Method for detecting echinococcus granulosus eggs in echinococcus granulosus terminal host faeces through RAA-LFD and primer probe composition thereof

Abstract

The invention discloses a method for detecting eggs of echinococcus granulosus in excrement of an echinococcus granulosus terminal host by RAA-LFD and a primer probe composition thereof. According to the primer probe composition for RAA-LFD detection of the echinococcus granulosus eggs, an upstream primer is as shown in SEQ ID NO.4, a downstream primer is as shown in SEQ ID NO.5, and a probe sequence is as follows: FAM-CTCTATAGTGTGTTTGGGTAGCAGGTTTG [THF] GGTCATATGTT-C3. According to the primer probe composition for RAA-LFD detection of the echinococcus granulosus eggs, the upstream primer is as shown in SEQ ID NO.3, and the downstream primer is as shown in SEQ ID NO.5. The invention further discloses the application of the primer probe composition in preparation of a reagent for RAA-LFD detection of echinococcus granulosus. The method has the advantages of safety, rapidness, simplicity, accuracy, high sensitivity, strong specificity and the like.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a method for detecting Echinococcus granulosus eggs in feces of the terminal host of Echinococcus granulosus by RAA-LFD and a primer-probe composition thereof. Background Art

[0002] Hydatid disease is a zoonosis caused by the middle tapeworm larvae (Echinococcus granulosus, hydatid) of Echinococcus granulosus parasitizing the liver, lungs and other organs of humans and animals. Dogs and canine wildlife are the final hosts of Echinococcus granulosus, and the eggs in dog feces are an important source of hydatid disease infection in humans, cattle and sheep.

[0003] Dogs are important terminal hosts of echinococcosis and have the closest contact with humans and livestock. They are the main source of infection for echinococcosis in humans and animals. Strengthening the detection and monitoring of worm eggs in dog feces is of great significance for the prevention and control of echinococcosis. At present, the detection method for worm eggs in dog feces is time-consuming, labor-intensive, costly, and requires professional personnel to operate, which is not conducive to promotion and application. It is very necessary to establish a detection method that is suitable for the general public, easy to operate, fast and simple.

[0004] Studies have found that the mitochondrial COX1 gene is well conserved in Echinococcus tapeworms and exists in different developmental stages such as eggs, larvae and adults, making it a good molecular detection target. Although there are reports on the detection of Echinococcus granulosus based on this gene as a target, the full length of the gene sequence is 1674bp, and some segments are prone to forming structures such as hairpins and dimers due to their high GC content, short palindromic sequences, and repetitive sequences in the sequence. Therefore, the selection of target segments has a significant impact on the accuracy and specificity of the detection results.

[0005] Recombinase aided amplification (RAA) is a detection technology that can rapidly amplify nucleic acids at a constant temperature in vitro. When combined with a lateral flow dipstick (LFD), rapid and visual nucleic acid detection can be achieved. Summary of the invention

[0006] The purpose of the present invention is to establish a safe, rapid, simple and accurate method for detecting the eggs of Echinococcus granulosus in view of the problems of low safety, complicated operation and high professional requirements in the existing detection of the eggs of Echinococcus granulosus.

[0007] Another object of the present invention is to provide a primer-probe combination for detecting eggs of Echinococcus granulosus by RAA-LFD.

[0008] Another object of the present invention is to provide application of the primer-probe combination.

[0009] The present invention can be achieved through the following technical solutions:

[0010] A primer-probe combination for detecting eggs of Echinococcus granulosus by RAA-LFD, wherein the upstream primer is shown in SEQ ID NO.4, the downstream primer is shown in SEQ ID NO.5, and the probe sequence is: FAM-TTCTATAGTGTGTTTGGGTAGCAGGGTTTG[THF]GGTCATCATATGTT-C3, wherein the downstream primer is labeled with Biotin at its 5' end, the 5' end of the probe is labeled with FAM fluorescein, the +31 position is labeled with tetrahydrofuran THF, and a blocking group C3 is added to the 3' end.

[0011] The primer-probe combination is used in preparing a reagent for detecting Echinococcus granulosus using RAA-LFD.

[0012] The primer-probe combination is used in RAA-LFD detection of Echinococcus granulosus.

[0013] A method for detecting Echinococcus granulosus eggs in feces of the terminal host of Echinococcus granulosus by RAA-LFD, wherein the primer-probe combination is used to detect DNA samples extracted from feces of dogs or wild animals of the Canidae family by RAA-LFD.

[0014] As a preferred embodiment of the present invention, the method comprises a method for extracting a DNA sample from dog feces:

[0015] (1) Take 1 g of dog or canine wildlife feces sample, add 300 μL SDS lysis buffer, 8-15 μL 20 mg / ml proteinase K, incubate at 65°C for 8-12 min, and then treat at 95°C±1°C for 0.5-2 min; wherein the SDS lysis buffer formula is: 10 mM Tris [pH 8.0], 2M NaCl, 7mM SDS, 8mM EDTA;

[0016] (2) Soak the filter paper in the above sample for 3 min;

[0017] (3) Take out the filter paper and wash it in a cleaning solution for 2-3 min. The cleaning solution is 10 mM Tris pH 8.0, 0.1% Tween-20.

[0018] (4) Place the filter paper in 40 μL ddH2O for 1-2 min to dissolve the DNA and prepare the DNA sample for later use.

[0019] As a further preferred embodiment of the present invention, the method comprises a method for extracting a DNA sample from dog feces:

[0020] (1) Take 1 g of dog or canine wildlife feces sample, add 300 μL SDS lysis buffer, 10 μL 20 mg / ml proteinase K, incubate at 65°C for 10 min, and then treat at 95°C for 1 min; wherein the SDS lysis buffer formula is: 10 mM Tris [pH 8.0], 2M NaCl, 7mM SDS, 8mM EDTA;

[0021] (2) Soak the filter paper in the above sample for 3 min;

[0022] (3) Take out the filter paper and place it in 600 μL of cleaning solution for 3 min. The cleaning solution formula is 10 mM Tris pH 8.0, 0.1% Tween-20;

[0023] (4) Place the filter paper in 40 μL ddH2O for 2 min to dissolve the DNA and prepare the DNA sample for later use.

[0024] As a further preferred embodiment of the present invention, the method comprises the following steps:

[0025] I: Extract DNA samples from feces of dogs or canine wild animals according to the method described;

[0026] II: 3 μL DNA sample was used as template, and the primer-probe combination was used for RAA reaction. The reaction system was: total volume 25 μL, RAA buffer 12.5 μL, upstream and downstream primers 1 μL each, probe 1 μL, DNA sample 3 μL, ddH2O 6.5 μL, and the reaction was carried out at 37°C for 10 min;

[0027] III: Take 10 μL of the reaction product and add it to 90 μL of 1×PBS, mix well, insert the test strip, and read the result after 2 min. For a negative result, only the quality control line will have a red strip, and for a positive result, both the quality control line and the test line will have a red strip.

[0028] The present invention is based on the following discoveries:

[0029] RAA-LFD has high sensitivity and can visualize the results. It does not require the purchase of additional auxiliary equipment. Under extreme conditions, a thermos cup can be used to complete the reaction and obtain the test results. It is suitable for rapid on-site screening, especially for areas with simple experimental equipment and emergency situations. It has good application prospects in the process of pet dog owners conducting health checks on their dogs. There have been no reports on the use of RAA-LFD technology to detect Echinococcus granulosus eggs in dog feces using the Echinococcus granulosus COX1 gene as a detection target.

[0030] Compared with the prior art, the advantages of the present invention are:

[0031] 1. Safety. The eggs of Echinococcus granulosus in dog feces are the source of echinococcosis infection in humans and animals. The optimized sample processing method of the present invention is safer and can quickly inactivate the eggs during the sample DNA extraction process, greatly reducing the infection risk of the operator.

[0032] 2. Fast. The optimized detection method of the present invention only takes about 30 minutes. The commonly used detection methods such as ELISA take at least more than one hour, which saves more than half of the detection time.

[0033] 3. Simple. The results can be read visually, no professional operation is required, no complicated equipment is required, and the reaction can be completed in a thermos cup.

[0034] 4. Accurate. This method has high sensitivity and strong specificity, and its consistency rate with the ELISA detection method is 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 PCR amplification of COX1 gene

[0036] Wherein: M: DNA Mark DL2000; 1: COX1 gene PCR product; N: negative control

[0037] Figure 2 Sequence analysis of COX1 gene of Echinococcus granulosus

[0038] Figure 3 Optimization of primers for RAA-LFD

[0039] Among them: A: Use F1 / R1 as primers for RAA amplification; B: Use F2 / R2 as primers for RAA amplification; C: Use F3 / R3 as primers for RAA amplification; D: Use F4 / R4 as primers for RAA amplification; E: Use F5 / R5 as primers for RAA amplification. M: 500 DNA Marker; N: Negative control

[0040] Figure 4 Optimization of DNA extraction method for eggs in feces

[0041] Wherein: M: 500 DNA Marker; 1: commercial kit extraction method; 2: the optimized DNA extraction method of the present invention; P: positive plasmid control; N: negative control

[0042] Figure 5 Sensitivity of DNA extraction methods for eggs in feces

[0043] Wherein: M: 500 DNA Marker; 1-10 are respectively 1g of dog negative feces with 1, 3, 5, 7, 10, 15, 20, 25, 30, 35 eggs of Echinococcus granulosus added to prepare simulated samples, and then DNA is extracted using the optimized method of the present invention; P: positive plasmid control; N: negative control

[0044] Figure 6 Schematic diagram of the probe

[0045] Where: FAM: 5' end is labeled with FAM fluorescein; THF: tetrahydrofuran; C3: 3' end blocking group

[0046] Figure 7 Screening of probe concentration for RAA-LFD method

[0047] Where: P1: DNA template added, probe concentration 1 μM; TI: no DNA template added, probe concentration 1 μM; P2: DNA template added, probe concentration 500 nM; T2: no DNA template added, probe concentration 500 nM; P3: DNA template added, probe concentration 50 nM; T3: no DNA template added, probe concentration 50 nM

[0048] Figure 8 Optimal reaction time selection for RAA-LFD

[0049] Among them: 1-6 are 5, 10, 15, 20, 25, 30 minutes of reaction respectively; N: negative control

[0050] Fig. 9 Sensitivity of RAA-LFD (detection of positive plasmids)

[0051] Among them: 1-9 are 4.8×10 8 -4.8×10 0 copies of positive plasmid; N: negative control

[0052] Fig.10 Sensitivity of RAA-LFD (detection of simulated samples)

[0053] Where: 1-10 are DNA extracted from 1, 3, 5, 7, 10, 15, 20, 25, 30, and 35 eggs added to 1 gram of negative dog feces as simulated samples; N: negative control

[0054] Fig.11 Specificity for RAA-LFD

[0055] Where: P: Echinococcus granulosus; 1-6 are canine intestinal epithelial cells, Escherichia coli, Salmonella, Ancylostoma caninum, Trichinella spiralis, Ascaris canis; N: negative control

[0056] Fig.12 Repeatability of RAA-LFD

[0057] Among them: P1: positive control for the first test; N1: negative control for the first test; P2: positive control for the second test; N2: negative control for the second test; P3: positive control for the third test; N3: negative control for the third test

[0058] Fig.13 Results of some clinical samples

[0059] Where: P: positive control; N: negative control DETAILED DESCRIPTION

[0060] Basic Materials

[0061] Adult Echinococcus granulosus was kindly provided by Xinjiang Medical University, and eggs of Echinococcus granulosus were kindly provided by the Veterinary Research Institute of Xinjiang Academy of Animal Husbandry. DH5α competent cells were provided by our laboratory. Negative dog fecal samples and canine small intestinal epithelial cells were obtained from the Veterinary Hospital of Nanjing Agricultural University, and DNA of Escherichia coli, Salmonella, Ancylostoma caninum, Trichinella spiralis, and Ascaris canis were all provided by our laboratory. 60 canine fecal samples were collected clinically from the Fuxing Stray Animal Base in Nanjing, and another 40 canine fecal samples were collected clinically from the Veterinary Hospital of Nanjing Agricultural University.

[0062] Main reagents

[0063] Omega Tissue DNA Kit and Omega Stool DNA Kit were purchased from Omega Bio-Tek; pMD-19T vector and 500 DNA Marker were purchased from Bao Biotechnology (Beijing) Co., Ltd.; agarose gel recovery kit was purchased from Beijing Solebow Technology Co., Ltd.; DNA plasmid extraction kit was purchased from Beijing Jinsha Biotechnology Co., Ltd.; 2×SuperKfx Master Mix was purchased from Beijing Kangwei Century Biotechnology Co., Ltd.; proteinase K (20 mg / ml) was purchased from Shanghai Bio-Technology Co., Ltd.; 2× Rapid Taq Master Mix was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; RAA and LFD nucleic acid amplification kits were purchased from Jiangsu Qitian Biotechnology Co., Ltd.; canine Echinococcus granulosus coproantigen ELISA kit was purchased from Shanghai ELISA Biotechnology Co., Ltd. Sodium dodecyl sulfate (SDS), ampicillin (Amp), urea (Urea), Tris-Hcl (pH8.0), sodium chloride (NaCl), ethylenediaminetetraacetic acid (EDTA), Tween-20 (Tween-20), agarose (Agarose), boric acid (Boric acid), acetic acid (Acetic Acid), Tris saturated phenol, trichloromethane (Trichloromethane), isoamyl alcohol (Isoamyl alcohol), ethanol (Ethanol) and the like were purchased from the reagent library of Nanjing Agricultural University.

[0064] Main instruments

[0065] Constant temperature water bath; PCR instrument; Nanodrop One ultra-micro-volume spectrophotometer; pressure steam sterilizer (MLS-3870, Sanyo, Japan); micropipette (Thermo, USA); constant temperature shaker incubator; vortex mixer; high-speed centrifuge (Eppendorf).

[0066] Example 1. Screening of detection targets

[0067] 1.1 Primer design

[0068] After searching in NCBI and performing BLAST analysis, it was found that the full length of COX1 gene was 1674 bp and highly conserved. A pair of primers for amplifying the full length COX1 gene was designed using Primer Primier 6 software, and their sequences are shown in SEQ ID NO.1 (5'ATGAGAGTGGTGTGATTAGGT 3') and SEQ ID NO.2 (5'TTAAACAACCAGGTCAATGACT 3').

[0069] 1.2 DNA extraction from adult Echinococcus granulosus worms

[0070] The Omega Tissue DNA Kit was used to extract DNA from adult Echinococcus granulosus worms. The steps are as follows:

[0071] (1) Weigh 20 mg of insect tissue into a 1.5 ml centrifuge tube, add 200 μL TL Buffer and 25 μL proteinase K (20 mg / ml) solution, and vortex to mix.

[0072] (2) Incubate in a 60°C water bath for 10 min, gently shaking the liquid to fully dissolve the insect cells.

[0073] (3) Centrifuge at 12,000 rpm for 5 min, transfer the supernatant to a new 1.5 ml centrifuge tube, add 200 μL BLBuffer, and vortex thoroughly to mix.

[0074] (5) Incubate in a 70°C water bath for 10 min and add 200 μL of anhydrous ethanol.

[0075] (6) Assemble the collection tube and the binding column, transfer the above liquid into the binding column, centrifuge at 12000 rpm for 1 min, and discard the filtrate.

[0076] (7) Add 400 μL HBC Buffer, centrifuge at 12,000 rpm for 30 s, and discard the filtrate and collection tube.

[0077] (8) Place the adsorption column back into a new collection tube, add 700 μL DNA Wash Buffer, centrifuge at 12,000 rpm for 30 seconds, discard the filtrate, and repeat this step once.

[0078] (9) After the adsorption column is dried, place it in a 1.5 ml centrifuge tube, add 60 μL ddH2O, and centrifuge at 12000 rpm for 1 min. The filtrate collected is the genomic DNA of Echinococcus granulosus. After detecting the concentration (85.36 ng / μL) using Nanodrop One, take 1 μL and perform electrophoresis on 2% agarose gel. The rest of the filtrate should be stored in a -20°C refrigerator.

[0079] 1.3 Construction of Echinococcus granulosus COX1 gene positive plasmid

[0080] According to the sample loading system in Table 1, the DNA extracted in 1.2 was used as a template to perform PCR reaction to amplify the full-length COX1 gene. The upstream and downstream primer sequences are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0081] The PCR reaction program was as follows: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 15 s, for 35 cycles; and extension at 72°C for 5 min.

[0082] The PCR products were subjected to agarose gel electrophoresis. Figure 1 . The PCR product was recovered using a DNA recovery kit to obtain a product with a high concentration and purity. Since the product amplified by the high-fidelity enzyme used was blunt-ended, the recovered product was reacted with ordinary Taq enzyme for 30 min to form a sticky end, and the PCR product was recovered and purified. The reagents in Table 2 were added to the reaction tube one by one, connected at 16°C for 30 min, and the connected product was transformed into DH5α competent cells. First, ice bath for 30 min, heat shock at 42°C for 90 s, and ice bath again for 2 min. Take 5 μL of the transformation product and add it to 600 μL of non-resistant LB liquid culture medium and mix well. Incubate in a 37°C constant temperature incubator at 120 rpm for 3 h. The bacterial solution was smeared on ampicillin-resistant LB solid culture medium and cultured at 37°C overnight. Pick a single colony and shake the bacteria again until the liquid is turbid for use.

[0083]

[0084] 1.4 Positive plasmid extraction and identification

[0085] Use a DNA extraction kit to extract the plasmid. The specific steps are as follows:

[0086] (1) Take 1 ml of bacterial solution and centrifuge it at 12,000 rpm for 1 min. Aspirate the supernatant and keep the bacterial cells.

[0087] (2) Add 100 μL of Buffer P1 to resuspend the cells, vortex to mix, then add 100 μL of Buffer P2 and gently invert 6-8 times to dissolve the cells.

[0088] (3) Add 150 μL Buffer P3 and gently invert 6-8 times. After a white precipitate appears, centrifuge at 12,000 rpm for 10 min. Pipette the supernatant into the adsorption column and centrifuge at 12,000 rpm for 1 min. Discard the filtrate.

[0089] (4) Add 200 μL Buffer W1, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and repeat this step.

[0090] (5) Centrifuge the adsorption column at 12,000 rpm for 2 min, place it in a 1.5 ml centrifuge tube, add 50 μL ddH2O, centrifuge at 12,000 rpm for 2 min, dissolve the plasmid in water, and store it in a -20°C refrigerator.

[0091] 1.5 Sequence analysis

[0092] The constructed plasmid was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the open reading frame of the COX1 gene of Echinococcus granulosus was 1674 bp, and the specific sequence is shown in SEQ ID NO.3. The COX1 gene was analyzed and compared using DNAstar, BLAST and other software ( Figure 2 ), and determined it as the detection target.

[0093] 1.6 Optimal selection of primers and probes for RAA-LFD amplification

[0094] According to the RAA-LFD primer and probe design principles, DNAMAN software was used to select five different target regions in the COX1 gene to design five pairs of primers (see Table 3 for details). The five pairs of primers were screened using the RAA nucleic acid amplification kit, and the amplified products were electrophoresed using a 2% agarose gel. Primers were screened by comparing the band changes under different reaction times (10-30 min), and the judgment was based on the brightness and singleness of the bands.

[0095]

[0096] The total volume of the RAA reaction (50 μL) is shown in Table 4, including 25 μL of RAA buffer, 1 μL of upstream primer (F), 1 μL of downstream primer (R), 1 μL of DNA template (positive plasmid), 19 μL of water, and 3 μL of magnesium acetate added to the tube cap.

[0097] Cover the tube and centrifuge for 10 seconds to mix all components thoroughly. After reacting at 37°C for 10 min, 15 min, 20 min, 25 min, and 30 min, add 50 μL of phenol / chloroform / isoamyl alcohol (V:V:V=25:24:1) to terminate the reaction and vortex thoroughly to mix. Centrifuge for 10 seconds to separate the solution. The upper layer is the amplified product. Take 10 μL and perform electrophoresis on 2% agarose gel.

[0098]

[0099] The results are as follows Figure 3 As shown. The results showed that both F3 / R3 and F4 / R4 primers had non-specific amplification and primer dimers; while F2 / R2 primer showed non-specific amplification after 30 minutes of reaction; the reaction bands of F1 / R1 and F5 / R5 were relatively single, and the product band of F5 / R5 was brighter than that of F1 / R1 primer after 10 minutes of amplification. It can be seen that primer screening for RAA reaction is necessary. In summary, F5 and R5 were selected as the upstream and downstream primers for subsequent RAA, and their sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, and the corresponding detection target region is 800bp-1022bp in SEQ ID NO.3, which is the target region of the present invention.

[0100] Based on the target genes amplified by F5 and R5, the probe was designed: FAM-TTCTATAGTGTGTTTGGGTAGCAGGGTTTG[THF]GGTCATCATATGTT-C3.

[0101] Example 2. Extraction of DNA from worm eggs in dog feces samples

[0102] 2.1 Extraction of egg DNA from dog feces

[0103] (1) Take 1 g of positive dog feces sample, add 300 μL SDS lysis buffer (10 mM Tris [pH 8.0], 2 M NaCl, 7 mM SDS, 8 mM EDTA), 10 μL proteinase K (20 mg / ml), incubate at 65°C for 10 min, and then treat at 95°C for 1 min.

[0104] (2) Place a 5 mm diameter filter paper into the above sample and soak it for 3 min.

[0105] (3) Remove the filter paper and place it in 600 μL of cleaning solution (10 mM Tris pH 8.0, 0.1% Tween-20) for 3 min.

[0106] (4) Place the filter paper in 40 μL ddH2O for 2 min to dissolve the DNA and set aside.

[0107] (5) Add corresponding reagents according to the reaction system in Table 5 for PCR amplification. The upstream primer sequence is shown in SEQ ID NO.4 (5' CGTTTGGGTTCTATGGGTTGTTGTTTGCTATG 3'); the downstream primer sequence is shown in SEQ ID NO.5 (5' CATCACAAAACCGGATCACTAACATTAACACTCG3'). The PCR program is: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 15 s, 30 cycles; 72℃ extension for 5 min.

[0108] (6) The PCR products were subjected to agarose gel electrophoresis. Figure 4 .

[0109] 2.2 Sensitivity of DNA extraction methods for eggs in dog feces

[0110] 1, 3, 5, 7, 10, 15, 20, 25, 30, and 35 Echinococcus granulosus eggs were added to 1 g of negative dog feces, and DNA was extracted from the above simulated samples using the method in 2.1.

[0111] The extracted DNA samples were subjected to PCR amplification, and negative and positive controls were set up at the same time. The PCR reaction was the same as in 2.1 (5). The PCR products were subjected to agarose gel electrophoresis, and the results were shown in Figure 5 .

[0112]

[0113] Example 3. Optimization of RAA-LFD reaction conditions

[0114] 3.1 Probe preparation

[0115] Synthesize primers and probes:

[0116] Upstream primer: 5' CGTTTGGGTTCTATGGGTTGTTGTTTGCTATG 3' (SEQ ID NO.4),

[0117] Downstream primer: Bio-CATCACAAAACCGGATCACTAACATTAACACTCG (SEQ ID NO.5), the downstream primer is labeled with Biotin at the 5' end of the sequence shown in SEQ ID NO.5;

[0118] The probe sequence is: FAM-TTCTATAGTGTGTTTGGGTAGCAGGGTTTG[THF]GGTCATCATATGTT-C3. The 5' end of the probe is labeled with FAM fluorescein, the +31 position is labeled with THF residues, and a blocking group is added to the 3' end. See the schematic diagram of the probe structure. Figure 6 .

[0119] 3.2 RAA-LFD probe concentration screening

[0120] The probe was diluted from 1 μM to 500 nM and 50 nM to screen for the optimal concentration. The positive plasmid was used as a DNA template in the P group, and no template was added in the T group.

[0121] Add the corresponding reagents according to Table 6, centrifuge for 10 s, and react at 37°C for 30 min. Take 10 μL of the reaction solution, add it to 90 μL of 1× PBS, mix well, insert it into the LFD test strip, and read the result after 2 min.

[0122] The results are as follows Figure 7 As shown, the optimized probe concentration was 50 nM.

[0123]

[0124] 3.3 RAA-LFD reaction time optimization

[0125] According to the P3 reaction system, RAA amplification was performed for 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, respectively, and the optimal reaction time was 10 min ( Figure 8 ).

[0126] 3.4 Evaluation of the sensitivity of the RAA-LFD detection method

[0127] The sensitivity evaluation was performed using the COX1 gene-positive plasmid as a template: the copy number of the COX1 gene-positive plasmid was calculated to be 4.8×10 8 Copy number / μL, and diluted it 10 times as DNA templates to detect the sensitivity of RAA-LFD method, and set up negative control group. The reaction system and steps are consistent with P3 in 3.2. The results show that this method can detect a minimum of 48 copies of plasmid ( Fig. 9 ).

[0128] The sensitivity of the simulated samples was evaluated: 1, 3, 5, 7, 10, 15, 20, 25, 30, and 35 eggs of Echinococcus granulosus were added to 1 g of negative dog feces as simulated samples. DNA was extracted from the simulated samples according to the method in 2.1, and RAA-LFD reaction was performed according to the P3 reaction system in 3.2, and a negative control was set. The results showed that the method had good sensitivity and could detect more than 10 eggs in 1 g of feces ( Fig.10 ).

[0129] 3.5 Evaluation of the specificity of the RAA-LFD assay

[0130] The DNA of adult Echinococcus granulosus and the genomic DNA of other microorganisms or parasites in the canine intestine (canine small intestinal epithelium, Escherichia coli, Salmonella, canine hookworm, Trichinella spiralis, and Ascaris canis) were detected using the RAA-LFD method. The reaction system was the same as P3 in 3.2, and the rest was the same as 3.2. The results are shown in Fig.11 As shown, this method has good specificity.

[0131] 3.6 Evaluation of the stability of the RAA-LFD assay

[0132] The egg DNA extracted from the positive dog feces samples was tested by RAA-LFD three times, and a negative control group was set up each time to observe the results to determine the repeatability of the RAA-LFD method. The reaction system was the same as P3 in 3.2, and the rest was the same as 3.2. Results Fig.12 As shown, the method has good stability.

[0133] Example 4. Application of RAA-LFD method

[0134] 4.1 Clinical samples

[0135] 60 and 40 dog feces samples were collected from Nanjing Fuxing Stray Animal Base and Nanjing Agricultural University Veterinary Hospital, respectively. The RAA-LFD method of the present invention, the antibody sandwich enzyme-linked immunosorbent assay detection technology of the national standard GB / T 32948-2016 for the fecal antigen of canines infected with Echinococcus granulosus (abbreviated as coproantigen ELISA) and the fecal examination method were used for detection, and the compliance rate of the detection results was analyzed.

[0136] 4.2 Detection of clinical samples using the optimized RAA-LFD method of the present invention

[0137] (1) Take 1 g of clinical sample, add 300 μL SDS lysis buffer (10 mM Tris [pH 8.0], 2 M NaCl, 7 mM SDS, 8 mM EDTA), 10 μL proteinase K (20 mg / ml), incubate at 65°C for 10 min, and then treat at 95°C for 1 min.

[0138] (2) Place a 5 mm diameter filter paper into the above sample and soak it for 3 min.

[0139] (3) Remove the filter paper and wash it in 600 μL of washing solution (10 mM Tris [pH 8.0], 0.1% Tween-20) for 3 min.

[0140] (4) Place the filter paper in 50 μL ddH2O for 2 min to dissolve the DNA and obtain a DNA sample.

[0141] (5) Use 3 μL DNA sample as template for RAA reaction. The reaction system is: total volume 25 μL, RAA buffer 12.5 μL, upstream and downstream primers 1 μL each, probe 1 μL, sample DNA 3 μL, ddH2O 6.5 μL. Reaction at 37℃ for 10 min.

[0142] (6) Take 10 μL of the reaction product and add it to 90 μL of 1× PBS, mix well, insert the test strip, and read the result after 2 minutes. Fig.13 shown.

[0143] 4.3 Testing clinical samples using coproantigen ELISA

[0144] According to the kit instructions, the clinical stool samples were tested. The specific process is as follows:

[0145] (1) Dissolve 1g of fecal sample in 1ml of PBS and centrifuge at 5000 rpm for 5min. Remove the strip from the aluminum foil bag after equilibration at room temperature for 20min, set up negative control wells, positive control wells and sample wells, and add 50 μL of control substance to each positive and negative control well.

[0146] (2) Dissolve the stool sample in 1× PBS, centrifuge and take the supernatant as the sample to be tested.

[0147] (3) Add 50 μL of the sample to be tested to the sample well. Add 100 μL of the detection antibody labeled with horseradish peroxidase (HRP) to each well except the blank well. Seal the reaction wells with a plate sealer and incubate in a 37°C water bath or incubator for 60 min.

[0148] (4) Discard the filtrate, pat dry on absorbent paper, fill each well with washing solution (350 μL), let stand for 1 min, shake off the washing solution, pat dry on absorbent paper, and repeat this process 5 times.

[0149] (5) Add 50 μL of substrate A and B to each well and incubate at 37°C in the dark for 15 min.

[0150] (6) Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 min.

[0151] Judgment basis: negative control well OD value <0.2, positive control well OD value >0.8, Cut-Off value: negative control OD value + 0.25, sample OD value greater than the threshold, judged as positive, otherwise, negative.

[0152] 4.4 Testing clinical samples by fecal examination

[0153] The centrifugal sedimentation method was used to observe the eggs under a microscope. The steps are as follows: (1) Take an appropriate amount of feces and add twice the volume of saturated sucrose water, and stir to mix. (2) Centrifuge at 4000 rpm for 2 min, aspirate the supernatant, and make a judgment based on the morphological characteristics of the eggs under a microscope.

[0154] 4.5 Comparison of the RAA-LFD method of the present invention with other detection methods

[0155] The results showed that 0 positive samples were detected in 100 dog feces samples. The conformity rate of the three methods was 100%. The specific results are shown in Tables 7 and 8.

[0156]

[0157] .

Claims

1. A primer-probe combination for detecting Echinococcus granulosus eggs by RAA-LFD, characterized in that: The upstream primer is shown as SEQ ID NO.4, the downstream primer sequence is shown as SEQ ID NO.5, and the probe sequence is: FAM-TTCTATAGTGTGTTTGGGTAGCAGGGTTTG[THF]GGTCATCATATGTT-C3, wherein the downstream primer is labeled with Biotin at the 5' end of the sequence shown in SEQ ID NO.5, the 5' end of the probe is labeled with fluorescein FAM, the +31 position is labeled with tetrahydrofuran THF, and a blocking group C3 is added to the 3' end.

2. Use of the primer-probe combination according to claim 1 in preparing a reagent for detecting Echinococcus granulosus by RAA-LFD.

3. Use of the primer-probe combination according to claim 1 in detecting Echinococcus granulosus or its eggs by RAA-LFD.

4. A method for detecting Echinococcus granulosus eggs in feces of the final host of Echinococcus granulosus by RAA-LFD, characterized in that: The primer-probe combination according to claim 1 is used to detect DNA samples extracted from dog feces by RAA-LFD.

5. The method according to claim 4, characterized in that A method for extracting DNA from feces of a dog or canine wildlife is provided: (1) Take 1 g of fecal sample, add 300 μL SDS lysis buffer, 8-15 μL 20 mg / ml proteinase K, incubate at 65°C for 8-12 min, and then treat at 95°C±1°C for 0.5-2 min; wherein the SDS lysis buffer formula is: 10 mM Tris [pH8.0], 2M NaCl, 7mM SDS, 8mM EDTA; (2) Soak the filter paper in the above sample for 3 min; (3) Take out the filter paper and wash it in a cleaning solution for 2-3 min. The cleaning solution is 10 mM Tris pH 8.0 and 0.1% Tween-20. (4) Place the filter paper in 40 μL ddH2O for 1-2 min to dissolve the DNA and prepare the DNA sample for later use.

6. The method according to claim 5, characterized in that Contains methods for extracting DNA samples from dog feces: (1) Take 1 g of fecal sample, add 300 μL SDS lysis buffer, 10 μL 20 mg / ml proteinase K, incubate at 65°C for 10 min, and then treat at 95°C for 1 min; wherein the SDS lysis buffer formula is: 10 mM Tris [pH 8.0], 2M NaCl, 7mMSDS, 8mM EDTA; (2) Soak the filter paper in the above sample for 3 min; (3) Take out the filter paper and place it in 600 μL of cleaning solution for 3 min. The cleaning solution formula is 10 mM Tris pH 8.0, 0.1% Tween-20; (4) Place the filter paper in 40 μL ddH2O for 2 min to dissolve the DNA and prepare the DNA sample for later use.

7. The method according to claim 6, characterized in that The following steps are involved: I: Extract DNA samples from dog or canine wildlife feces; II: 3 μL of DNA sample was used as a template, and the primer-probe combination of claim 1 was used for RAA reaction. The reaction system was: total volume 25 μL, RAA buffer 12.5 μL, upstream and downstream primers 1 μL each, probe 1 μL, DNA sample 3 μL, ddH2O 6.5 μL, and the reaction was carried out at 37°C for 10 min; III: Take 10 μL of the reaction product and add it to 90 μL of 1×PBS, mix well, insert the test strip, and read the result after 2 minutes. For a negative result, only the quality control line will have a red strip, and for a positive result, both the quality control line and the test line will have a red strip.

Images