LuUGT175 gene for regulating and controlling form of flax petal and application of LuUGT175 gene

Abstract

The invention provides a LuUGT175 gene for regulating and controlling the form of flax petals and application, and relates to the technical field of plant biology, the invention provides a regulating and controlling gene for the form of the flax petals, the regulating and controlling gene is LuUGT175, and the sequence number of the regulating and controlling gene is SEQ ID NO: 01. Specific embodiments prove that the glycosyl transferase LuUGT175 of flax can participate in regulation and control of the form of flax petals, overexpression of the glycosyl transferase LuUGT175 causes deletion of flax overexpressed strain petals to different degrees, the original rounded petals have irregular deep cracks, and the deep cracks do not reach the base. Petals are always one of key improvement targets in gardening research, the ornamental value of plants can be improved by improving the characters of the petals, and the petals can bring great economic benefits to gardening production after the method is implemented. The novel glycosyl transferase LuUGT175 overexpression body provided by the invention can cause deep cracking of flax petals, so that petals with extremely high ornamental value are produced.

Description

Technical Field

[0001] The invention relates to the field of plant biotechnology, and in particular to a LuUGT175 gene for regulating the morphology of flax petals and an application thereof. Background Art

[0002] Flower development is an important part of plant development and is related to the survival and reproduction of plants. Plants have formed complex flower structures and inflorescence structures during the evolution process, which are related to the normal reproduction of plants and also affect the way humans use plants. Therefore, a considerable part of human research on plants is centered on the flower development of plants. Flower development is a key process for plants to complete their life cycle. The transition from vegetative growth to reproductive growth is a dual response to environmental and genetic factors. In order to ensure the normal reproduction of offspring, higher plants must bloom under the most suitable environmental conditions. Flower development is divided into three stages: floral induction, floral initiation, and floral organ development (Cho et al., 2017). Plants sense flowering signals through changes in the external environment and endogenous hormones, stimulating the shoot apical meristem (SAM) to transform into inflorescence meristem (IM). Subsequently, the inflorescence meristem forms a complete flower under the action of floral meristem identity genes and floral organ identity genes (Yang et al., 2002). F-box protein is one of the largest protein superfamily in plants. There is an F-box domain at the N-terminus, which is composed of 40 to 60 amino acid residues. It can bind to Skp1, Cullinl (CUL1) / Cdc53 and Rbxl / Rocl / Hrtl to form Skp1-Cullin1-F-box (SCF) complex to participate in the ubiquitination process; the C-terminus is the substrate binding region, and there are different domains, including Kelch, LRR, FBD domain, etc. The C-terminus of F-box protein determines the specificity of substrate recognition. Depending on the binding substrate, F-box protein plays different roles (Mo et al., 2021). It can be seen that the SCF complex formed by F-box protein can participate in various aspects of the plant life cycle, such as seed germination, flower development, self-incompatibility, biotic and abiotic stresses, and photomorphogenesis (Zhang et al., 2019).

[0003] Flax (Linum usitatissimum L.) is an annual herbaceous plant of the genus Linum in the family Linaceae. Its inflorescence structure is a cyme, and its morphological characteristics are slender pedicels, 5 petals, and light blue. At present, the research on flax mainly focuses on fiber quality and functional nutrients for seeds, and the research on flower development is extremely lacking. Flax is one of the few species that naturally blooms blue flowers. The petals of blue flax have obvious color gradients and beautiful flower shapes, which are of high ornamental and research value. Flax has a short growth cycle, relatively short plants, high genetic transformation efficiency, and is easy to cultivate in the laboratory, making it an ideal research material. The research content on the development of petals of flax can be enriched by studying the development of petals of ornamental horticultural plants. Summary of the invention

[0004] The purpose of the present invention is to explore the regulatory mechanism of the glycosyltransferase gene, LuUGT175, in the development of flax flowers, and to provide new ideas for the regulation of the LuUGT175 gene in the development of plant petals.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] A regulatory gene for flax petals, the regulatory gene is LuUGT175, and the sequence number of the regulatory gene is SEQ ID NO: 01.

[0007] The present application also provides a molecule for regulating flax petals, wherein the molecule comprises one of the gene LuUGT175, the protein encoded by LuUGT175, and the gene overexpression body of LuUGT175.

[0008] The present application also provides the use of the LuUGT175 gene, the protein encoded by the LuUGT175 gene and the LuUGT175 gene overexpressor in regulating the morphology of flax petals.

[0009] The present application also provides a production method for regulating the morphology of flax petals, comprising the following steps:

[0010] S1: Construction of LuUGT175 gene overexpression vector;

[0011] S2: Genetic transformation of flax.

[0012] Preferably, the primers in S1 are designed as follows:

[0013] Primer name Primer sequence 5'-3' LuUGT175-F cggggtaccATGGACGTAAAATCAAACCATACTGCT LuUGT175-R ccaatgcattggttctgcagTTATAAGGCACTTGATTTCTTCCATAT .

[0014] The present application demonstrates through specific examples that the glycosyltransferase LuUGT175 of flax can participate in regulating the morphology of flax petals, and its overexpression leads to different degrees of missing petals in the flax overexpression strains, and irregular deep cracks appear on the originally round petals, which do not reach the base. Petals have always been one of the key targets for improvement in horticultural research. The ornamental value of plants can be improved by improving the petal traits. The implementation of the present invention will bring significant economic benefits to horticultural production. The present invention provides a new glycosyltransferase LuUGT175 overexpressor that can cause deep cracks in flax petals, thereby producing highly ornamental multi-petal flowers. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the electrophoresis diagram of the target fragment PCR product in Example 1 of the present invention. Note: 1 is the target fragment PCR product; M is Yisheng DL2000 DNA Marker

[0016] Figure 2 The electrophoresis diagram of the PCR identification results of single colonies selected after the ligation products 1 to 6 in Example 1 of the present invention were transformed into Escherichia coli. Note: M is Yisheng DL2000 DNA Marker

[0017] Figure 3 This is a diagram of the construction of the LuUGT175 overexpression vector in Example 1 of the present invention. Note: Lus10005950 is the gene code of LuUGT175

[0018] Figure 4 This is the PCR verification of the LuUGT175 overexpression strain in Example 1 of the present invention. Note: The hygromycin gene (HPT) is used as a marker gene, and the product size is 610 bp.

[0019] Figure 5 The whole plant morphology of the wild type (WT), overexpression plants OE-2 and OE-14 in Example 1 of the present invention.

[0020] Figure 6 The petal morphology of the wild type (WT) and overexpression plants OE-2 and OE-14 in Example 1 of the present invention.

[0021] Figure 7 The petal cells of the wild type (WT) and overexpression plants OE-2 and OE-14 in Example 2 of the present invention were observed using a microscope (OM×400), a scanning electron microscope (SEM×300), and a transmission electron microscope (TEM×1.0K).

[0022] Figure 8 The external morphology of pollen grains of the wild type (WT) and overexpression plants OE-2 and OE-14 in Example 3 of the present invention was observed using a microscope (OM×400, OM×1000).

[0023] Fig. 9 This is the GUS staining analysis of the LuUGT175 promoter in flax buds, petals and capsules in Example 4 of the present invention. Note: A: 1 day after budding; B: 2 days after budding; C: 3 days after budding; D: 4 days after budding; E: 5 days after budding; F: 1 day after flowering; G: 5 days after flowering; H: 10 days after flowering; I: 15 days after flowering; J: 20 days after flowering.

[0024] Fig.10 The expression of LuUGT175 in the flowers of the wild type flax (WT) and the overexpression plant (OE-14) after budding in Examples 4 and 5 of the present invention.

[0025] Fig.11 This is the expression pattern of key genes for flower development in the transgenic strain in Example 5 of the present invention. DETAILED DESCRIPTION

[0026] The present invention is further described in detail below in conjunction with specific embodiments.

[0027] A regulatory gene for flax petals, the regulatory gene is LuUGT175, the sequence number of the regulatory gene is shown as SEQ ID NO: 01, and the amino acid sequence of the protein encoded by the LuUGT175 gene is shown as SEQ ID NO: 02.

[0028] The present application also provides a molecule for regulating flax petals, wherein the molecule comprises one of the gene LuUGT175, the protein encoded by LuUGT175, and the gene overexpression body of LuUGT175.

[0029] Application of LuUGT175 gene, LuUGT175 gene encoded protein and LuUGT175 gene overexpressor in regulating flax petal morphology.

[0030] The present application also provides a production method for regulating the morphology of flax petals, comprising the following steps:

[0031] S1: Construction of LuUGT175 gene overexpression vector;

[0032] S2: Genetic transformation of flax.

[0033] The above contents are described below in conjunction with specific embodiments:

[0034] Example 1: Construction of overexpression vector:

[0035] See also Figure 1 , Figure 2 and Figure 3The full length of LuUGT175 gene is 1455bp, including one exon and no introns, encoding 485 amino acids.

[0036] The target gene fragment was obtained by double restriction digestion from the correctly sequenced intermediate cloning vector pBSK-UGTs, and the target fragment was recovered after electrophoresis. The target vector fragment was obtained by double restriction digestion of pCAMBIA1301 with the same enzyme, and the vector fragment was recovered after electrophoresis.

[0037] The vector fragment carries the promoter 35S promoter that drives gene expression. The target gene fragment pCAMBIA1301 vector fragment is connected using T4 ligase, and the ligation system is transformed into Escherichia coli DH5a competent cells and spread on LB solid medium. Pick a single clone, expand it in LB liquid medium, extract the plasmid, and verify the positive clone by PCR and enzyme digestion. The recombinant eukaryotic expression vector PCAMBIA1301-UGTs is transformed into Agrobacterium tumefaciens GV3101, and the positive colony is selected for shaking.

[0038] S1-1: Primer design

[0039] Primer name Primer sequence 5'-3' LuUGT175-F cggggtaccATGGACGTAAAATCAAACCATACTGCT LuUGT175-R ccaatgcattggttctgcagTTATAAGGCACTTGATTTCTTCCATAT

[0040] S1-2: Target fragment amplification:

[0041]

[0042] S1-3: Target fragment gel recovery

[0043] The target fragment was recovered by gel recovery using a gel recovery kit (Tian Gen, DP209) to purify and recover DNA. For specific methods, refer to the instruction manual.

[0044] S1-4: Linearization and recovery of target vector

[0045] The final plasmid pCAMBIA1301S was linearized by restriction endonuclease (Kpnl+PstI) of TaKaRa, and recovered in the same way as in the previous step.

[0046] S1-5: Target fragment ligation vector

[0047] The clip uses Hieff Plus One Step Cloning Kit (Cat. No. 10911ES20). For specific cloning methods, please refer to the instructions.

[0048]

[0049] S1-6: Bacterial Identification:

[0050]

[0051] Example 2: Flax genetic transformation:

[0052] Flax seeds were treated with 75% ethanol for 1 min, 0.1% mercuric chloride for 8 min, rinsed with sterile water 5-6 times, and spread on germination medium LU1, cultured at 25℃ in the dark for 3-5 days, and moved to 8 hours of light after germination for further culture. Use sterile flax seedlings of 5-10 days old, cut the hypocotyl into 3-5 mm small segments, soak in Agrobacterium liquid with OD value of 0.6 for 20 minutes, then dry the liquid, and place it on co-culture medium LU2-Co for 2-3 days at 25℃ in the dark. Wash the bacteria with 500mg / L Carb solution for 30 minutes, then place it on screening medium LU3H5 for 8 hours of light culture, and subculture once every 2 weeks. When the resistant buds grow to about 5-7mm, move them to rooting medium LU4H5 for rooting culture, and roots can be formed in about 14 days (see Table 1 for the above culture medium formula).

[0053] Table 1 Flax genetic transformation medium formula

[0054]

[0055] Example 3: Positive plant identification

[0056] The hygromycin gene (HPT) was used as the target gene.

[0057] Primers (HPT379F: CTTAGCCAGACGAGCGGGTTC; HPT992R: CGGTTTCCACTATCGGCGAGTA) were designed to perform PCR verification on the transformed positive plants, and the product size was 610 bp.

[0058] The PCR program is as follows:

[0059] PCR kit: Qingke Bio 2XT5 SuperPCR Mix (Colony) Catalog No. TSE005

[0060]

[0061] PCR procedure

[0062]

[0063]

[0064] Example 4: Scanning electron microscope observation of the external morphology of petals

[0065] The morphology of mature petal epidermal cells was observed using a scanning electron microscope (SEM). The specific experimental steps are as follows:

[0066] (1) Dehydration: The plant material fixed in the FAA solution was selected in 70% ethanol, and then placed in a series of ethanol gradients with concentrations of 80%, 95%, 100%, and 100% for dehydration, with each gradient for 20 min;

[0067] (2) Replacement: The material was placed in a series of mixed solutions of anhydrous ethanol: isoamyl acetate ([V]:[V] = 2:1, 1:1, 1:2), pure isoamyl acetate (I), and pure isoamyl acetate (II), with each gradient for 20 min;

[0068] (3) Drying: Use K850 critical point dryer to dry the material with CO2

[0069] (4) Gluing the sample onto a sample stand of appropriate size using double-sided conductive adhesive.

[0070] (5) Gold spraying: Use an ion sputtering device to spray gold on the material;

[0071] (6) Observation and photography: A JSM-6390LV scanning electron microscope (JEOL, Japan) was used for observation and photography.

[0072] Example 5:7. Observation of the internal structure of petals using transmission electron microscopy

[0073] Transmission Electron Microscope (TEM) was used to observe the ultrastructure of mature petal tissue. The experimental steps are as follows:

[0074] (1) Cleaning: Take out the observation part of the material in the 2% GA2% PA (glutaraldehyde-paraformaldehyde) solution and wash it three times with 20 m m / L phosphate buffer, each time for 15 min;

[0075] (2) Fixation: Place the material in a 1% osmium acid solution and place the whole in an ice box for 3 to 4 hours;

[0076] (3) Dehydration: The material was washed three times with phosphate buffer, each time for 15 min, and then treated in a series of ethanol solutions with a concentration gradient of 10%, 30%, 50%, 70%, 80%, 95%, 100%, and 100%, each gradient for 1 h;

[0077] (4) Replacement: The material was subjected to a series of solutions of anhydrous ethanol: propylene oxide ([V]:[V]=2:1, 1:1, 1:2), pure propylene oxide (I), pure propylene oxide (II), propylene oxide: epoxy resin ([V]:[V]=2:1, 1:1, 1:2), pure epoxy resin (I), and pure epoxy resin (II), each gradient for 2 h;

[0078] (5) Embedding: Pour Epon into the embedding plate, place the material and adjust the position, and let it stand at room temperature for 12 h;

[0079] (6) Polymerization: Place the embedded plate at 37°C for 12 h, adjust the material position, place it at 45°C for 12 h, and place it at 60°C for 24 h;

[0080] (7) Block trimming: Fix the embedded block on the block trimming table and cut off the excess part around the material;

[0081] (8) Sectioning: Use Leica EMUC6 ultrathin microtome for sectioning with a thickness of 2 μm;

[0082] (9) Slice collection: Use a diamond knife to slice the sample to a thickness of 60 nm. Stick the sliced ​​sample on the support film in the center of the single-hole copper mesh and use filter paper to absorb the water for later use.

[0083] (10) Staining: Use uranyl acetate (30 min) and lead citrate (40 min) for staining, wash with double distilled water, absorb the water with a clean filter paper strip, collect and dry for later use;

[0084] (11) Observation and photography: A Hitachi HT-77000 (60 kV) transmission electron microscope was used for observation and photography.

[0085] Example 6: Observation of petal cell morphology and pollen morphology using an optical microscope

[0086] Use an optical microscope (OM) to observe the morphology of mature petal cells and pollen. The experimental steps are as follows:

[0087] 1. Take a glass slide and a cover slip, wipe them clean with a soft cloth. Because the cover slip is very thin, be careful when wiping. You can pinch the edge of the cover slip with your left thumb and index finger, spread the gauze flat on the palm of your right hand, gently clamp the cover slip from the top and bottom, and rub it slowly with even force so as not to break the cover slip.

[0088] 2. Use a dropper to absorb 1 to 2 drops of water and place them in the center of the slide.

[0089] 3. Use tweezers to tear off the petals (dip them in pollen grains) and place them in a small drop of water on the slide, trying not to shrink the material.

[0090] 4. Use tweezers to pick up a clean cover glass, first touch the small water drop with one side of the cover glass at an angle, and then slowly lower the cover glass to cover all the observation materials. During the operation, prevent the cover glass from dropping suddenly to avoid bubbles that will hinder the observation effect.

[0091] 5. The prepared slide should be filled with water between the cover glass and the slide. If the water is insufficient, a small amount of water can be dripped from the edge of one side of the cover glass with a dropper, and then absorbed with absorbent paper on the other side, so that the space between the cover glass and the slide is filled with water. If there is excess water, absorb the excess water with absorbent paper.

[0092] 6. Adjust the microscope magnification for observation and photography.

[0093] Example 7: GUS staining analysis

[0094] Prepare sterile centrifuge tubes (2 ml) containing 1 ml of GUS dye solution on a clean bench. Use sterile tweezers and a scalpel to cut the roots, stems, and leaves of the promoter GUS and empty vector positive seedlings and place them in a centrifuge tube containing the GUS dye solution to ensure that the material is immersed in the liquid. After cutting each sample with tweezers and a scalpel blade, sterilize it at high temperature with an alcohol lamp to prevent cross contamination, and then incubate it on a shaker at 37°C at 150 rpm overnight. Then, remove the GUS dye solution, add 1 ml of 70% anhydrous ethanol for decolorization, and place the sample flat on a shaker at 100 rpm at room temperature. Add new 70% anhydrous alcohol every hour until the green color of the flax tissue is completely removed and the background of the tissue is usually white. Remove the flax tissue and take a picture.

[0095] Example 8: Real-time quantitative PCR

[0096] qRT-PCR was performed using Tiangen SuperReal PreMix Plus (SYBR Green) on a 7500 Real Time PCR System (BIO-RAD, USA). Each reaction solution contained 10 μL 2× SuperReal PreMix Plus (SYBR Green), 0.4 μL 50× ROX Reference Dye, 2 μL cDNA template, 0.6 μL each of upstream and downstream primers, and 6.4 μL sterile distilled water. The reaction program was 95°C for 15 min; 95°C for 10 s, 60°C for 32 s, and 40 cycles, according to 2 -ΔΔCt The relative expression level of genes was calculated by ΔΔC T =(C T,target -C T,internalcontrol ) timex -(C T,target -C T,internalcontrol )time0 (Livak and Schmittgen. 2001). GraphPad Prism9 software was used for data analysis and plotting. All qRT-PCR experiments were performed with three biological replicates. LuGAPDH was used as an internal reference gene. The primer sequences for all genes required for the experiment are shown in Table 2.

[0097] Table 2 Names and sequences of primers required for fluorescence quantitative PCR

[0098] Primer name Upstream primer (5'-3') Downstream primer (5'-3') LuGAPDH AGGTTCTTCCCGCTCTCAAT CCTCCTTGATAGCAGCCTTG LusUGT175 GCAGAGTGATCGGAAGGGAA ACAACGCCCTACTAGACGAG Lus10013532 TGGCTGCGAACTCAAACC CCCAGTGGTGGCAGGAAT Lus10031960 CGCTAAGGTCTCCATCAT TATCGACGCCAAGTGTTC Lus10026679 GAGGTTGCCCTTATTGTC GCCTTCAGCCTGTTGTAC Lus10007983 TTCTTGCCAATGATACTGA CTGGAGCGGATATGTTTA Lus10029719 GGCTGTGGGATGCTAAAC GGCGCTTGTTCTCATCTTCAGCCAT Lus10033187 TCGCCAGGTCACTTACTC TGGTCCAGATGTCTACGC Lus10002763 CAGAGCGATTCGAGGGAG TGCCGATTCGTGGTGTTC Lus10004638 CAACAGGCAAGTCACATT TCACCATACTGGAGGAGC Lus10005080 CTGTCCGTACTCTGTGATG CTCTTTAGCAGGTTTGTTG Lus10034662 AAAATCAACAGGCAGGTC TCGGTGGAGTAATCAAAG Lus10006715 ATCAAGTTACAGCACGAA TCTGTCTCAACCTCCATAC Lus10016732 ACTACACCATTGCGAAGATA CGAAAGATGTGGGAGACG Lus10022427 ATCAAGCACAACCAGCAA GGCTCCGTTACGATGAAA Lus10007755 CCTTCAGCGTACTGGGACA CCTCAAACTCCTGGGAACAT Lus10018690 GCCGCCTTCATCTACAAC TGAGATTCGGTGCCAGAG

[0099] Experimental results:

[0100] Experimental result 1:

[0101] See also Figure 1 , Figure 2 and Figure 3 In this application, an overexpression vector of LuUGT175 was constructed and transferred into flax plants. After screening with a culture medium containing kanamycin resistance, 42 overexpression T0 generation independent resistant strains were obtained, and 15 overexpression strains were obtained by PCR identification ( Figure 4 ). Different strains of transgenic plants of the T4 generation with obvious phenotypes were selected for analysis, and no obvious changes were observed in the roots, stems, and leaves of the transgenic plants ( Figure 5 ), while the floral organs developed abnormally ( Figure 6 A, B). When wild flax flowers bloom, the pedicels are slender, with 5 petals, a rounded corolla, the base of the petals separated, and the stamens growing close to the pistil in the center of the flower ( Figure 6 B); The petals of the overexpression lines OE-2 and OE-14 were missing to varying degrees. The originally round petals were irregularly deeply cracked, especially in OE-14. The deep cracks on the petals caused the original 5 petals to become 9-10 narrow petals, but the deep cracks did not reach the base of the petals, so the base of the petals were still 5 independent petals. The petal deformity phenotype showed stable inheritance from the T0 generation to the T4 generation and above.

[0102] Experimental result 2: Electron microscope observation of the external morphology and internal structure of petals

[0103] In order to further explore the cause of petal deformity in LuUGT175 overexpression lines, the petals of wild-type and overexpression lines of flax were observed under optical microscopy (400 times), scanning electron microscopy (300 times) and transmission electron microscopy (1000 times) ( Figure 7). The epidermal cell structure on flax petals was observed by optical microscopy and scanning electron microscopy. It was found that the epidermal cells of the petals of the wild-type material were clearly visible, and each cell was relatively complete and very regular in morphology, but the epidermal cells of the petals of the overexpression strains OE-2 and OE-14 were irregular in morphology, showing different degrees of wrinkling, and a small number of cells were severely wrinkled and paper-like. Under a 1000x transmission electron microscope, the internal structure of the petals of the wild-type and overexpression strains of flax showed that the petal cells contained a large central vacuole, the vacuole membrane was smooth, the cell nucleus structure was complete and regular in shape, and was distributed near the cell membrane. However, the cell wall of the wild-type petal cells was significantly thicker than that of the overexpression strains (OE-2 and OE-14). There were a large number of starch granule-like complex particles distributed along the cell wall in the wild-type petal cells, some of which were distributed as single particles and some of which were clustered together, while only a small number of starch granule-like complex particles were dispersed in the cytoplasm along the large vacuole in the petal cells of the overexpression strains.

[0104] Experimental result 3: Observation of pollen morphology using an optical microscope

[0105] Pollen grains are an important part of plant floral organs, and their morphological characteristics are of great significance for plant classification and identification. Observation under an optical microscope can reveal the shape, size, surface patterns, and germination pores of pollen grains. Therefore, the pollen morphology of wild-type and overexpression strains of flax was observed under an optical microscope at 400 and 1000 times magnification ( Figure 8 ), the purpose is to understand whether the overexpression strain will cause changes in pollen morphology when the petals are deformed. Through optical microscopy, it was found that the pollen shapes of the wild-type and overexpression strains are both spherical, but the surface of the wild-type pollen grains is smoother, while the surface of the pollen grains of the overexpression strains is modified with reticular patterns. Observation of the germination pores of the pollen grains revealed that the pollen grains of the wild-type strain are three-grooved, but the grooves are relatively shallow. The overexpression strain OE-2 also belongs to the three-grooved type, but the grooves are relatively deep. Interestingly, no obvious germination pores were observed on the surface of the overexpression strain OE-14.

[0106] Experimental result 4: Expression pattern analysis of LuUGT175

[0107] Since the LuUGT175 overexpression strains showed typical and heritable petal deformity phenotypes stably until the T4 generation, we speculated that the LuUGT175 gene is an important characteristic gene involved in the formation of floral organs and plays a role in the early stage of petal formation. In order to explore the expression level of the LuUGT175 gene in the reproductive organs of flax, the promoter of the 2kb region upstream of the LuUGT175 gene was fused with the GUS reporter gene, and the promoter-GUS vector was transformed into flax. Floral organs and capsules at different developmental stages of positive plants were collected. GUS staining analysis showed that the LuUGT175 gene was highly expressed in the upper end of the sepals from the budding stage, expressed in the petals at the early stage of budding (2 days after budding), with the highest expression level 4 days after budding, and the expression level decreased when the flax flower was fully open (6 days after budding). Fig. 9 AE). The results of GUS staining of capsules at different developmental stages showed that the LuUGT175 gene was strongly expressed in the residual stigma and residual sepals on the capsules ( Fig. 9 FJ). At the same time, quantitative PCR analysis was performed on the floral organs of the wild type and overexpression (OE-14) lines at 1 day after budding, 2 days after budding, 3 days after budding, 4 days after budding, and 5 days after budding ( Fig.10 ), it is speculated that the LuUGT175 gene is very likely to be involved in floral organ development.

[0108] Experimental result 5: Expression of key genes in flower development

[0109] Fifteen genes closely related to plant flower development were screened, and fluorescence quantitative PCR analysis was performed in wild-type and overexpression lines at different stages of flower development. It was found that, except for Lus10007983, Lus10013532, Lus10034662 and Lus10022427, the expression levels of the other 11 genes in the overexpression lines at different stages of flax flower development were higher than those in the wild-type lines. In particular, the expression levels of Lus10029719, Lus10033187, Lus10004638, Lus10005080, Lus10006715, Lus10016732 and Lus10018690 in transgenic lines at different stages of flax flower development were significantly higher than those in the wild-type lines. The expression levels of Lus10029719, Lus10006715, Lus10016732 and Lus10018690 in the overexpression lines were significantly higher than those of the wild type at 5 days after bud formation. The expression level of Lus10029719 was 38 times higher than that of the wild type at this period, Lus10006715 was 17.4 times higher, Lus10016732 was 9.1 times higher, and Lus10018690 was 19.3 times higher ( Fig.11). The expression levels of the above four genes in the overexpression plants increased with flower development, and the expression trend was similar to that of LuUGT175 in the overexpression plants ( Fig.10 ). It is speculated that these four genes interact with LuUGT175 and jointly regulate petal shape.

[0110] In summary, the present application proves that the glycosyltransferase LuUGT175 of flax can participate in regulating the morphology of flax petals, and its overexpression leads to different degrees of missing petals in the flax overexpression strains, and the originally round petals have irregular deep cracks, and the deep cracks do not reach the base. Petals have always been one of the key targets for improvement in horticultural research. The ornamental value of plants can be improved by improving the petal traits. The implementation of the present invention will bring significant economic benefits to horticultural production. The present invention provides a new glycosyltransferase LuUGT175 overexpressor that can cause deep cracks in flax petals, thereby producing highly ornamental multi-petal flowers.

Claims

1. A regulatory gene for flax petals, the regulatory gene being LuUGT175, and the sequence number of the regulatory gene being SEQ ID NO:

01.

2. A molecule for regulating flax petals, the molecule comprising one of the gene LuUGT175, the protein encoded by LuUGT175, and the gene overexpression body of LuUGT175.

3. Application of LuUGT175 gene, LuUGT175 gene encoded protein and LuUGT175 gene overexpressor in regulating flax petal morphology.

4. A method for producing flax petals by regulating their morphology, characterized in that: The following steps are involved: S1: Construction of LuUGT175 gene overexpression vector; S2: Genetic transformation of flax.

5. The method for producing flax petals by regulating their morphology according to claim 4, characterized in that: The primers in S1 are designed as follows: 。

Images