

[0135] In a specific embodiment, the chimeric epitope is ORF9 (CD4 + T)-IE62-IE63-OR F9(CD8 + T)-ORF29 (belonging to epitope 1). In a more specific embodiment, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO:6. More specifically, the chimeric epitope comprises, in sequence: ORF9 (CD4 + T) epitope, IE62 epitope shown in SEQ ID NO: 2, IE63 epitope shown in SEQ ID NO: 3, ORF9 (CD8 + T) epitope, and the ORF29 epitope shown in SEQ ID NO:5.

[0136] In a specific embodiment, the chimeric epitope is ORF9 (CD4 + T)-IE62-IE63 (belonging to epitope 2). In a more specific embodiment, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO: 18. More specifically, the chimeric epitope comprises, in sequence: ORF9 (CD4 +T) epitope, the IE62 epitope shown in SEQ ID NO: 2, and the IE63 epitope shown in SEQ ID NO: 3.

[0137] In a specific embodiment, the chimeric epitope is ORF9 (CD8 + T)-ORF29 (belonging to epitope 3). In a more specific embodiment, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO:24. More specifically, the chimeric epitope comprises, in sequence: ORF9 (CD8 + T) epitope and the ORF29 epitope shown in SEQ ID NO:5.

[0138] The fusion protein of the present invention

[0139] In some aspects, the present invention provides a fusion protein comprising the VZV-gE protein disclosed herein and an Fc region, and a fusion protein comprising a VZV-gE protein, a chimeric epitope and an Fc region. The inventors surprisingly found that when a fusion protein of a VZV-gE protein, an Fc region and a chimeric epitope having a cellular immune activation effect is used as an antigen, it has an enhanced cellular immune activation effect.

[0140] Specifically, from N to C terminus, the fusion protein may comprise a portion operably linked in any of the following ways: gE-Fc, Fc-gE, gE-chimeric epitope-Fc, chimeric epitope-gE-Fc, chimeric epitope-Fc-gE, gE-Fc-chimeric epitope. The chimeric epitope may be any chimeric epitope as disclosed herein, such as epitope 1, epitope 2 or epitope 3 as shown in Table A.

[0141] Table A

[0142]

[0143]

[0144] In some specific embodiments, the fusion protein is in the form of gE-Fc or Fc-gE from N-terminus to C-terminus, wherein the gE portion has the amino acid sequence shown in SEQ ID NO:26.

[0145] In some specific embodiments, the fusion protein is in the form of gE-chimeric epitope-Fc, chimeric epitope-gE-Fc, chimeric epitope-Fc-gE or gE-Fc-chimeric epitope from N-terminus to C-terminus, wherein the gE portion has the amino acid sequence shown in SEQ ID NO: 26, and the chimeric epitope is any one of the chimeric epitopes shown in Table A. For example, the chimeric epitope may comprise the amino acid sequence shown in SEQ ID NO: 6, 18 or 24.

[0146] Fc part

[0147] The present invention provides a fusion protein comprising an Fc region. The Fc region in the fusion protein can provide new properties and functions, such as extending the half-life of the fusion protein in plasma, enhancing antigen stability, and improving antigen presentation efficiency and expression. In addition, the Fc region of the fusion protein can bind to different Fc receptors, including FcγRI (CD64), FcγRI (CD32), FcγRIII (CD16), FcεRI, FcεRI and FcRn, thereby mediating different biological functions, such as inflammatory response, antibody-dependent cellular cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP) and complement-dependent cytotoxicity (CDC), regulating cytokine secretion, etc. In addition, the fusion protein comprising Fc can also be used as a new vaccine form, fusing part of the antigenic peptide of the pathogen with the IgG Fc region to induce the body to produce an antigen-specific immune response.

[0148] The Fc region that can be used for the fusion protein of the present invention includes, for example, the Fc region of human IgG, IgM, IgA, IgE and IgD, preferably the Fc region of human IgG. In some embodiments, the Fc region of the fusion protein of the present invention can be selected from the Fc region of human IgG1, IgG2, IgG3 and IgG4 and variants thereof, for example the Fc region of human IgG1 and variants thereof.

[0149] In some embodiments, the Fc in the fusion protein comprises or consists of an amino acid sequence that is at least 85%, at least 90%, or at least 99% identical to SEQ ID NO:27.

[0150] Preparation of vaccine compositions

[0151] In some aspects, the present invention provides a vaccine composition comprising any fusion protein disclosed herein. The fusion protein may comprise a gE protein and an Fc region, and optionally a chimeric epitope having a cellular immune activation effect.

[0152] Preferably, the fusion protein antigen is combined with a specific adjuvant to prepare a vaccine composition. The vaccine composition can be in the form of an aqueous solution, oil-in-water, water-in-oil, liposomes, etc. A good adjuvant can promote the stimulation of sufficient cellular immunity and humoral immune response in the body to achieve a protective effect. The adjuvants currently approved for use can be roughly divided into two types: one is an adjuvant that stimulates immune response, which enhances the immunogenicity of the antigen by connecting to receptors on innate immune cells, such as CpG oligodeoxyribonucleotides (CpG ODN); the other is an adjuvant that cooperates with vaccine delivery to present the necessary amount of vaccine antigens and immunostimulants to the immune system to induce immunity, such as aluminum adjuvants and emulsions.

[0153] The vaccine composition of the present invention can be prepared by mixing the fusion protein disclosed herein with various adjuvants known in the art in a certain proportion. The adjuvants include, but are not limited to, TLR (Toll-like receptor) agonists, NOD agonists, CLR (C-type lectin receptor) agonists, RLR agonists, aluminum adjuvants (e.g., aluminum hydroxide, aluminum phosphate), squalene-containing oil-in-water emulsions (e.g., MF59), AS adjuvant systems (e.g., AS01, AS03, AS04), saponin adjuvants, α-galactosylceramide-derived adjuvants, and polysaccharide adjuvants.

[0154] In some embodiments, the adjuvant comprises an agonist adjuvant, such as a TLR agonist adjuvant such as CpG ODN. As an agonist of Toll-like receptor 9 (TLR9), CpG ODN can stimulate cells expressing TLR9 and activate downstream innate immune response pathways, on the one hand inducing the expression of type I and type III interferons in plasmacytoid dendritic cells, and on the other hand activating B cells to promote the secretion of inflammatory factors, thereby enhancing humoral immunity and cellular immune responses. It can be taken up by endosomes, causing increased secretion of interferon, and effectively activating antigen-specific T cells by promoting cross-presentation of antigens. In some embodiments, the CpG ODN is CpG1009, which has the nucleotide sequence of SEQ ID NO: 28. More specifically, the nucleotides in the nucleotide sequence are fully thiolated.

[0155] MF59 or MF59 analogs are one of the earliest clinical adjuvants approved for use. They are a water-oil emulsion adjuvant, mainly composed of squalene, Tween-80 and Span85. Its water-in-oil design significantly reduces viscosity and enhances human tolerance. Squalene is an oil phase component, widely distributed in animals, plants and the human body, and has the characteristics of biocompatibility and degradability. Tween-80 and Span85 are surfactants that enhance the stability of the emulsion. MF59 is an ideal adjuvant for viral vaccines. When used in combination with influenza, HIV and other vaccines, it can significantly enhance antibody titers and has good tolerance in different populations. It can promote antigen uptake, recruit a large number of immune cells into the injection site, and recruit monocytes and neutrophils to present antigens and transport them into lymph nodes. When used in combination with CpG, it induces higher antibody titers and Th1-type responses than adjuvants alone.

[0156] In one aspect, the present invention provides a combination of MF59 and CpG ODN (especially CpG1009) for preparing a herpes virus vaccine composition. The inventors have found that when MF59 and CpG ODN (especially CpG1009) are used in combination, the immunogenicity of the antigen can be significantly improved, and a good synergistic effect can be achieved. The adjuvant of MF59 and CpG1009 combined with the fusion protein herein can synergistically induce an antigen-specific cellular immune response, and the resulting vaccine composition has a strong ability to induce specific humoral immunity and cellular immune response.

[0157] Polynucleotides, vectors and host cells

[0158] In some aspects, the present invention also provides polynucleotides encoding the fusion proteins disclosed herein. The polynucleotides can be used to express the fusion proteins. The polynucleotides encoding the fusion proteins are easy to separate and sequence using conventional procedures known in the art. The polynucleotides can also be obtained by synthetic methods. Preferably, the polynucleotides are codon optimized for expression in eukaryotic host cells, such as insect cells and mammalian cells.

[0159] Using known recombinant techniques, the polynucleotide encoding the fusion protein can be inserted into a vector for further cloning (amplification of the DNA) or expression. The vector components typically include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter (e.g., SV40, CMV, EF-1α), and a transcription termination sequence.

[0160] In some embodiments, the present invention provides a vector (e.g., an expression vector) comprising a polynucleotide encoding a fusion protein provided herein, at least one promoter (e.g., SV40, CMV, EF-1α) operably linked to the polynucleotide, and at least one selection marker. Examples of vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papovaviruses (e.g., SV40), λ phages, and M13 phages, liposomes, plasmids pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, pBAD, pcDNA, pCal, pL, pET, pGEM EX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS10, pLexA, pACT2.2, pCMV-SCRIPT.RTM, pCDM8, pCDNA1.1 / amp, pcDNA3.1, pRc / RSV, PCR 2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos, etc.

[0161] The vector comprising the polynucleotide sequence encoding the fusion protein can be imported into a host cell for cloning or gene expression. Suitable host cells for cloning or expressing DNA in the vector herein can be prokaryotes, yeast or higher eukaryotic cells. Suitable prokaryotes for this purpose include true bacteria, such as gram-negative or gram-positive bacteria, such as Escherichia coli. In addition to prokaryotes, eukaryotic microorganisms such as filamentous fungi or yeast are suitable clones or expression hosts for the vector provided. Saccharomyces cerevisiae or common baker's yeast are the most commonly used in lower eukaryotic host microorganisms. Suitable host cells for expressing the fusion protein provided herein can also be derived from multicellular organisms. The example of invertebrate cells includes plant and insect cells. In some embodiments, the host cell is a Chinese hamster ovary (CHO) cell. In some other embodiments, the host cell is other mammalian cell lines, such as human cell lines.

[0162] The fusion protein of the present invention can be obtained by the baculovirus expression vector system (BEVS). BEVS is an expression system that uses insect baculovirus as a foreign gene vector and insects and insect cells as receptors. The patterns and capabilities of translation and post-translational protein modification of insect cells and mammals are similar, including glycosylation, phosphorylation, acylation, signal peptide excision, and peptide cleavage and decomposition. The resulting recombinant protein has similar biological activities such as antigenicity, immunogenicity, and function as natural proteins; it can accommodate large molecular inserts; and it is easy to achieve large-scale low-cost production. Currently commonly used BEVS include, for example, the Bac-to-Bac system, the BaculoDirect system, the BacPAK6 and BaculoGOLD systems, the FlashBAC system, and the like. The above BEVS can all be used to express the fusion protein of the present invention.

[0163] In some embodiments, the fusion protein of the present invention is expressed by the Bac-to-Bac system, which mainly includes the following steps: cloning the target gene into the pFastBac vector; transforming the above plasmid into a bacterial strain (e.g., a DH10Bac strain) to prepare a recombinant baculovirus shuttle plasmid (Bacmid); transforming the recombinant Bacmid into insect cells to prepare a recombinant baculovirus; amplifying the baculovirus, infecting insect cells, and expressing the recombinant protein. Examples of pFastBac vectors include, but are not limited to, pFastBac1, pFastBac Dual, pFastBac HT A, pFastBac HT B, and pFastBac HT C vectors. In some embodiments, the pFastBac vector is a pFastBac1 vector. Examples of insect cells include, but are not limited to, Sf9, Sf21, and High Five (HF) cells. In some embodiments, the insect cell is an Sf9 cell. In some embodiments, the insect cell is an Sf9 cell. In some embodiments, the insect cell is an Sf9 and HF cell, wherein Sf9 is used to amplify the baculovirus, and then the HF cell is infected with the obtained baculovirus to express the recombinant protein.

[0164] Host cells are transformed with the above-described expression or cloning vectors for production of fusion proteins and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants or amplifying genes encoding the desired sequences.

[0165] When a recombinant expression vector encoding a target protein is introduced into a host cell, the target protein is produced by culturing the host cell for a period of time to allow the target protein to be expressed in the host cell or secreted into the culture medium in which the host cell is cultured. The target protein can be recovered from the culture medium using standard protein purification methods.

[0166] Diseases or symptoms caused by herpes zoster infection

[0167] Herpes zoster is caused by reactivation of the varicella-zoster virus (VZV) during primary varicella infection and is characterized by skin pain and papules. The pain usually appears a few days before the rash and can last for months after the rash subsides. The rash often appears in a single skin area and usually subsides within 4-5 weeks. Common complications include postherpetic neuralgia (PHN) and VZV pneumonia.

[0168] Age-related loss of functional VZV-specific T cell-mediated immunity in the elderly coincides with an increased incidence of HZ. VZV-specific T cell-mediated immunity is also critical for optimal recovery from herpes zoster (HZ). The magnitude of the VZV-specific T cell-mediated immune response during the first week after the onset of the HZ rash is inversely correlated with HZ disease severity and the risk of developing postherpetic neuralgia.

[0169] In one aspect, the present invention provides use of a vaccine composition in the preparation of a medicament for preventing or ameliorating herpes zoster and / or herpes zoster sequelae.

[0170] The present invention has the following beneficial effects:

[0171] 1. The present invention fuses the antigen epitope with cellular immune activation effect with VZV-gE protein and human IgG1Fc, thereby enhancing the cellular immune activation effect of the antigen. + / CD8 + Both T cell immunity and humoral immunity have reached high efficiency standards, improving the competitiveness of vaccine products in terms of safety and effectiveness.

[0172] 2. The recombinant gE fusion protein expressed by the insect-baculovirus platform in the present invention is a glycosylated protein, which maintains the spatial structure of the natural gE protein and has good immunogenicity;

[0173] 3. The present invention provides a preparation method and application of a shingles vaccine. The adjuvant system used in conjunction with the vaccine has also been innovated accordingly. MF59 and CpG1009 are used as adjuvants at the same time to improve the humoral immunity and cellular immunity of the antigen. CpG1009 adjuvant and the three new CpGs approved by CDE are all type B innovative CpG adjuvants, which are better than the three commercialized CPG adjuvants, and their safety and effectiveness are better than QS21 adjuvant.

[0174] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0175] Example

[0176] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0177] Example 1: Preparation of gE fusion protein

[0178] 1. Construction of gE fusion protein plasmid

[0179] The gene fragments gE fragment and Fc fragment were synthesized by GenScript Biotech Co., Ltd., and the antigen epitopes with cellular immune activation effect (epitope 1, epitope 2, and epitope 3, respectively, are spliced ​​by multiple epitope sequences, for details, see Figure 1 ) was obtained by multiple rounds of PCR amplification (primers were synthesized by Qingke Biotechnology Co., Ltd.). The pFastBac1-syn21-GP67 empty vector (provided by GenScript Biotechnology Co., Ltd.) was double-digested with EcoR I and Kpn I to recover the large vector fragment. Then, the target fragment was connected to the vector fragment through multi-fragment homologous recombination technology to form a recombinant plasmid. Subsequently, the recombinant plasmid was transformed into Escherichia coli DH5a competent cells. The transformed bacteria were screened with LB solid medium containing ampicillin resistance and then expanded (37°C shaking culture overnight). After the cultivation was completed, the plasmid was extracted with an endotoxin-free plasmid mini-extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and after sequencing to verify that the sequence was correct, it was used for the next step of fusion protein expression.

[0180] The prepared fusion proteins are in the form of gE-Fc, gE-epitope 1-Fc, gE-epitope 2-Fc, epitope 1-gE-Fc, epitope 2-gE-Fc, and epitope 3-gE-Fc. The composition of epitope 1, epitope 2, and epitope 3 is as follows: Figure 1 The amino acid sequence of gE-Fc is shown in SEQ ID NO:29. The amino acid sequence of gE-epitope 1-Fc is shown in SEQ ID NO:30. The amino acid sequence of gE-epitope 2-Fc is shown in SEQ ID NO:31. The amino acid sequence of epitope 1-gE-Fc is shown in SEQ ID NO:32. The amino acid sequence of epitope 2-gE-Fc is shown in SEQ ID NO:33. The amino acid sequence of epitope 3-gE-Fc is shown in SEQ ID NO:34.

[0181] Table 1: Amino acid sequences of various parts of the fusion protein

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190] 2. Expression of Fusion Protein

[0191] 1) The above plasmids were transformed into DH10Bac competent cells respectively, and the white spots with successful recombination were selected after blue-white spot screening, and then shake culture was performed, and then the recombinant Bacmid was extracted using the Baculovirus Shuttle Vector Bacmid Small Quantity Extraction Kit (Biyuntian) and sequenced for verification;

[0192] 2) Select Sf9 cells in the logarithmic growth phase with a cell viability of >90% and dilute the viable cell concentration to 0.8×10 5 cells / mL, inoculated into 6-well plates, 2 mL per well, and cultured in a 27°C incubator for 5 to 6 hours; then take 5 μL of each plasmid and take 5 μL -Insect Transfection Reagent (Mirus) was added to 250 μL of fresh culture medium, mixed and allowed to stand at room temperature for 20 min, then 260 μL of the mixture was added to the adhered Sf9 cells, and allowed to stand in a 27°C incubator for 5-6 days, and the supernatant was harvested to obtain the P1 virus;

[0193] 3) Select Sf9 cells in the logarithmic growth phase (cell viability > 90%) and dilute the viable cell concentration to 0.8 × 10 5 After 100 cells / mL, inoculate into a T25 square flask (culture volume is 5 mL), incubate in a 27°C incubator for 5 to 8 hours, then add 1 mL of P1 virus, incubate in a 27°C incubator for 5 to 6 days, harvest the supernatant, and obtain P2 virus;

[0194] 4) Select Sf9 cells in the logarithmic growth phase (cell viability > 90%) and dilute the viable cell concentration to 2-3 × 10 6 After 100 cells / mL, inoculate into a 250mL shake flask (culture volume is 100mL), then add 1mL P2 generation virus, culture at 27°C, 120rpm for 5-6 days, harvest the supernatant to obtain P3 generation virus, and use the TCID50 method to detect the virus titer;

[0195] 5) Select HF cells in the logarithmic growth phase (cell viability > 90%) and dilute the viable cell concentration to 2-3 × 10 6 After 100 cells / mL, it was inoculated into a 2L shake flask (culture volume was 800mL), and then the P3 virus was inoculated at an MOI of 1.0, cultured at 27°C, 120rpm for 3d, and the supernatant was centrifuged for protein purification.

[0196] 3. Protein sample purification and preparation process

[0197] 3.1 Clarification process

[0198] 1) Remove solids by low-speed centrifugation and harvest cell supernatant: Fill the obtained cell culture fluid into 85% of the maximum capacity of the centrifuge bottle, then balance it, set the centrifuge parameters, centrifuge speed to 3000 rpm, centrifuge time to 20 min, centrifuge temperature to 4°C, harvest cell supernatant, take samples to determine expression level and purity, and weigh the mass of solids.

[0199] 2) High-speed centrifugation to remove trace impurities and harvest the cell supernatant: Fill the refrigerated cell supernatant into 85% of the maximum capacity of the centrifuge tube, then balance it and set the centrifuge parameters to 8000 rpm, 30 min, and 4°C. Harvest the cell supernatant and take samples to test the content, turbidity, purity, and endotoxin, calculate the recovery rate, and measure the pH and conductivity values.

[0200] 3.2 Affinity chromatography

[0201] 1) The affinity chromatography filler Protein A (Borglon (Zhejiang) Biotechnology Co., Ltd.) was loaded into the column, rinsed with disinfectant (150 mM phosphoric acid), and allowed to stand.

[0202] 2) Rinse with equilibration buffer (20mM phosphate buffer + 500mM sodium chloride pH 7.0±0.1). Then take the membrane solution to test endotoxin, the limit is less than 0.25EU / mL, and the sample can be loaded only if the test is qualified. If it is unqualified, it needs to be disinfected and equilibrated again.

[0203] 3) After confirming that the pH of the sample solution is 7.0±0.1 and the conductivity is less than 5mS / cm, load the sample and 280 Collect the flow-through.

[0204] 4) After loading, rinse with equilibration buffer (20 mM phosphate buffer + 500 mM sodium chloride pH 7.0 ± 0.1).

[0205] 5) Rinse with washing buffer (20 mM phosphate buffer, pH 4.5±0.1).

[0206] 6) Elute the target protein with elution buffer (20 mM phosphate buffer, pH 3.5±0.1).

[0207] 3.3 Refined process

[0208] 1) Anion exchange chromatography was performed using Capto Q ImpRes filler (Cytiva) in a bind-elute mode to effectively remove HCP, HCD, and some product analog impurities.

[0209] 2) Disinfect the loaded chromatography column with 0.5M NaOH, regenerate the chromatography column with 25mM PB, 2M NaCl, pH 7.20±0.05, and balance the chromatography column with 25mM PB, 100mM NaCl, pH 8.50±0.05 solution. Measure the sample conductivity before loading. If the conductivity is ≥13mS / cm, adjust the sample conductivity to 12±0.5mS / cm with 25mM PB, pH 8.50±0.05 solution, and then load the sample. After loading, first rinse three column volumes with 25mM PB, 100mM NaCl, pH 8.50±0.05 solution, and then elute with 25mM PB, 0.3M NaCl, pH 7.20±0.05 solution. Then, the chromatography column was regenerated with 25 mM PB, 2 M NaCl, pH 7.20 ± 0.05, and then disinfected again with 0.5 M NaOH and preserved with 20% ethanol; the eluted sample collected was used as the chromatography sample for the next step.

[0210] 3.4 Preparation of stock solution

[0211] The hollow fiber membrane column (Hangzhou Kebet Filter Equipment Co., Ltd.) is made of PES with a pore size of 30kD. First, rinse the membrane column with water for injection, then disinfect it with 0.5M NaOH, and then rinse the membrane column with water for injection until the pH is neutral. After the water flux test is completed, balance the membrane column with 25mM PB, 150mM NaCl, pH 7.20±0.05 solution. Then use the hollow fiber membrane column to concentrate to one-fourth, add the replacement solution 25mM PB, 130mM NaCl, pH 7.20±0.05 to the original volume, and cycle three times until the conductivity of the filtrate end is 17.0mS / cm, and the concentrated protein is about 1mg / mL. After the concentration is completed, rinse the system with water for injection, disinfect it with 0.5M NaOH, and then rinse the membrane column with water for injection. After the integrity test and water flux test are completed, use 0.01M NaOH to preserve the membrane column;

[0212] 3.5QC Testing

[0213] Use SDS-PAGE and SEC-HPLC to check sample size and purity. Detect HCD residue and endotoxin to ensure that they meet quality requirements. Figure 2 As shown, the sizes of the six fusion proteins were consistent with the antigen design.

[0214] Example 2: Vaccine immunogenicity study

[0215] 1. Vaccine Preparation

[0216] 1.1 CpG1009 adjuvant dilution

[0217] CpG1009 adjuvant (Nanjing Jisheng Aoma Biopharmaceutical Co., Ltd.) was diluted with sterile water to a 5 mg / mL stock solution for subsequent vaccine preparation.

[0218] The sequence of CpG1009 (SEQ ID NO:28): TCGACGTTCGTCGTTCGTCGTCGT, specifically T*C*G*A*C*G*T*T*C*G*T*C*G*T*T*C*G*T*C*G*T*C*G*T*C*G*T (Note: * indicates thio modification).

[0219] 1.2 MF59+CpG1009 adjuvant vaccine preparation

[0220] Under sterile conditions at room temperature, the purified antigens gE-Fc, gE-epitope 1-Fc, gE-epitope 2-Fc, epitope 1-gE-Fc, epitope 2-gE-Fc, and epitope 3-gE-Fc were diluted with a buffer (pH 7.5) containing 20mM Hepes, 300mM NaCl, and 50mM trehalose, and an appropriate amount of CpG1009 mother solution was added, and then mixed with MF59 adjuvant (from Chengdu Nano-Gold Biotechnology Co., Ltd., tested by Sichuan Institute of Drug Inspection, and the test results were qualified) suspension at a volume ratio of 1: 1. A vaccine with an antigen content of 50μg / mL and a CpG adjuvant content of 200μg / mL was prepared. The vaccines prepared above are named after the antigens they contain, for example, gE-Fc vaccine refers to a vaccine containing antigen gE-Fc (50 μg / mL) and MF59+CpG1009 adjuvant (CpG1009, 200 μg / mL).

[0221] 1.3 Experimental animal grouping and immunization: Female C57BL / 6 mice aged 6 to 8 weeks (purchased from Xi'an Yifengda Biotechnology Co., Ltd.) were randomly divided into 8 groups, with 8 mice in each group. Each mouse in the control group was intramuscularly injected with 0.1 mL of normal saline; the positive control group was treated with recombinant herpes zoster vaccine (Shingrix) (5 μg / mouse). The 6 experimental groups with MF59+CpG1009 adjuvant were intramuscularly injected with 0.1 mL of 5 μg of VZV gE series antigens adsorbed with MF59+CpG1009 adjuvant, and 8 mice were injected in each dose group; after the first immunization, the mice were immunized again at an interval of two weeks, for a total of 2 immunizations. The treatment schemes of experimental animals in each group are summarized in Table 2. Seven days after the second immunization, 3 mice in each group were euthanized, spleens were taken, and spleen cells were isolated. Cellular immunity was detected by flow cytometry. 14 days after the second immunization, blood was collected from the remaining 5 mice in each group through the orbital ventricle, and the serum was collected and stored in a -80°C refrigerator for gE antigen-specific IgG detection.

[0222] Table 2

[0223]

[0224]

[0225] 1.4 Humoral Immunity Testing

[0226] 1) Dilute the recombinant VZV gE-His protein to 1 μg / mL with carbonate buffer, coat a 96-well ELISA plate (Costar), 100 μL per well, place at 37°C for 1 hour, and then place at 2-8°C overnight;

[0227] 2) Discard the liquid in the 96-well plate and wash it three times with PBST solution (0.5 mL Tween-20 dissolved in 1 L PBS solution);

[0228] 3) Add 200 μL of blocking solution (5 g skim milk powder dissolved in 100 mL PBST solution) to each well and block at room temperature for 60 minutes;

[0229] 4) Aspirate the blocking solution in the wells and wash three times with PBST solution;

[0230] 5) Use antibody diluent (3g skim milk powder dissolved in 100mL PBST solution) to dilute the test serum by 2 times, 1:3200, 1:6400, 1:12800... etc. Then add 100μL / well to the ELISA plate, the negative control is the mouse serum immunized with normal saline only (1:100), and react at 37℃ for 60 minutes;

[0231] 6) Aspirate the blocking solution in the wells and wash three times with PBST solution;

[0232] 7) Take out the goat anti-mouse IgG-HRP conjugate, dilute the corresponding secondary antibody 1:5000 with antibody diluent, and incubate at room temperature for 30 minutes;

[0233] 8) Add to 96-well ELISA plate, 100 μL per well, react at 37°C for 30 minutes;

[0234] 9) Aspirate the blocking solution in the wells and wash three times with PBST solution;

[0235] 10) Add 100 μL of TMB colorimetric solution to each well, and after 10 minutes, add 50 μL of stop solution (1 M hydrochloric acid solution) to terminate the reaction;

[0236] 11) The A450 absorbance was measured using a TECAN Infinit 200 microplate reader, and the mean value of the A450 of the serum in the negative control group plus 3 times the SD was used as the Cut-Off value (if the mean value of the A450 value of the negative control plus 3 times the SD was lower than 0.100, it was calculated as 0.100) to determine the titer of the immunized serum.

[0237] 1.5 Cellular Immunoassay

[0238] 1) Sacrifice: The mice were eyeballed and blood was collected, then sacrificed and placed in 75% ethanol.

[0239] 2) Dissection: The spleen of the mouse was removed and ground using a 70 μm cell sieve in a 6-well plate with 3 mL of 2% FBS RPMI 1640 medium until no obvious tissue was left on the sieve. The cell suspension was collected and transferred to a 15 mL centrifuge tube and centrifuged at 300×g for 5 min at 4°C.

[0240] 3) Discard the supernatant, resuspend the pelleted cells with 3 mL ACK lysis buffer, incubate at room temperature (or 37°C) for 5 min, add 3 mL 2% FBS RPMI 1640 medium to terminate lysis, and centrifuge at 300×g for 5 min at 4°C.

[0241] 4) Discard the supernatant, resuspend the spleen cells in 2 mL of 2% FBS RPMI 1640 medium, and centrifuge at 300×g for 5 min at 4°C.

[0242] 5) Discard the supernatant and resuspend the spleen cells in 2 mL of 2% FBS RPMI 1640 medium. After mixing, take 10 μL and add it to an EP tube containing 90 μL of 2% FBS RPMI 1640 medium to count the cells.

[0243] 6) According to the counting results, the cells were diluted to 10 with 2% FBS RPMI 1640 medium. 7 / mL, aspirate 100μL into a 48-well culture plate. Add 200μL of gE antigen overlapping peptide library (a total of 127 peptides, a single peptide length of 15 amino acids, 11 overlaps) (156μg / mL, diluted in 2% FBS RPMI 1640 medium) to the antigen stimulation group. Add 200μL of 2% FBS RPMI 1640 medium to the blank control group. Add 200μL of diluted Cell Stimulation Cocktail (plus protein transport inhibitors) to the positive control group, diluted in 2% FBS RPMI 1640 medium. Add 1μg anti-mouse CD28 to each well. Incubate at 37℃, 5% CO2 for 8h.

[0244] 7) Add 200 μL of the diluted protein transport inhibitor mixture diluted with 2% FBS RPMI 1640 medium to the antigen stimulation group and the blank control group, and culture at 37°C, 5% CO2 for 12 hours.

[0245] 8) Transfer the spleen cells from the 48-well plate to a flow cytometry tube, add 1 mL of staining buffer, and centrifuge at 4°C, 300×g, for 5 min. Repeat the washing process.

[0246] 9) Add 50 μL of Fc receptor blocker (anti-mouse CD16 / 32) to each tube and incubate on ice for 20 min.

[0247] 10) For intracellular staining, add 1 mL of staining buffer to resuspend the cells, centrifuge at 4°C, 300×g for 5 min. Add 100 μL Reagent A (Fixation Medium) and incubate at room temperature in the dark for 15 min. Add 1 mL of staining buffer to resuspend the cells, centrifuge at 4°C, 300×g for 5 min. Add 100 μL Reagent B (Permeabilization Medium) and intracellular staining antibody. Incubate at room temperature in the dark for 20 min.

[0248] 11) Add 1 mL of staining buffer to resuspend the cells, centrifuge at 4°C, 300 × g, 5 min. Repeat the wash twice. Add 200 μL of staining buffer to resuspend the cells and transfer to a 96-well plate for detection.

[0249] 1.6 Test results

[0250] After immunization twice, all mice in the experimental groups were positively converted. Figure 3As shown, analysis of the serum titers measured in each experimental group showed that the antigen-specific IgG antibodies induced by the fusion protein of the chimeric epitope 1 with immune cell activation effect added in combination with the MF59+CpG1009 adjuvant were better than gE-Fc without the epitope, and better than the same dose of Shingrix.

[0251] 1.7 Results

[0252] Compared with the gE-Fc protein without epitope, the gE-epitope-Fc fusion protein containing the chimeric epitope with cell-mediated immune activation induced CD4 + The number of T cells increased significantly ( Figure 4 ); the number of CD8+T cells producing IFN-γ, IL-2, and CD40L increased significantly ( Figure 5 ). The above shows that the recombinant herpes zoster vaccine made of the gE-Fc fusion protein with chimeric epitopes prepared by the present invention can induce the body's humoral immunity and cellular immunity, and the specific combination of fusion protein combined with MF59+CpG1009 is better than the same dose of Shingrix.

[0253] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A fusion protein comprising varicella-zoster virus (VZV) glycoprotein gE protein and Fc region.

2. The fusion protein of claim 1, further comprising a chimeric epitope having a cellular immune activation effect, wherein the chimeric epitope comprises one or more selected from the following: (a) Activatable CD4 from ORF9 of VZV + T cell epitopes; (b) Activatable CD4 from IE62 of VZV + T cell epitopes; (c) Activatable CD4 from IE63 of VZV + T cell epitopes; (d) Activatable CD8 from ORF9 of VZV + T cell epitopes; (e) Activatable CD8 from ORF29 of VZV + T cell epitopes.

3. The fusion protein of claim 2, wherein the epitope of (a) comprises the amino acid sequence shown in SEQ ID NO: 1, the epitope of (b) comprises the amino acid sequence shown in SEQ ID NO: 2, the epitope of (c) comprises the amino acid sequence shown in SEQ ID NO: 3, the epitope of (d) comprises the amino acid sequence shown in SEQ ID NO: 4, and / or the epitope of (e) comprises the amino acid sequence shown in SEQ ID NO:

5.

4. The fusion protein of claim 2 or 3, wherein the chimeric epitope comprises a portion operably linked in any of the following forms: (CD4 + T)ORF9-IE62-IE63-(CD8 + T)ORF9-ORF29; (CD4 + T)ORF9-IE63-IE62-(CD8 + T)ORF9-ORF29; IE62-(CD4 + T)ORF9-IE63-(CD8 + T)ORF9-ORF29; IE62-IE63-(CD4 + T)ORF9-(CD8 + T)ORF9-ORF29; IE63-(CD4 + T)ORF9-IE62-(CD8 + T)ORF9-ORF29; IE63-IE62-(CD4 + T)ORF9-(CD8 + T)ORF9-ORF29; (CD4 + T)ORF9-IE62-IE63-ORF29-(CD8 + T)ORF9; (CD4 + T)ORF9-IE63-IE62-ORF29-(CD8 + T)ORF9; IE62-(CD4 + T)ORF9-IE63-ORF29-(CD8 + T)ORF9; IE62-IE63-(CD4 + T)ORF9-ORF29-(CD8 + T)ORF9; IE63-(CD4 + T)ORF9-IE62-ORF29-(CD8 + T)ORF9; or IE63-IE62-(CD4 + T)ORF9-ORF29-(CD8 + T)ORF9; Preferably, the chimeric epitope comprises the amino acid sequence shown in any one of SEQ ID NOs: 6-17, More preferably, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO:

6.

5. The fusion protein of claim 2 or 3, wherein the chimeric epitope comprises a portion operably linked in any of the following forms: (CD4 + T)ORF9-IE62-IE63; (CD4 + T)ORF9-IE63-IE62; IE62-(CD4 + T)ORF9-IE63; IE62-IE63-(CD4 + T)ORF9; IE63-(CD4 + T)ORF9-IE62; IE63-IE62-(CD4 + T)ORF9; Preferably, the chimeric epitope comprises the amino acid sequence shown in any one of SEQ ID NOs: 18-23, More preferably, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO:

18.

6. The fusion protein of claim 2 or 3, wherein the chimeric epitope comprises a portion operably linked in any of the following forms: (CD8 + T)ORF9+ORF29; ORF29+(CD8 + T)ORF9; Preferably, the chimeric epitope comprises the amino acid sequence shown in any one of SEQ ID NOs: 24-25, More preferably, the chimeric epitope comprises the amino acid sequence shown in SEQ ID NO:

24.

7. The fusion protein of any one of claims 1-6, wherein the gE protein comprises: (a) the amino acid sequence shown in SEQ ID NO: 26; (b) an amino acid sequence that is at least 98% identical to the amino acid sequence shown in SEQ ID NO:

26.

8. The fusion protein of any one of claims 1 to 6, wherein from the N-terminus to the C-terminus, the fusion protein comprises a portion operably linked in any of the following ways: gE-Fc, Fc-gE, gE-chimeric epitope-Fc, chimeric epitope-gE-Fc, chimeric epitope-Fc-gE, or gE-Fc-chimeric epitope.

9. The fusion protein of claim 8, wherein: The gE protein comprises the amino acid sequence shown in SEQ ID NO: 26; and The chimeric epitope comprises, in order: (a) the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence shown in SEQ ID NO: 3, the amino acid sequence shown in SEQ ID NO: 4, and the amino acid sequence shown in SEQ ID NO: 5; (b) the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence shown in SEQ ID NO: 2, and the amino acid sequence shown in SEQ ID NO: 3; or (c) the amino acid sequence shown in SEQ ID NO:4 and the amino acid sequence shown in SEQ ID NO:

5.

10. The fusion protein of any one of claims 1-9, wherein the various epitopes of the chimeric epitope or between the gE protein and the chimeric epitope are directly connected or connected via a linker sequence, and the linker sequence is selected from SGS, SGG, GGGGS, EAAAK, AAY, GPGPG, KK and RVRR. Preferably, the linker sequence is AAY, GPGPG or EAAAK.

11. The fusion protein of any one of claims 1 to 10, wherein the Fc region is a human IgG1, IgG2, IgG3 or IgG4 Fc region or a variant thereof.

12. The fusion protein of claim 11, wherein the Fc region comprises: (a) the amino acid sequence shown in SEQ ID NO: 27; or (b) an amino acid sequence that is at least 98% identical to the amino acid sequence shown in SEQ ID NO:

27.

13. A composition comprising the fusion protein according to any one of claims 1 to 12 and a pharmaceutically acceptable carrier and / or adjuvant.

14. The composition according to claim 13, wherein the adjuvant comprises MF59 adjuvant and CpG ODN adjuvant.

15. The composition according to claim 14, wherein the CpG ODN adjuvant is a CpG1009 adjuvant, and the CpG1009 adjuvant has a nucleic acid sequence shown in SEQ ID NO: 28; Preferably, the phosphate backbones in the nucleic acid sequence shown in SEQ ID NO: 28 are all thio-modified.

16. The composition according to claim 15, wherein in a unit dose The content of the fusion protein is between 5-100 μg, preferably between 50-100 μg.

17. The composition of any one of claims 13-16, which is a vaccine composition, more particularly a herpes zoster vaccine composition.

18. A nucleic acid molecule encoding the fusion protein according to any one of claims 1 to 12.

19. A vector comprising the nucleic acid molecule according to claim 18, for example, said vector is a baculovirus vector.

20. A host cell comprising a nucleic acid molecule according to claim 18 or a vector according to claim 19, optionally wherein the host cell is an E. coli or an insect cell.

21. A method for preparing the fusion protein according to any one of claims 1 to 12, comprising the following steps: - Cultivating the host cell transfected with the vector of claim 19 under suitable conditions; and - isolating the fusion protein from the supernatant of the host cells.

22. A method for preparing a herpes zoster vaccine, comprising the step of mixing the fusion protein according to any one of claims 1 to 12 with an adjuvant, optionally wherein the adjuvant comprises MF59 adjuvant and CpG1009 adjuvant.

23. Use of the fusion protein according to any one of claims 1 to 12 or the nucleic acid molecule according to claim 18 in the preparation of a vaccine composition for preventing or alleviating varicella-zoster virus infection in a subject.

24. Use of the fusion protein according to any one of claims 1 to 12 or the nucleic acid molecule according to claim 18 in the preparation of a medicament for preventing or alleviating a disease or condition associated with varicella-zoster virus in a subject, For example, the subject is a human or a non-human animal, preferably a human.

25. The use according to claim 24, wherein the disease associated with varicella-zoster virus is selected from chickenpox, herpes zoster and postherpetic neuralgia.

26. Use of the fusion protein according to any one of claims 1 to 12 in the preparation of a medicament for inducing a body to produce humoral immunity and / or cellular immunity against herpes zoster virus.

27. Use of the fusion protein according to any one of claims 1 to 12 in producing antibodies against herpes zoster virus, For example, the antibody comprises a polyclonal antibody, a monoclonal antibody or a recombinant antibody.

28. Use of a combination of MF59 adjuvant and CpG1009 adjuvant in the preparation of a vaccine composition for preventing or alleviating varicella-zoster virus infection in a subject.

29. Use of a combination of MF59 adjuvant and CpG1009 adjuvant to enhance the immunogenicity of antigens in herpes zoster vaccine compositions.

Images