A biomimetic MOF based on red blood cells, and a preparation method and application thereof
By loading CM272 and MA onto biomimetic MOFs based on erythrocytes, the epigenetic modification of leukemia cells was targeted and regulated, solving the problems of low utilization of epigenetic drugs and the influence of hypoxic environment, thus achieving effective treatment and immune response stimulation for acute myeloid leukemia.
Patent Information
- Application Number
- CN202411177958.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-26
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2044-08-26
AI Technical Summary
Existing epigenetic drugs for the treatment of acute myeloid leukemia suffer from problems such as low utilization, drug resistance, and off-target effects, and the hypoxic microenvironment of leukemia affects drug sensitivity.
By employing biomimetic MOFs based on erythrocytes, and by coating the MOFs with erythrocyte membranes and loading them with dual epigenetic drugs CM272 and MA, we can target and regulate DNA methylation, histone methylation, and RNA methylation in leukemia cells, thereby enhancing the immune response and overcoming the hypoxic microenvironment.
It enhances the efficacy of leukemia immunotherapy, inhibits leukemia growth, stimulates long-lasting immune memory, prevents relapse, and maintains drug activity in hypoxic environments.
Smart Images

Figure CN119385975B_ABST
Abstract
Description
Technical Field
[0001] This application relates to a biomimetic MOF for red blood cells, its preparation method and application, belonging to the field of biomaterials technology. Background Technology
[0002] Acute myeloid leukemia (AML) is the most common hematologic malignancy in children. Standard chemotherapy often has limited efficacy, especially in elderly or high-risk patients, and is also accompanied by significant toxicity. There are few effective salvage options for relapsed or refractory cases, and the genetic heterogeneity of this disease complicates the development of targeted therapies. New treatment strategies, including targeted and immunotherapies, are urgently needed to improve efficacy and reduce treatment-related complications.
[0003] Epigenetic modifications affect gene expression patterns without altering the underlying DNA sequence. Dysregulation of epigenetic mechanisms, including DNA methylation, histone modifications, and RNA methylation, can suppress tumor suppressor genes and activate oncogenes crucial for leukemia transformation and disease progression, leading to leukemia. Aberrant DNA methylation and histone modifications are frequently observed in acute myeloid leukemia (AML) cells. Increased histone H3 lysine 9 (H3K9) methylation or DNA methylation (5-methylcytosine, 5mC) within the promoter region of tumor suppressor genes leads to transcriptional silencing, thereby enhancing leukemia cell survival and proliferation. Furthermore, alterations in N6-methyladenosine (m6A) modifications of mRNA transcripts encoding oncogenes, tumor suppressor factors, transcription factors, and signaling molecules disrupt normal RNA processing, resulting in the malignant phenotype of AML cells. Abnormal gene expression patterns are further exacerbated by dysregulation of the expression or activity of m6A regulators, particularly writing and erasing factors. In summary, dysregulated m6A methylation in acute myeloid leukemia disrupts normal hematopoietic differentiation, promotes the expansion of LSCs, and leads to increased malignancy and treatment resistance.
[0004] Therapies targeting epigenetic alterations, also known as "epigenetic therapy" (or epigenetic treatment), can reverse abnormal gene expression patterns and restore normal cellular function. These therapies target DNA methyltransferases (DNMT), histone methyltransferases, and m... 6Drugs that methylate A-RNA have shown promising efficacy in preclinical and clinical studies, improving treatment outcomes and patient survival, whether used as monotherapy or in combination with standard chemotherapy. ORY-1001 is an inhibitor of the lysine-specific histone demethylase KDM1A, inducing H3K4me2 accumulation on KDM1A target genes, leading to blastoblast differentiation and a reduction in LSCs. CM272 is a dual inhibitor of histone methyltransferases G9a and DNMT1, inhibiting cancer cell proliferation and promoting apoptosis in AML and other hematologic malignancies. Furthermore, CM272 induces immune cell death (ICD), releasing damage-associated molecular patterns (DAMPs) including ATP, HMGB-1, and CRT, leading to dendritic cell (DC) maturation and increased antigen processing and presentation by CD8+ T cells. Further elucidation of the complex interactions between epigenetic alterations in acute myeloid leukemia and other molecular abnormalities is needed to identify novel therapeutic targets and overcome drug resistance.
[0005] Nanoparticles offer significant advantages in cancer therapy, such as targeted drug delivery to tumor cells, improved drug solubility and controlled release, enhanced drug accessibility across biological barriers, precise imaging and diagnosis, personalized treatment strategies, support for combination therapies, and good biocompatibility and biodegradability. Self-therapeutic nanomaterials or nanocarriers loaded with epigenetic drugs such as enzyme inhibitors, siRNA, and microRNA can target factors and signaling pathways related to epigenetic signals, thereby achieving multifunctional cancer therapy. For example, glutathione (GSH)-imprinted nanoparticles loaded with amino acids (MA) (GNCIPP8MA) were designed and synthesized, which can specifically target LSCs and deplete intracellular GSH. GNCIPP8MA can induce ferrosenterism and m... 6 A-RNA methylation enhances the PD-L1 blockade-driven anti-leukemia immune response. A gold nanocomplex loaded with the anti-leukemia nucleotides AS1411 and miR-221 was synthesized, which selectively targets AML cells and inhibits leukemia progression by suppressing the DNMT1-mediated DNA methylation signaling pathway in the cell nucleus.
[0006] Cell membrane biomimetic nanoparticles provide a versatile platform for various biomedical applications, such as personalized medicine, cancer treatment, vaccination, and regenerative medicine. These nanoparticles, composed of lipid bilayers or membrane-derived vesicles, mimic the properties of cell membranes and the composition of surface proteins and lipids. This biomimetic design not only improves biocompatibility and reduces immunogenicity but also enables efficient and targeted drug delivery, immune evasion, and regulation of biological interactions. Our research group previously developed a nanocomposite material by hybridizing CuS / carbon dots with macrophage membranes (CuSCDB@MMT7) and adding a proteasome inhibitor to the particles. CuSCDB@MMT7 exhibited tumor selectivity while evading immune detection and induced hyperthermia under near-infrared light, leading to the accumulation of thermally stable polyubiquitinated tumor suppressor proteins. CuSCDB@MMT7-induced photothermal therapy enhanced tumor cell apoptosis and reduced metastasis. Recently, based on Mn... 2+ / Fe 3+ Metal-organic frameworks (MOFs) have been used to develop a biomimetic bimetallic nanoplatform called LSC for targeting DNA and RNA methylation in acute myeloid leukemia (AML) cells. These AFMMB particles enhanced the antigenicity of AML cells by upregulating MHC-I and downregulating PD-L1, leading to cytotoxic T cell recognition and clearance of these cells. Furthermore, AFMMBs inhibited metastasis in a mouse model of breast cancer, thus establishing their broad antitumor activity.
[0007] While treatment strategies targeting epigenetic disorders hold promise for leukemia, epigenetic drugs face several limitations, including low utilization rates, drug resistance, and off-target effects. Furthermore, the hypoxic microenvironment of leukemia further impacts drug sensitivity. Summary of the Invention
[0008] To address the problems of low utilization, drug resistance, and off-target effects in existing treatment strategies for epigenetic dysregulation of leukemia, as well as the hypoxic microenvironment of leukemia further affecting drug sensitivity, this application provides a biomimetic MOF based on erythrocytes, its preparation method, and its application. By targeting three epigenetic modifications, it simultaneously regulates DNA methylation, histone methylation, and RNA methylation in leukemia cells to enhance the immune response against acute myeloid leukemia. Furthermore, the biomimetic MOF microparticles overcome the hypoxic microenvironment of leukemia, enhance the therapeutic activity of loaded drugs, and induce the death of leukemia cells and leukemia mesenchymal stem cells. In addition, it not only stimulates T cell-mediated responses but also inspires durable immune memory, preventing leukemia relapse.
[0009] The technical solution adopted in this application is as follows:
[0010] A biomimetic MOF based on red blood cells includes drug-loaded MOFs and a red blood cell membrane layer coating the outside of the MOFs.
[0011] The MOFs are selected from UiO-66-NH2;
[0012] The UiO-66-NH2 is a microparticle with an amino functional group attached to UiO-66;
[0013] The drug-loaded MOFs contain dual epigenetic drugs;
[0014] The dual epigenetic drugs are CM272 and MA.
[0015] Optionally, the particle size of the drug-loaded MOFs is 140–160 nm.
[0016] According to another aspect of this application, a method for preparing the above-mentioned erythrocyte-based biomimetic MOFs is provided, comprising the following steps:
[0017] S1. Obtain UiO-66-NH2, then mix UiO-66-NH2 with a dual epigenetic drug and solvent, stir, separate, wash and dry to obtain drug-loaded MOFs;
[0018] The dual epigenetic drugs are CM272 and MA;
[0019] S2. Obtain the PBS solution for red blood cells;
[0020] S3. Add the drug-loaded MOFs to the PBS solution of red blood cells to obtain a mixture. Use an extruder to circulate and extrude the mixture to obtain the biomimetic MOFs based on red blood cells.
[0021] Optionally, in step S1, the method for obtaining UiO-66-NH2 includes: adding a zirconium propoxide solution to a mixture containing acetic acid and DMF, placing it in a sealed container, heating the mixture to react, then adding a linker to the product, stirring, separating, washing, and drying to obtain UiO-66-NH2.
[0022] Optionally, the concentration of the zirconium propoxide solution is 70 wt%, and the solvent is 1-propanol.
[0023] Optionally, the ratio of zirconium propoxide solution to acetic acid is 1 μL: 53–55 mL.
[0024] Optionally, the ratio of zirconium propoxide solution to DMF is 1 μL: 93–95 mL.
[0025] Optionally, the ratio of zirconium propoxide solution to binder is 1 μL: 1.1–1.3 mg.
[0026] Optionally, the binder is selected from 1,4-phthalate.
[0027] Optionally, the conditions for the heating reaction include: a reaction temperature of 120–140°C and a reaction time of 1–3 hours;
[0028] Preferably, the stirring conditions include: ultrasonic treatment for 20-40 seconds, followed by stirring at a speed of 150-300 rpm for 16-24 hours.
[0029] Optionally, in step S1, the weight ratio of UiO-66-NH2 to CM272 is 1:0.025 to 0.15.
[0030] Optionally, in step S1, the weight ratio of UiO-66-NH2 to MA is 1:0.025 to 0.15.
[0031] Optionally, in step S1, the solvent is selected from methanol.
[0032] Optionally, in step S2, the method for obtaining the PBS solution of red blood cells includes: placing a mouse blood sample into a container containing an anticoagulant, centrifuging to obtain the supernatant plasma, mixing the supernatant plasma with the PBS solution, and centrifuging again to obtain the PBS solution of the red blood cells.
[0033] Optionally, the ratio of drug-loaded MOFs to erythrocytes is 1 mg: 0.15 × 10⁻⁶. 7 ~0.25×10 7 indivual.
[0034] According to another aspect of this application, the use of the above-mentioned erythrocyte-based biomimetic MOFs or the erythrocyte-based biomimetic MOFs obtained according to the above preparation method as triple epigenetic regulators in the preparation of drugs that enhance anti-leukemia immunity is also provided.
[0035] Optionally, the triple epigenetic regulator targets 5mC DNA methylation, m 6 Epigenetic regulators that regulate A-RNA methylation and histone H3K9 methylation.
[0036] The beneficial effects that this application can produce include:
[0037] The biomimetic MOFs (MA272@MOF@RBC) based on red blood cells provided in this application enhance leukemia immunotherapy by adding CM272, MA, and oxygen-rich red blood cells to MOFs. They exhibit good biocompatibility, prolong blood circulation, evade immune system clearance, alleviate hypoxia, and inhibit downstream oncogenes of HIF-1α, thereby improving the efficacy of epigenetic drugs. These drugs enhance the efficacy of epigenetic drugs by inhibiting DNA and histone methylation and enhancing m...6 A-RNA methylation limits leukemia growth. Furthermore, MA272@MOF@RBC induces ICD and increases the antigenicity of AML cells by upregulating MHC-I and downregulating PD-L1, thereby activating cytotoxic T cells that can recognize and clear LSCs in the bone marrow niche. MA272@MOF@RBC also stimulates long-term immune memory, preventing leukemia relapse. Finally, MA272@MOF@RBC is also effective against liver tumors. This application reports for the first time the synthesis of a triple epigenetic regulatory biomimetic nanoplatform for tumor immunotherapy, demonstrating significant clinical potential. Attached Figure Description
[0038] Figure 1 The preparation and characterization of MA272@MOF@RBC in this application are as follows: (A) Schematic diagram of MA272@MOF synthesis; (B) TEM image of MA272@MOF; (C) Hydrated particle size of MA272@MOF; (D) X-ray diffraction (XRD) analysis of MA272@MOF; (E) X-ray photoelectron spectroscopy (XPS) analysis of MA272@MOF; (F) C1s peak in high-resolution XPS spectrum; (G) N1s peak; (H) O1s peak; (I) Zr peak. 3d peak; (J) is the elemental spectrum of MA272@MOF; (K) shows the morphological characteristics of mouse erythrocytes after Giemsa staining; (L) is a schematic diagram of the preparation of MA272@MOF@RBC; (M) is a photograph of the solution containing MA272@MOF and MA272@MOF@RBC; (N) is the Zeta potential of MA272@MOF and MA272@MOF@RBC; (O) is an SDS-PA gel image showing the total protein in MA272@MOF@RBC; (P) is a flow cytometry histogram showing the expression of cell membrane protein CD47 on MA272@MOF@RBC; (Q) is the quantitative analysis of CD47 in (K).
[0039] Figure 2To demonstrate the selective targeting of MA272@MOF@RBC to acute myeloid leukemia (AML) and leukemia stem cells in this application: (A) Schematic diagram of the synthesis of fluorescently labeled MA272@MOF@RBC; (B) Confocal image showing the uptake of MA272@MOF@RBC by AML or normal cells, scale bar = 50 μm; (C) Quantitative assessment of cellular uptake of MA272@MOF@RBC or MA272@MOF by ICP; (D) Schematic diagram of the establishment and in vivo distribution assessment of a mouse AML model; (E) MA272@MOF@RBC. Distribution in leukemia mice; (F) Fluorescence enrichment detection of MA272@MOF@RBC in the tibia of leukemia mice; (G) Fluorescence signal of MA272@MOF@RBC in LSCs in mouse bone marrow as shown by flow cytometry; (H) Detection of MA272@MOF@RBC-induced apoptosis in AML cells; (I) Evaluation of the effect of MA272@MOF@RBC on AML cell viability by CCK-8 cell proliferation assay. One-way ANOVA and Tukey test, *P<0.05, **P<0.01, ***P<0.001.
[0040] Figure 3 This application describes the following: (A) MA272@MOF@RBC regulation of epigenetic modifications in AML cells; (B) Dot blot or immunoblotting showing DNA methylation, histone methylation, and RNA methylation in C1498 cells of a specified group; (C) Transcriptional activity of STING in a specified group; (D) IFN-β level in the culture supernatant of the indicator group; (E) Flow cytometry analysis of MHC-I expression in the specified group; (F) HMGB-1 protein level in the culture supernatant of the indicator group; (G) m6A-PD-L1 transcription level in the specified group; and (V) PD-L1 mR in the specified group. (H) Flow cytometry quantification of PD-L1 expression on cell surface; (I) Immunoblotting showing HIF-1α expression in C1498 cells treated with MA272@MOF@RBC or MA272@MOF@LM under CoCl2-induced hypoxia; (J) Transcriptional level of DNMT3a in the specified group; (K) Cell viability in the specified group; (L) Schematic diagram of the triple epigenetic regulatory mechanism of MA272@MOF@RBC on AML. One-way ANOVA and Tukey test, *P<0.05, **P<0.01.
[0041] Figure 4This application demonstrates the following: (A) MA272@MOF@RBC inhibits leukemia growth, induces T cell activation and immune memory in vivo; (B) Establishment of an acute myeloid leukemia mouse model; (C) White blood cell counts in each group over 24 days; (D) Survival curves for mice in the specified groups; (E) Leukemia inhibition rate in the specified groups; (F) Giemsa staining of bone marrow cells, scale bar = 50 μm; (G) Quantitative analysis of leukemia cells in bone marrow cells in E; (H) Representative images of spleen (scale bar = 0.5 cm) and HE-stained tissue sections (scale bar = 50 μm) from the specified groups of mice; (I) Spleen weight in the specified groups; (D) LSCs (CD34) in the bone marrow of the specified groups. + CD38 + (J) represents the percentage of MHC-I and PD-L1 expressed in leukemia cells by flow cytometry; (K) represents the expression of PD-L1 in leukemia cells; (L) represents the serum HMGB-1 level in the specified group; (M) represents the percentage of mature DCs (CD80+CD86+) in the spleen of the specified group; (N) represents the percentage of CD8+ T cells in the bone marrow of the specified group; (O) represents the percentage of effector memory T cells (CD44+CD62L-) in the spleen of the specified group; (P) represents the establishment of a leukemia rechallenge model; (Q) represents the white blood cell count in the specified group after rechallenge; (R) represents the survival curve of leukemia mice after rechallenge; (S) represents a schematic diagram of the mechanism by which MA272@MOF@RBC activates T cells; one-way ANOVA and Tukey test, *P<0.05, **P<0.01.
[0042] Figure 5 The following data represent the immunotherapeutic effects of MA272@MOF@RBC on liver tumors: (A) Establishment of mouse H22 liver tumor models and rechallenge models; (B) Tumor growth curves for each group; (C) Survival time for specified groups; (D) Tumor inhibition rate for specified groups; (E) Photographs of mice with tumors; (F) Representative images of PCNA immunostaining and HE staining of tumor tissues, scale bar = 50 μm; (G) Quantitative expression of PCNA in tumor tissues of specified groups; (H) Body weight of mice in specified groups; (I) Tumor growth curves after rechallenge; (J) Survival time of mice after rechallenge; One-way ANOVA and Tukey test, *P<0.05, **P<0.01.
[0043] Figure 6 For the pore size test of UiO-66-NH2 in this application, (A) is the N2 adsorption-desorption isotherm; (B) is the pore size distribution.
[0044] Figure 7 This application describes the loading efficiency and loading capacity of MA and CM272 in MA272@MOF.
[0045] Figure 8 The cell viability of LO2 or primary normal bone marrow (NBM) cells treated with different concentrations of MA272@MOF@RBC for 48 hours is shown in this application.
[0046] Figure 9 The data represent the body weights of mice with acute myeloid leukemia in different groups in this application. The data are expressed as mean ± SD (n = 6).
[0047] Figure 10 The data represent the IFN-γ levels in different groups of acute myeloid leukemia mice according to this application. Data are expressed as mean ± SD (n = 6). One-way ANOVA and Tukey's test were performed. *P < 0.05.
[0048] Figure 11 For the flow cytometry analysis of LSCs (CD34) in bone marrow cells of the C1498-carrying mouse model, this application was submitted. + CD38 - ( ), gating strategies for leukemia blastocysts, CD3+CD8+ T cells, effector memory T cells, and MHC-I and PD-L1 expression.
[0049] Figure 12 This is a schematic diagram illustrating the use of biomimetic MOFs based on erythrocytes as triple epigenetic regulators to enhance anti-leukemia immunity, as described in this application. Detailed Implementation
[0050] The present application is described in detail below with reference to the embodiments, but the present application is not limited to these embodiments.
[0051] Unless otherwise specified, all raw materials used in the embodiments of this application were purchased through commercial channels.
[0052] The zirconium propoxide solution was obtained from Aladdin (70 wt% concentration, 1-propanol as solvent).
[0053] Unless otherwise specified, all test methods are standard and all instrument settings are those recommended by the manufacturer.
[0054] Loading capacity (LC) and encapsulation efficiency (EE) were obtained by high-performance liquid chromatography (HPLC) on a C18 column. The loading capacity (LC) and encapsulation efficiency (EE) of MA and CM272 in MA272@MOF@RBC were evaluated. The calculation method is as follows:
[0055]
[0056] Material characterization:
[0057] The morphology of the nanoparticles was evaluated using a JEOL JSM-6700F scanning electron microscope (SEM) and a transmission electron microscope (TEM, a Philips-FEITecnai G2S-Twin microscope equipped with a 200 kV field emission gun); the nitrogen adsorption-desorption isotherm at 77 K was calculated using a Micromeritics 2020 analyzer; powder X-ray diffraction (PXRD) patterns were obtained using a Rigaku D-Max 2550 diffractometer and CuKα radiation. The data were obtained in the range of 3° to 44°; Fourier transform infrared spectra in the 400–4000 cm⁻¹ region were obtained using a Bruker IFS 66V / S Fourier transform infrared spectrometer and KBr spheres; X-ray photoelectron spectroscopy (XPS) data were collected using an ESCALAB 250 spectrometer.
[0058] In the experiments described in this application, a PBS solution containing biomimetic MOFs based on erythrocytes was prepared at a therapeutic cell concentration of 50 μg / ml.
[0059] Cell culture:
[0060] C1498 cells were purchased from the U.S. Tissue Culture Collection and cultured in Dulbecco Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum at 37°C and 5% carbon dioxide. The H22 cell line was purchased from Wuhan Precissor Biotechnology Co., Ltd.
[0061] Cell uptake assay of MA272@MOF@RBC:
[0062] With 1×10 per hole 5 Cells were seeded at a density of 100 cells / well in 24-well plates and cultured overnight. After replacing the medium with fresh medium containing Cy3-labeled MA272@MOF@RBC nanoparticles, cells were cultured for 30 minutes, harvested, and sliced into thin sections using a cell slicer. Cells were washed with PBS and fixed with 4% paraformaldehyde (PFA) for 15 minutes, followed by nucleus staining with DAPI. Cells were observed using a confocal laser scanning microscope (Nikon). Intracellular uptake of MA272@MOF@RBC nanoparticles was also quantified by measuring Zr content in the cells using a Perkin-Elmer NEXION 300×ICP mass spectrometer.
[0063] In vitro cytotoxicity assay:
[0064] Cytotoxicity was assessed using the Cell Counting Kit-8 (CCK8; Dojindo Molecular Technologies). In short, cells were seeded into 96-well plates and treated with different nanoparticles for 48 hours. CCK-8 assays were performed according to the kit instructions, with absorbance measured at 450 nm using a BioTek Epoch microplate reader. Apoptosis was detected by Annexin V and PE staining, and the number of apoptotic cells was determined by flow cytometry.
[0065] Western blot:
[0066] Cells that had been adequately treated were lysed with cold protein lysis buffer and 1% phosphatase inhibitor (CellSignaling Technology) was added. Protein samples from each group were separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Millibert & Co., Inc.). After blocking with 5% skim milk for 1 hour, the PVDF membranes were incubated overnight at 4°C with anti-β-actin (sc-47778, Santa Cruz Biotechnology) and anti-HIF-1α (14179, Cell Signaling Technology) antibodies. The membranes were then probed with horseradish peroxidase-conjugated secondary antibody. Bands were observed using an ECL kit and imaged using a gel imaging system. Band density relative to β-actin was quantified using ImageJ software.
[0067] 5mC or m6A point imprint detection:
[0068] 5mC or m6A dot blot detection was performed according to the previously described protocol. In short, DNA or mRNA samples were denatured in NaOH at 100°C for 10 minutes, then mixed with an equal volume of cold ammonium acetate. Dot blot analysis was performed using a Bio-Dot instrument (Bio-Rad) system with either anti-5mC antibody (AHP1826Z, Bio-Rad) or anti-m6A antibody (202003, Synaptic Systems) and a secondary antibody bound to horseradish peroxidase. The signal was detected using enhanced chemiluminescence.
[0069] qPCR of methylated RNA transcripts:
[0070] Using MagnaMeRIP TMThe m6A kit (17-10499, Millipore) was used for qPCR analysis of m6A-methylated RNA transcripts according to the manufacturer's instructions. In short, RNA samples were lysed and immunoprecipitated with 5 μl of anti-m6A antibody, followed by capture of the RNA-protein complex using magnetic beads. The bound RNA was eluted from the beads with N6-methyladenosine, and then quantitative RT-PCR was performed. The primer sequences were: mouse PD-L1 (3'UTR), SEQ ID NO.1: 5'-CCT GAGGGAGAGAACCAAGA (forward), SEQ ID NO.2: 5'-GGCACTGAGC AGAGGAAAAG (reverse).
[0071] mRNA stability assay:
[0072] Appropriately treated cells were seeded into 12-well plates and treated with actinomycin D (5 μg / mL, Sigma) for different time periods. RNA was extracted at specified time intervals and analyzed by qPCR. The half-life of mRNA was determined using linear regression analysis. Primer sequences were: mouse GAPDH, SEQ ID NO.3: 5'-GCAAAGTGGAGATTGTTG (forward), SEQ ID NO.4: 5'-AGTGGAGTCATACTGGAA (reverse); mouse PD-L1 (CDS), SEQ ID NO.5: ATCCATCCTGTTGTTCCT (forward), SEQ ID NO.6: CACATCTAGCATTCTCACTT (reverse).
[0073] Establishing a mouse model of acute myeloid leukemia:
[0074] Male C57BL / 6N or Balb / c mice aged 4-6 weeks were purchased from Charles River and housed in a pathogen-free environment. The research protocol was approved by the Ethics Committee of Jilin University, and all animal experiments were conducted in accordance with the guidelines established by the Animal Conservation and Use Committee of Jilin University. The establishment of the AML model was as described previously. C57BL / 6N mice were intravenously injected with 0.5 × 10⁶ C1498 cells, and their white blood cell (WBC) counts were routinely monitored. Blood was drawn from the tail vein, and 2 μL of blood sample was diluted with 38 μL Turk blood diluent (Ricca Chemical). The white blood cell count was performed under a microscope. After confirming leukemia based on the white blood cell count, mice were intraperitoneally injected with 50 μg / mL nanoparticles three times a week for two weeks. Mice were randomly assigned to three groups: a PBS group, a CM272+MA group (60 μM MA and 1 μM CM272, equivalent to the dose in MA272@MOF@RBC), and a MA272@MOF@RBC group (n=6 in each group). White blood cell counts were monitored to assess treatment response, as described above. Mice were euthanized once they exhibited symptoms such as respiratory distress, weight loss, or lethargy. Spleen weight and the number of metastatic nodules were assessed at the end of each experiment. In the C1498 rechallenge experiment, surviving mice were challenged again with 10 × 10⁶ C1498 cells on day 24; all mice were euthanized once the first mouse reached the endpoint.
[0075] Establishing a mouse liver tumor model:
[0076] H22 cells (1 × 10⁶) were subcutaneously injected into the right abdomen of male Balb / c mice. When the tumor volume reached approximately 200 mm³, the mice were randomly assigned to three groups: a PBS group, a CM272+MA group (60 μM MA and 1 μM CM272, equivalent to the dose in MA272@MOF@RBC), and a MA272@MOF@RBC group (n = 6 in each group). Nanoparticles were injected intraperitoneally at a dose of 50 μg / mL, three times a week for two weeks. Tumor size and body weight were measured every three days. Tumor volume was calculated using the formula: 1 / 2 × (length × width²). Mice were monitored for survival until 80 days after the first injection. Euthanasia was performed once the tumor volume exceeded 2000 mm³. Complete response (CR) or 100% tumor growth inhibition was defined as a tumor volume below 20 mm³ (lower limit of detection). On day 20, 1 × 10⁶ H22 cells were induced again in the left abdomen of each mouse to assess immune memory. Tumor-related parameters were assessed at 20 and 80 days post-transplantation.
[0077] Immunohistochemistry and H&E staining:
[0078] Tumor tissue was fixed in 10% neutral buffered formalin, embedded in paraffin, and cut into 5 μm thick sections. Immunohistochemistry (IHC) and hematoxylin and eosin (H&E) staining were performed according to standard protocols. For immunohistochemical staining, tissue sections were deparaffinized, rehydrated, and antigen recovered, then incubated overnight with anti-PCNA antibody (#12727, Cell Signaling Technology). Sections were imaged under a Nikon confocal fluorescence microscope.
[0079] Analysis of in vivo immune response:
[0080] After euthanasia of mice, lymph nodes, spleen, and bone marrow extruding from tumors were harvested, homogenized, and used to obtain single-cell suspensions. Cells were stained with anti-CD45 (FITC), anti-CD3 (Brilliant Violet 785), and anti-CD8 (Alexa Fluor 700) antibodies (Bio Legend) to recognize CD8. + T cells; mature dendritic cells (DCs) were detected using anti-CD11c (PerCP / Cy5.5), anti-CD80 (APC), and anti-CD86 (Brilliant Violet 421) antibodies (BioLegend). Lymph node T cells were stained with anti-CD62L (Brilliant Violet 605) and anti-CD44 (APC / Cy7) antibodies (BioLegend) to differentiate between central memory T cells and effector memory T cells. Anti-PD-L1 (BV711, BioLegend) and anti-MHCI (BV510, BioLegend) were used to detect cell membrane protein expression. HMGB-1 expression in bone marrow cells was quantified using ELISA. Serum samples were also collected, and IFN-γ levels were detected using a specific ELISA kit (Thermo Fisher Scientific) according to the manufacturer's instructions.
[0081] Biomass distribution within the body:
[0082] Mice were euthanized 12 hours after administration (3 mice at each time point). Bone marrow, heart, liver, spleen, lungs, and kidneys were harvested, weighed, and digested in aqua regia at 80°C for 3 days. Silicon content in the samples was analyzed by ICP-AES (Perkin-Elmer Optima 3300 DVICP spectrometer). For flow cytometry analysis, bone marrow cells were collected and filtered through a 40-μm nylon mesh filter (Corning). Leukemia stem cells (CD34) were analyzed using a BDL SFR Ortessa flow cytometer and FlowJo software (FlowJo, v.10.8). + CD38 + ).
[0083] Statistical analysis:
[0084] Kaplan-Mill survival curves were generated and analyzed using the log-rank test. Sample sizes for each study were determined through prior literature and well-characterized experiments to ensure sufficient statistical power for comparing experimental and control outcomes. Unless otherwise specified, in vitro experiments were performed at least three times. One-way ANOVA and Tukey post-tests were used for comparisons among multiple groups. All analyses were performed using GraphPadPrism 9 software. All p-values were two-tailed, and p < 0.05 was considered statistically significant.
[0085] Example 1: Preparation of MA272@MOF@RBC
[0086] (1) Synthesis of MA272@MOF
[0087] A schematic diagram of the synthesis process is shown below. Figure 1 As shown in Figure A, a mixture of 75 μL of zirconium propoxide solution, 4 mL of acetic acid, and 7 mL of DMF was placed in a scintillation flask with an aluminum block, heated at 130 °C for 2 h, and then cooled to room temperature to obtain hexanuclear zirconium oxide clusters. Subsequently, 82 mg of 1,4-phthalic acid ester (BDC) linker was added, and the mixture was sonicated for 30 s and stirred at 200 rpm at 25 °C for 18 h to synthesize the product UiO-66-NH2. The product was centrifuged at 6000 rpm for 15 min, washed twice with DMF and ethanol, and dried in a vacuum oven at 30 °C to obtain UiO-66-NH2 nanoparticles.
[0088] 100 mg UiO-66-NH2 nanoparticles were mixed with 10 mg MA and 10 mg CM272 in 5 mL of methanol solvent and stirred at 500 rpm for 6 h to obtain the product MA272@MOF solution. The product was centrifuged at 6000 rpm for 15 min, washed twice with DMF and ethanol, and dried in a vacuum oven at 30 °C to obtain MA272@MOF nanoparticles.
[0089] (2) Separation of red blood cells
[0090] Mouse blood samples were collected and placed in sterile tubes containing EDTA. The samples were centrifuged at 1500×g for 10 min at room temperature. The plasma layer was carefully aspirated, and the red blood cell granules were resuspended in PBS and centrifuged once. Red blood cell counts were determined by flow cytometry, and the cells were stored in PBS at 4°C.
[0091] (3) Synthesis of MA272@MOF@RBC
[0092] A schematic diagram of the synthesis process is shown below. Figure 1 As shown in L, 5 mg of MA272@MOF nanoparticles were mixed with 200 μL of 1×10⁻⁶ mol / L water. 7Red blood cells were mixed with PBS solution and extruded for 20 cycles using an Avanti mini extruder (AvantiPolarLipids). The cells were then washed twice with 4000g PBS for 20 min each time. To confirm the red blood cell coating, the total protein profile of the MA272@MOF@RBC particles was analyzed by SDS-PAGE, and the surface expression of CD47 was detected by flow cytometry.
[0093] Test Example 1: Preparation and Characterization of MA272@MOF@RBC
[0094] In Example 1, a representative MOF, UiO-66, was prepared as a drug carrier using a room-temperature synthesis method. This method can prevent the encapsulated bimolecular drug from losing its activity. UiO-66 has a durable structure composed of zirconium (Zr) ions linked by 1,4-phthalic acid, and exhibits high specific surface area, large porosity, customizable properties, and good biocompatibility. Figure 6 The N2 adsorption / desorption isotherms and pore size distribution of UiO-66 are shown. The specific surface area and total pore volume of UiO-66 are 855.6896 m². 2 / g and 0.256683cm 3 g -1 The dual epigenetic drugs CM-272 and MA were loaded into the core of a UiO-66 to obtain MA272@MOF particles. The loading capacity was tested using the method of Example 1, adjusting different weight ratios of MA, CM272, and MA272@MOF. The maximum loading efficiency of CM272 and MA was 98.5% when the mass ratio of MA272@MOF was 0.1:0.1:1; and 37.5% when the mass ratio was 1:1:1. Figure 7 The relatively high dual drug loading capacity can be attributed to the large pore structure of UiO-66. Transmission electron microscopy (TEM) measurements determined the size of MA272@MOF to be 150 ± 9.4 nm in diameter. Figure 1 B, C). X-ray diffraction (XRD) patterns of UiO-66 and MA272@MOF confirm that the structure of the MOF remains unchanged after loading the bimolecular drug. Figure 1 D). Elemental distribution as measured by X-ray photoelectron spectroscopy (XPS) Figure 1 EI) and TEM elemental spectrum ( Figure 1 J) was evaluated. To prepare MA272@MOF@RBC particles, erythrocytes were isolated from mouse peripheral blood. Erythrocytes have a characteristic biconcave disc shape ( Figure 1 K) facilitates the efficient binding of oxygen and the exchange of carbon dioxide, and maximizes the surface area for gas diffusion. After coating with red blood cells, the color of the MA272@MOF@RBC solution changes from milky white to pale red. Figure 1 Furthermore, the potential reversal of MA272@MOF@RBC is -14.4±2.7mV (M). Figure 1 This may be because the negative potential of the red blood cell membrane maintains the ion balance inside and outside the cell.
[0095] The protein profile of MA272@MOF@RBC is comparable to that of erythrocytes, which clearly indicates that erythrocyte membrane proteins are retained in MA272@MOF@RBC. Figure 1 In addition, MA272@MOF@RBC also expresses high levels of CD47, a characteristic marker of erythrocytes. Figure 1 In summary, this demonstrates the successful synthesis of a erythrocyte-based biomimetic MOF carrying two epigenetic drugs.
[0096] Test Example 2: Targeting capability of MA272@MOF@RBC
[0097] To evaluate the ability of MA272@MOF@RBC to specifically target leukemia cells, its uptake in normal bone marrow cells and C1498 cells was tracked: MA272@MOF@RBC was mixed with Cy3 or Cy7 to fuse and encapsulate cells with MA272@MOF@RBC nanoparticles. Figure 2 A). C1498 or LSCs incubated with Cy3-labeled MA272@MOF@RBCs emitted a strong red fluorescent signal, while normal bone marrow cells showed very little fluorescence. Figure 2 (B) This indicates that MA272@MOF@RBC nanoparticles have higher selectivity for leukemia blasts. Furthermore, C1498 cells treated with MA272@MOF@RBC had significantly higher zirconium content compared to C1498 cells treated with MA272@MOF, confirming that erythrocyte coating promotes the uptake of MA272@MOF@RBC nanoparticles by cells. Figure 2 C). The in vivo biodistribution of MA272@MOF@RBC nanoparticles was analyzed in a C1498-induced acute myeloid leukemia mouse model. Figure 2 D). Furthermore, compared to the MA272@MOF group, the MA272@MOF@RBC group showed significantly increased Zr content in peripheral blood mononuclear cells and bone marrow, indicating targeted delivery (…). Figure 2 E). To achieve sustained remission and improve prognosis in leukemia patients, selective ablation of hematopoietic stem cells is essential. Therefore, we analyzed the in vivo biodistribution of MA272@MOF@RBCs using in vitro and in vivo fluorescence imaging and flow cytometry. Flow cytometry analysis was used to analyze LSCs (CD34) in bone marrow cells of a C1498-carrying mouse model. + CD38 -The gating strategy for leukemia blastocysts, CD3+CD8+ T cells, effector memory T cells, and MHC-I and PD-L1 expression is as follows: Figure 11 As shown. In bone marrow cells ( Figure 2 F) and CD34 + CD38 - LSCs( Figure 2 Elevated Cy7 fluorescence signals were observed in both G and R cells, confirming the precise targeting ability of MA272@MOF@RBC for leukemia. MA272@MOF@RBC also induced AML cell apoptosis in a dose-dependent manner, with an IC50 of 33.4 ± 5.6 μg / mL. Figure 2 H, I), but at the same concentration, the cytotoxicity to LO2 cells and normal monocytes is negligible. Figure 8 In summary, MA272@MOF@RBC can selectively inhibit AML cells at relatively low doses.
[0098] Triple epigenetic regulatory mechanism of test case 3 MA272@MOF@RBC
[0099] To elucidate the epigenetic regulatory role of MA272@MOF@RBC, the methylation of 5mCDNA in C1498 cells under different treatments and m... 6 A-RNA methylation and histone H3K9 methylation were evaluated: For example Figure 3 As shown in Figure A, MA272@MOF@RBC significantly reduced 5mC DNA methylation and H3K9me histone methylation, and increased m 6 A-RNA methylation. DNMT1 epigenetic silencing of STING in cancer cells plays a crucial role in tumor immune evasion and anti-immunotherapy. Furthermore, H3K9me2-mediated epigenetic regulation can activate type I IFN responses and promote ICD. Additionally, MA272@MOF@RBC also induces MHC-I expression in C1498 cells (…). Figure 3 D), and releases the ICD marker HMGB-1 into the serum. Figure 3 E). Multiple oncogenes, such as PD-L1 and cMYC, can be detected through m 6 A-RNA modification is regulated. PD-L1 is frequently upregulated in acute myeloid leukemia cells and inhibits T cell activity by binding to the PD1 receptor on T cells. In fact, MA272@MOF@RBC increases the abundance of m6A residues in C1498 cells. Figure 3 F), which corresponds to the significant downregulation of PD-L1 transcripts ( Figure 3 G). Accelerated decay of PD-L1 mRNA leads to reduced surface expression of PD-L1 protein. Figure 3 H).
[0100] Test Case 4: MA272@MOF@RBC inhibits the HIF-1α signaling pathway and alleviates hypoxia symptoms.
[0101] Hypoxia is a characteristic feature of leukemia niches, triggering the activation of HIF-1α and other genes that play a crucial role in regulating cellular responses to low oxygen levels. Furthermore, hypoxia-induced gene expression is a key factor determining drug resistance in leukemia cells. To verify that MA272@MOF@RBC can improve the hypoxic microenvironment of leukemia by transporting oxygen via erythrocytes, acute myeloid cells (AML) were exposed to a hypoxic environment in vitro using CoCl2. CoCl2-induced hypoxia stabilized HIF1-α protein in AML cells. Although the combination of MA and CM272 did not downregulate HIF-1α, even MA272@MOF particles loaded with leukemia cell membranes (MA272@MOF@LM) had no effect. On the other hand, MA272@MOF@RBC significantly reduced CoCl2-mediated HIF1-α stabilization. Figure 3 I). like Figure 3 As shown in K, compared with MA272@MOF@LM, MA272@MOF@RBC significantly reduced the survival rate of AML cells under hypoxic conditions, which can be attributed to its ability to alleviate hypoxia. In summary, MA272@MOF@RBC can overcome the hypoxic environment of acute myeloid leukemia (AML) and improve the therapeutic effect by inhibiting the HIF1-α signaling pathway. Moreover, the triple epigenetic regulatory activity of MA272@MOF@RBC can induce apoptosis in AML cells and enhance the recognition ability of immune cells. Figure 3 L).
[0102] Test Example 5: Inhibition of Leukemia Growth by MA272@MOF@RBC in Vivo
[0103] To verify the in vitro experimental results, the anti-leukemic effect of MA272@MOF@RBC was tested in a C1498-induced acute myeloid leukemia mouse model. Figure 4 A): When the mouse white blood cell (WBC) count reaches 250 x 10⁻⁶ 9 At a concentration of 99.9 g / L, patients were randomly assigned to four groups: PBS, MOF@RBC, MA272@MOF@LM, CM272+MA, and MA272@MOF@RBC, and treated with the corresponding formulations for 80 days. Changes in white blood cell count, survival rate, and leukemia growth inhibition rate over time in different treatment groups are shown in the figures below. Figure 4BD. We observed a rapid increase in white blood cell count in mice treated with PBS within 24 days, with all mice dying within 33 days. Similarly, MOF@RBC did not inhibit leukemia progression, indicating that MOF and erythrocytes had no therapeutic effect. The combination of CM272 and MA achieved only 21.6% LGI and extended the survival time of leukemia mice by 15 days. This suggests that even when used in combination, small molecule drugs have limited in vivo utilization and highlights the need for suitable drug delivery systems. The LGI rate and survival time in the MA272@MOF@LM group were 33.5% and 51 days, respectively. Therefore, consistent with the aforementioned in vitro results, MA272@MOF@LM failed to overcome the hypoxic microenvironment of leukemia, thus limiting the efficacy of epigenetic drugs. On the other hand, MA272@MOF@RBC achieved a 93.8% inhibition rate of leukemia growth and a 100% survival rate within 90 days. Furthermore, MA272@MOF@RBC significantly inhibited pathological markers of leukemia, such as leukemia cell proliferation and splenomegaly. Figure 4 EH). Hematopoietic stem cells are a major cause of leukemia relapse because they reside in the hypoxic niche of the bone marrow, making targeted therapy with conventional drugs difficult. For example... Figure 4 As shown in Figure I, MA272@MOF@RBC eliminated 90.2% of leukemia stem cells, thanks to the efficient delivery of the drug to the bone marrow and precise targeting of stem cells using a red blood cell-based MOF nanocarrier. No significant weight loss was observed in any group, reflecting the good biocompatibility of the different MA272@MOF@RBC nanoparticles. Figure 9 ).
[0104] Test Example 6: Enhancement of T cell activation and immune memory response by MA272@MOF@RBC
[0105] The potential immune mechanism of MA272@MOF@RBC was further investigated in vivo. Consistent with in vitro results, MA272@MOF@RBC significantly upregulated MHC-I ( ) on leukemia cells in mouse bone marrow. Figure 4 J), downregulate PD-L1 ( Figure 4 K), thereby enhancing immunogenicity. The elevated HMGB-1 levels in the serum of these mice further confirmed the activation of ICD (K). Figure 4 L). Increased antigenicity of leukemia cells directly triggers the maturation of dendritic cells (DCs), as evidenced by the upregulation of co-stimulatory molecules CD80 and CD86 (L). Figure 4 M), leading to cytotoxic CD8 + T cell amplification ( Figure 4 Increased production of N) and IFN-γ Figure 10 Memory T cells play a crucial role in adaptive immunity, providing durable protection against previously encountered pathogens. For example... Figure 4 As shown in Figure O, compared with other groups, the number of central memory T cells (CD8+CD44+CD62L-) in the spleen cells of mice treated with MA272@MOF@RBC was significantly increased, indicating that MA272@MOF@RBC treatment can stimulate strong immune memory. To determine whether MA272@MOF@RBC can provide long-term anti-leukemia immunity, mice were treated again with C1498 cells (…). Figure 4 When untreated mice were challenged with 10 × 10⁶ C1498 cells, white blood cell counts increased rapidly, and all mice died within 20 days of C1498 rechallenge. In contrast, mice treated with MA272@MOF@RBC showed no leukemia growth after rechallenge, and all mice survived to day 90 after C1498 rechallenge. Figure 4 Q, R). In summary, MA272@MOF@RBC improves the efficacy of immunotherapy for leukemia by promoting T cell activation and enhancing immune memory responses.
[0106] Test Example 7: Inhibition of Liver Tumor Growth by MA272@MOF@RBC in Vivo
[0107] Since epigenetic mechanisms regulate immune responses to various cancers, including liver tumors, a mouse liver tumor model was established by orthotopic injection of H22 cells to investigate the therapeutic effects of MA272@MOF@RBC on liver cancer. The mice with tumors were then treated with PBS, CM272+MA, and MA272@MOF@RBC for 80 days. Figure 5 A). Figure 5 BE (Beta-Brain) data showed tumor growth curves, survival time, and tumor growth inhibition rate (TGI). CM272 and MA inhibited the growth of hepatocellular carcinoma. Furthermore, the survival time of mice in the CM272+MA group was 53 days, compared to only 41 days in the control group. MA272@MOF@RBC almost ablated the tumor, achieving a TGI rate as high as 92.9%, with a total survival rate of 100% by day 80. In situ expression of proliferating cell nuclear antigen in tumor tissues of each group further confirmed these results. Figure 5 F). Furthermore, the histological changes in the tumor were consistent with the growth patterns in different treatment groups (F). Figure 5 G). No significant weight loss was observed in any group, indicating that the different treatment methods have good biocompatibility. Figure 5H). Tumor recurrence is one of the leading causes of death in liver cancer patients. Therefore, to verify whether MA272@MOF@RBC can also induce an immune memory effect against liver tumors, mice were rechallenged after surgical resection of the primary tumor. Secondary tumors in both the control group and the CM272+MA group were not significantly suppressed, and all mice died within 43 days. In contrast, no tumors were found in mice treated with MA272@MOF@RBC after rechallenging. Figure 5 I), all mice survived to day 80 ( Figure 5 J). In summary, MA272@MOF@RBC can effectively inhibit liver tumors and induce a long-term protective immune response. A schematic diagram of this application using erythrocyte-based biomimetic MOFs (MA272@MOF@RBC) as a triple epigenetic regulator to enhance anti-leukemia immunity is shown below. Figure 12 As shown.
[0108] The above description is merely a few embodiments of this application and is not intended to limit this application in any way. Although this application discloses preferred embodiments as described above, it is not intended to limit this application. Any changes or modifications made by those skilled in the art without departing from the scope of the technical solution of this application using the disclosed technical content are equivalent to equivalent implementation cases and fall within the scope of the technical solution.
Claims
1. A biomimetic MOF based on erythrocytes, characterized in that, This includes drug-loaded MOFs and the erythrocyte membrane layer coating the outside of the MOFs; The MOFs are UiO-66-NH2 particles with a particle size of 140-160 nm; The UiO-66-NH2 is a microparticle with an amino functional group attached to UiO-66; The drug-loaded MOFs contain dual epigenetic drugs; The dual epigenetic drugs are CM272 and MA, and the structure of MA is as follows: The weight ratio of UiO-66-NH2 to CM272 is 1:0.025-0.15, and the weight ratio of UiO-66-NH2 to MA is 1:0.025-0.
15. The erythrocyte-based biomimetic MOFs serve as triple epigenetic regulators, simultaneously regulating 5mCDNA methylation, m... 6 A-RNA methylation and histone H3K9 methylation enhance immunity against leukemia.
2. The method for preparing biomimetic MOFs based on erythrocytes as described in claim 1, characterized in that, Includes the following steps: S1. Obtain UiO-66-NH2, then mix UiO-66-NH2 with a dual epigenetic drug and solvent, stir, separate, wash and dry to obtain drug-loaded MOFs; The dual epigenetic drugs are CM272 and MA; S2. Obtain the PBS solution for red blood cells; S3. Add the drug-loaded MOFs to the PBS solution of red blood cells to obtain a mixture. Use an extruder to circulate and extrude the mixture to obtain the biomimetic MOFs based on red blood cells.
3. The preparation method according to claim 2, characterized in that, In step S1, the method for obtaining UiO-66-NH2 includes: adding zirconium propoxide solution to a mixture containing acetic acid and DMF, placing it in a sealed container, heating the mixture to react, then adding a linker to the product, stirring, separating, washing, and drying to obtain UiO-66-NH2.
4. The preparation method according to claim 3, characterized in that, The zirconium n-propoxide solution has a concentration of 70 wt% and uses 1-propanol as the solvent. The volume ratio of zirconium propoxide solution to acetic acid is 1 μL: 53~55 mL; The volume ratio of zirconium propoxide solution to DMF is 1 μL: 93~95 mL; The ratio of zirconium propoxide solution to binder is 1 μL: 1.1~1.3 mg; The linker is selected from 2-amino-1,4-phthalate esters; The conditions for the heating reaction include: a reaction temperature of 120~140℃ and a reaction time of 1~3h; The stirring conditions include: ultrasonic treatment for 20-40 seconds, followed by stirring at a speed of 150-300 rpm for 16-24 hours.
5. The preparation method according to claim 2, characterized in that, In step S1, the solvent is selected from methanol.
6. The preparation method according to claim 2, characterized in that, In step S2, the method for obtaining the PBS solution of red blood cells includes: placing a mouse blood sample into a container containing an anticoagulant, centrifuging to obtain the upper plasma layer, mixing the upper plasma layer with the PBS solution, and centrifuging again to obtain the PBS solution of the red blood cells.
7. The preparation method according to claim 2, characterized in that, In step S3, the ratio of drug-loaded MOFs to red blood cells is 1 mg: 0.15 × 10⁻⁶. 7 ~0.25×10 7 indivual.
Citation Information
Patent Citations
Nanometer bionic erythrocyte and construction method and application thereof
CN116942631A