Single cell or subcellular structure transcriptome or spatial analysis method

Abstract

The invention discloses a single-cell or subcellular structure transcriptome or spatial analysis method. A linker sequence, a spatial barcode sequence and a capture sequence are introduced into a spatial nucleotide, and a linker sequence and a capture sequence are introduced into a general nucleotide. Spatial nucleotides directly capture the slice transcripts, and meanwhile, for transcripts which are not captured by the spatial nucleotides, general nucleotides are adopted to carry out secondary general capture on the transcripts which are not captured by the spatial nucleotides. Two nucleotide chains are used for capturing transcripts, the transcript capturing efficiency is improved, one nucleotide chain carries spatial information, the captured transcripts carry the spatial information while the transcripts are captured, and therefore the transcription information and the spatial information of each single-cell or subcellular structure are obtained; wherein transcriptional information can be used for identification and grouping of single-cell or subcellular structures, spatial information is used for spatial reconstruction of the single-cell or subcellular structures, and the method has a wide application prospect.

Description

Technical Field

[0001] The present application relates to the field of cell biology, and in particular to a single cell or subcellular structure transcriptome or spatial analysis method. Background Art

[0002] Single cell or subcellular structure spatial analysis technology is a technology that captures and analyzes RNA within cell structures while retaining the spatial location information of cell structures. This technology can reveal the spatial distribution and interactions of cells and cell structures in tissues / cells, which is crucial for understanding cell composition, tissue and organ formation, and the phenotype and function of living organisms.

[0003] Early spatial omics technologies mainly relied on single-molecule fluorescence in situ hybridization (smFISH) technology and its derivative technologies such as seqFISH and MERFISH. By designing special fluorescent probes for target RNA, these technologies can detect the copy number and spatial location of thousands of RNAs in a single cell. However, these technologies have high requirements for imaging equipment and probe design, and can only be used to study known RNA targets. With the development of technology, in situ sequencing technologies such as FISSEQ, ISS, STARmap, ExSeq, etc. have emerged. These technologies can directly sequence mRNA in fixed tissue or cell samples, but the related technical process is similar to the sequencing process, requiring multiple rounds of detection to determine the base composition, which is relatively cumbersome and has high requirements for imaging and analysis systems. In recent years, with the maturity of second-generation sequencing technology and the reduction of costs, spatial analysis methods based on second-generation sequencing have developed rapidly.

[0004] There are currently two approaches to spatial transcriptome analysis based on second-generation sequencing. One relies on tightly packed spatial encoding matrix chips, such as 10X genomics' Visium and BGI's STOmics-Stereoseq. The resolution of spatial encoding matrix chips is 500nm-2um. The resolution of the spatial chips they use is gradually approaching the scale of single cells or subcellular structures. These nanoscale spatial encoding nucleotide matrices are directly used to capture transcripts in tissue sections and achieve spatial labeling. The spatial information and transcript information of RNA are obtained through sequencing to achieve spatial reconstruction of RNA transcripts. This approach to achieving spatial analysis at the scale of single cells or subcellular structures has high requirements for spatial chip resolution (nanometer level), and the synthesis process is difficult and the cost is high. Another approach requires a lower resolution of the spatial coding matrix chip (10-50um). The coding nucleotide chains of the spatial chip are infiltrated into tissue slices, and then the tissue slices are dissociated into single cells or subcellular structures. Single cells or subcellular structures carrying different spatial nucleotide chains are labeled using conventional single cell or subcellular structure separation methods. Spatial transcriptome analysis at the single cell or subcellular structure scale is achieved through two rounds of labeling (i.e., one spatial labeling and one single cell or subcellular structure separation labeling).

[0005] Existing technologies include sci-space and slide-tag technologies. First, slice the OCT-embedded tissue, fit the slices to the spatial chip, release the spatial transcripts on the spatial chip and infiltrate into the tissue slices. The sequence structure of the spatial transcripts on the spatial chip is: PCR linker + spatial barcode sequence + binding sequence. Dissociate the tissue slices and extract the cell nuclei. Slide-tag uses the 10X genomics microfluidics system to separate single cells. The spatial transcripts and the cell's mRNA transcripts are captured together by the label microspheres. The transcription information (mRNA) and spatial information (spatial barcode) of each cell nucleus are obtained through sequencing. The transcription information is used to determine the identity of the cell, and the spatial information is used to determine the spatial position of the cell. Sci-space uses pooled barcode technology to separate single cells. The spatial transcripts and the cell's mRNA transcripts are combined and labeled together for multiple rounds of pooling. The transcription information (mRNA) and spatial information (spatial barcode) of each cell nucleus are obtained through sequencing. The transcription information is used to determine the identity of the cell, and the spatial information is used to determine the spatial position of the cell. Sci-space uses pooled barcode technology to separate single cells. The spatial transcripts and the cell's mRNA transcripts are combined and labeled together for multiple rounds of pooling. The transcription information (mRNA) and spatial information (spatial barcode) of each cell nucleus are obtained through sequencing. The transcription information is used to determine the identity of the cell, and the spatial information is used to determine the spatial position of the cell. In summary, both existing methods use spatial chips to infiltrate transcripts carrying spatial information into the cell nuclei of slices, and then the spatial transcripts in the cell nucleus are labeled with single-cell separation labels together with other transcripts in the cell nucleus, and the transcriptional information and spatial information of each cell are obtained through sequencing.

[0006] Based on this scheme, the capture efficiency of the final spatial information involves the infiltration efficiency of the spatial transcript fragments released by the spatial chip into the tissue, as well as the single-cell separation labeling efficiency, that is, the capture labeling efficiency of the spatial transcripts by the primer reverse transcription. At present, the capture and detection efficiency of genes by the high-throughput single-cell sequencing primer reverse transcription is low. It is known that low-throughput single-cell sequencing primer reverse transcription captures transcripts, and the number of gene captures is about 10,000-20,000; high-throughput single-cell sequencing primer reverse transcription captures transcripts, and the number of gene captures is about 1,000-2,000. In high-throughput analysis, only the top 10% of genes with higher copy numbers will be captured and detected. To this end, it is necessary to ensure that the efficiency of spatial transcripts penetrating into the tissue is as high as possible, so that enough spatial transcripts are accumulated in the cell nucleus to increase the copy number of spatial transcripts, which may be captured and detected by subsequent capture primers. Therefore, the existing technical scheme has high requirements for the permeability of tissues, and is only suitable for OCT-embedded frozen samples, whose cells are loose and easy to penetrate, and FFPE and other fixed samples, in which proteins and RNA are cross-linked, and spatial transcripts are difficult to penetrate, making subsequent capture difficult to achieve. Summary of the invention

[0007] In order to analyze samples that are difficult to penetrate, the present invention releases a capture sequence (rather than a captured sequence) through a spatial chip. The spatial capture sequence directly captures the slice transcripts. At the same time, for transcripts not captured by the spatial sequence, a second universal capture sequence is performed to capture the transcripts. Finally, the cell transcripts are the transcripts captured by the spatial capture sequence and the transcripts captured by the universal capture sequence. The tissue permeability requirements are relatively low, and spatial single-cell labeling of fixed samples such as FFPE can be achieved.

[0008] Therefore, the present invention provides a single cell or subcellular structure transcriptome and / or spatial analysis method, the method comprising the following steps:

[0009] 1) attaching a tissue slice to a spatial chip, wherein the spatial nucleotide chains are distributed in the spatial chip;

[0010] 2) The spatial nucleotide chains on the spatial chip are released, and the nucleotide chains penetrate into the tissue slices after being released, and the capture sequences in the spatial nucleotide chains are bound to the RNA in the slices to achieve RNA capture and spatial information labeling;

[0011] 3) adding a universal nucleotide chain to the tissue section to capture RNA, and then dissociating the single cell or subcellular structure; or, first dissociating the single cell or subcellular structure, and then adding a universal nucleotide chain to the single cell or subcellular structure to capture RNA;

[0012] 4) Use single cell or subcellular structure separation scheme to separate and label single cell or subcellular structure;

[0013] 5) Amplify cDNA for library construction and sequencing to obtain transcriptional and spatial information of each single cell or subcellular structure.

[0014] Preferably, the freeing method in step 2) includes using USER enzyme to cut the space nucleotide chain and the U base connected to the chip or using light to cut the space nucleotide chain and the photosensitive group connected to the chip.

[0015] Preferably, the space nucleotides in step 2) include a linker sequence, a space barcode sequence and a capture sequence. In a specific example, the space nucleotide sequence is a linker sequence CTACACGACGCTCTTCCGA+space barcode sequence+random capture sequence NNNNNNN; the capture sequence is a linker sequence GGAGTTGGAGTGAGTGGATGAGT+random capture sequence NNNNNNN.

[0016] Preferably, the universal nucleotide in step 3) includes a linker sequence and a capture sequence.

[0017] Preferably, the capture sequence is selected from polyT, a random sequence, a semi-random sequence, a targeted base sequence or a combination thereof.

[0018] Preferably, the single cell includes a eukaryotic cell, a prokaryotic cell or a combination thereof, and the subcell includes a cell nucleus, a cell organelle, a cytoplasmic condensate, a plastid, a lysosome, a physical structure secreted by a cell or a combination thereof.

[0019] Preferably, the organelles include mitochondria, ribosomes, lysosomes, endoplasmic reticulum and Golgi apparatus.

[0020] Preferably, the physical structure secreted by the cell is an extracellular vesicle.

[0021] Preferably, the single cell or subcellular structure separation scheme in step 4) includes microfluidic droplets, microplates and split pool barcode technology (split pool).

[0022] Preferably, the tissue sections include paraffin sections and frozen sections.

[0023] The present invention discloses a method for spatial reconstruction of a single cell or subcellular structure, comprising the following steps:

[0024] 1) Obtaining the spatial information of each single cell or subcellular structure according to the described method;

[0025] 2) Spatial reconstruction of single-cell or sub-cellular structures is performed based on the acquired spatial information of each single-cell or sub-cellular structure.

[0026] The present invention provides a method for identifying and grouping a single cell or subcellular structure, which comprises the following steps:

[0027] 1) Obtain transcriptome information of each single cell or subcellular structure according to the described method;

[0028] 2) Identify and group single cells or subcellular structures based on the transcriptome information of each single cell or subcellular structure obtained.

[0029] Specifically, the method of the present invention includes: slicing paraffin-embedded (FFPE) samples or OCT-embedded samples. The tissue slices are attached to the spatial chip, and the spatial nucleotide chains (structure: linker sequence + spatial barcode sequence + capture sequence, the linker sequence is a fixed sequence used to connect specific nucleic acid fragments for enrichment, adding linkers, amplification, etc., the spatial barcode sequence is a set of coding sequences used to mark the spatial position of the nucleotide chain and pass it to the RNA in the cell, and the capture sequence can be polyT, random, semi-random, targeted base sequence or a combination thereof) are distributed on the spatial chip.

[0030] Furthermore, the spatial nucleotide chain on the spatial chip is released, and the release scheme includes but is not limited to using USER enzyme to cut the spatial nucleotide chain and the U base connected to the chip, nucleotide breakage based on special light, etc.

[0031] After the nucleotide chains are free, they penetrate into the tissue slices, and the capture sequence binds to the RNA in the slices to achieve RNA capture and spatial information labeling. The molecular concentration of spatial nucleotide chains is low (far less than <1uM), and the efficiency of RNA capture in tissues is low. Only a few RNAs in each cell substructure are captured and labeled. This spatial information is sufficient for spatial reconstruction but does not meet the needs of transcript analysis.

[0032] Add universal nucleotide chains (concentration greater than or equal to 1uM) (sequence structure: linker sequence + capture sequence, the capture sequence can be polyT, random, semi-random, targeted base sequence or a combination thereof) to the tissue to capture RNA. After RNA capture is completed, single cells or subcellular structures are dissociated (the single cells or subcellular structures include eukaryotic cells, prokaryotic cells, cell nuclei, organelles (such as mitochondria, ribosomes, lysosomes, endoplasmic reticulum, Golgi bodies), cytoplasmic condensates, plastids, lysosomes, physical structures secreted by cells (such as extracellular vesicles) or a combination thereof), and single cell or subcellular structure separation schemes (including but not limited to microfluidic droplets, microplates, splitpools, etc.) are used for separation marking. Each single cell or subcellular structure contains two structures of cDNA, one of which includes separation markers, transcript information, and spatial barcodes; the other includes single cell separation markers and transcript information. Different single cell or subcellular structures have different separation markers, and single cell or subcellular structures from different spatial sources have different spatial barcodes. cDNA is amplified for library construction and sequencing to obtain transcriptional information and spatial information of each single cell or subcellular structure, wherein the transcriptional information can be used for identification and clustering of single cells or subcellular structures, and the spatial information is used for spatial reconstruction of single cells or subcellular structures.

[0033] The present invention uses two nucleotide chains to capture transcripts to improve transcript capture efficiency. One of the nucleotide chains carries spatial information and is released from a spatial chip in a relatively small amount. While capturing transcripts, the captured transcripts also carry spatial information, which can satisfy the spatial labeling of each single-cell subcellular structure. The other part is a universal nucleotide chain with a relatively large input amount for overall transcript capture. The scheme is suitable for paraffin FFPE and frozen sections.

[0034] The present invention uses the capture sequence (rather than the captured sequence) released by the spatial chip, and the spatial capture sequence directly captures the slice transcripts. At the same time, for the transcripts not captured by the spatial sequence, the second universal capture sequence is captured. The final overall capture efficiency of the cell transcripts is the transcripts captured by the spatial capture sequence plus the transcripts captured by the universal capture sequence. The tissue permeability requirement is low, and spatial single-cell labeling of FFPE samples can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Spatial labeling efficiency of spatial nucleotide chains.

[0036] Figure 2 Spatial reconstruction of the single-cell transcriptome of FFPE human intestinal samples. DETAILED DESCRIPTION

[0037] Example 1: Spatial transcriptome detection of OCT-embedded samples

[0038] 1. Sample slice preparation: Take mouse brain tissue, place it on dry ice and embed it with OCT embedding reagent, and store it at -80 degrees after solidification. Use a freezing microtome to cut 20um brain tissue slices, incubate the slices at room temperature for 5 minutes, wash off the OCT with PBS solution, and soak in 4% paraformaldehyde for 30 minutes; wash it 3 times with pre-cooled 2X SSCT buffer (containing 0.05% Triton), 2 minutes each time;

[0039] 2. Spatial sequence release: prepare a SPA system (10x USER enzyme buffer 5uL, USER enzyme (NEB) 2.5uL, RNaseInhibitor (Vazyme) 2.5uL, water to 50ul) and drop it on the tissue, and attach the chip with the spatial capture sequence (linker sequence CTACACGACGCTCTTCCGA + spatial barcode sequence + random capture sequence NNNNNNN) (this example uses the article published in the journal Nature Biotechnology in 2024: Cao, J., Zheng, Z., Sun, D. et al. Decoder-seq enhances mRNA capture efficiency in spatial RNAsequencing. Nat Biotechnol (2024). https: / / doi.org / 10.1038 / s41587-023-02086-y) to the tissue slice and incubate at 37°C for 30min; release the spatial capture sequence to bind to the RNA of the slice sample. After the reaction is completed, remove the chip and immediately rinse the tissue surface twice with pre-cooled 2X SSCT buffer, and then rinse the tissue surface twice with pre-cooled PBST to wash away excess unbound space capture sequences.

[0040] 3. Reverse transcription reaction: prepare RT system (5X RT buffer 20ul, universal capture primer (adapter sequence GGAGTTGGAGTGAGTGGATGAGT + random capture sequence NNNNNNN) 10uL, 10mM dNTP 5uL, RNaseInhibitor 5uL, RT enzyme (Vazyme) 5uL, water to 100uL). Perform reverse transcription reaction according to the following procedure: 8℃10min; 15℃10min; 20℃15min; 25℃20min; 30℃20min; 42℃50min; 4℃∞; After the RT reaction, rinse the tissue twice with pre-cooled 2X SSCT buffer, add 50uL pre-cooled PBST, scrape the tissue with a gun tip and rinse the surface of the slide with pre-cooled PBST, collect all tissue fragments in a 1.5mL centrifuge tube; put the centrifuge tube into a centrifuge, centrifuge at 500xg, 4℃ for 5min, and remove the supernatant. The same washing operation was repeated twice;

[0041] 4. Adding the linker: Prepare the dA reaction system (10X TDT buffer 10uL, CoCl 2 10uL, 100mM dATP1uL, Terminal transferase (NEB)1uL, water to 100uL), add to the tissue sample, incubate at 37℃ for 30min; transfer the tissue fragments that have completed the dA reaction to a 1.5mL centrifuge tube, add 1mL pre-cooled PBST and gently blow, then put the centrifuge tube into a centrifuge, centrifuge at 500xg, 4℃ for 5min, and remove the supernatant. Repeat the same washing operation 4 times;

[0042] 5. Single cell nucleus dissociation: suspend the tissue in 50ul PBST, grind the tissue on ice for 5min, rinse the grinding rod with 850uL PBST lysis buffer; add 100uL 1% proteinase K directly to the centrifuge tube, incubate at 37℃ on a metal bath for 10min, and observe under a microscope every 3min to ensure the integrity of the cell nucleus and that most tissue fragments are dissociated into single cell nuclei; filter the cell nucleus suspension with a 40μm cell sieve into a new 1.5mL centrifuge tube, then immediately add 500μL PBST to rinse the cell sieve, centrifuge at 500xg, 4℃ for 5min, and remove the supernatant; add 1mL PBST, resuspend the cell nucleus pellet, centrifuge at 500xg, 4℃ for 5min, and remove the supernatant. Repeat the same washing operation 3 more times (4 times in total). Add 1mL PBST to suspend the cell nuclei, examine and count under a microscope, and dilute to 100,000 / mL;

[0043] 6. Microfluidic droplet encapsulation: Use a single cell preparation instrument (M20) for single cell separation and droplet preparation, and dispense the droplets into PCR tubes and run the following program for extension reaction: 37°C 60min; 50°C 30min; 60°C 30min; 75°C 20min; 4°C∞;

[0044] 7. cDNA amplification and library construction: Add PFO demulsification equal to the volume of droplets to the PCR tube at the end of the reaction, and perform 2XAMPureXP beads purification; prepare PCR reaction system (Kapa enzyme 25ul, chip end primer 1ul, bead end primer 1uL, universal RT end primer 1uL, sample 22uL). Pre-amplify 10 cycles according to the following program: 96℃3min; 98℃20s; 60℃15s; 72℃2min; GOTO step 2 9X; 72℃5min; 4℃∞; purify the amplified product with 1X AMPure XP beads, elute with 100uL water, take 1uL of the purified product and dilute it 5 times as a template for qPCR; construct the library according to the qPCR results. Use Qubit to measure the concentration of the library, and use Qsep100DNA fragment analyzer to measure the size of the library fragment; perform second-generation sequencing on qualified libraries.

[0045] Example 2: FFPE sample spatial transcriptome detection

[0046] 1. Sample slice preparation: fix human intestinal tissue, embed it in paraffin, and cut it into 10um tissue slices using a paraffin slicer; place the slices in a 60℃ oven for 30min, then immediately rinse the tissue surface with 1mL of environmentally friendly dewaxing agent, and then incubate twice with environmentally friendly dewaxing agent in a washing box, each time for 20min; transfer the slices to a gradient ethanol solution for rehydration (100%, 100%, 90%, 70%, 30%, water), and rinse 3 times with 1mL PBST; add HCl-Perpsin and incubate at 37℃ for 30min; rinse the slices 3 times with PBST;

[0047] 2. Single-stranded DNA blocking: Prepare blocking system (10mM dNTP 20ul, blocking primer 12ul, 10x polymerase buffer 10ul, RNase inhibitor 5ul, T4 DNA polymerase 4ul (NEB), water to 100ul), and carry out blocking reaction in PCR instrument according to the following program: 8℃ 4min; 15℃ 4min; 20℃ 4min; 25℃ 4min; 30℃ 4min; 37℃ 25min; after blocking, add 150μl 0.2X SSCT buffer (containing 0.05% Triton), incubate at 50℃ for 5min, and wash twice with PBST;

[0048] The subsequent steps are the same as steps 2-7 of Example 1, including spatial sequence release, reverse transcription, linker addition, single cell nucleus dissociation, microfluidic droplet packaging and cDNA amplification library construction. The sequencing results show that the spatial nucleotide chain can achieve spatial label addition of ~100% of cells ( Figure 1 ), and can achieve single-cell spatial reconstruction of tissue samples ( Figure 2 ).

Claims

1. A method for single cell or subcellular structure transcriptome and / or spatial analysis, characterized in that: The method comprises the following steps: 1) attaching a tissue slice to a spatial chip, wherein the spatial nucleotide chains are distributed in the spatial chip; 2) The spatial nucleotide chains on the spatial chip are released, and the nucleotide chains penetrate into the tissue slices after being released, and the capture sequences in the spatial nucleotide chains are bound to the RNA in the slices to achieve RNA capture and spatial information labeling; 3) adding a universal nucleotide chain to the tissue section to capture RNA, and then dissociating the single cell or subcellular structure; or, first dissociating the single cell or subcellular structure, and then adding a universal nucleotide chain to the single cell or subcellular structure to capture RNA; 4) Use single cell or subcellular structure separation scheme to separate and label single cell or subcellular structure; 5) Amplify cDNA for library construction and sequencing to obtain transcriptional and spatial information of each single cell or subcellular structure.

2. The analysis method according to claim 1, characterized in that The freeing method in step 2) includes using USER enzyme to cut the space nucleotide chain and the U base connected to the chip or using light to cut the space nucleotide chain and the photosensitive group connected to the chip.

3. The analysis method according to claim 1, characterized in that The spatial nucleotides in step 2) include a linker sequence, a spatial barcode sequence and a capture sequence.

4. The analysis method according to claim 1, characterized in that The universal nucleotides in step 3) include a linker sequence and a capture sequence.

5. The analysis method according to any one of claims 3-4, characterized in that: The capture sequence is selected from polyT, a random sequence, a semi-random sequence, a targeted base sequence or a combination thereof.

6. The analysis method according to claim 1, characterized in that The single cell includes a eukaryotic cell, a prokaryotic cell or a combination thereof, and the subcellular structure includes a cell nucleus, a cell organelle, a cytoplasmic condensate, a plastid, a lysosome, a physical structure secreted by a cell or a combination thereof.

7. The analysis method according to claim 1, characterized in that The single cell or subcellular structure separation scheme in step 4) includes microfluidic droplets, microplates and split pool barcode technology (split pool).

8. The analysis method according to claim 1, characterized in that The capture of RNA in steps 2) and 3) is achieved by combining the nucleotide chain with the RNA fragment to generate a polymerization reaction or a ligation reaction, so that the nucleotide chain carries the RNA information and the capture linker.

9. A method for spatial reconstruction of a single cell or subcellular structure, characterized in that: The steps include: 1) Acquiring spatial information of each single cell or subcellular structure according to the method of claim 1; 2) Spatial reconstruction of single-cell or sub-cellular structures is performed based on the acquired spatial information of each single-cell or sub-cellular structure.

10. A method for identifying and grouping single cells or subcellular structures, characterized in that: The steps include: 1) Obtaining transcriptome information of each single cell or subcellular structure according to the method of claim 1; 2) Identify and group single cells or subcellular structures based on the transcriptome information of each single cell or subcellular structure obtained.

11. The analysis method according to claim 1, characterized in that The tissue sections include paraffin sections and frozen sections.

Images