Rice sdv1 gene, its encoded protein and application thereof

By cloning and knocking out the SDV1 gene to regulate rice plant height, the problem of scarce rice plant height regulation gene resources has been solved, and lodging resistance has been improved without affecting yield, thus meeting the needs of modern cultivation conditions.

CN119462873BActive Publication Date: 2026-05-05SICHUAN AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411532524.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-02-26
Filing Date
2024-10-30
Publication Date
2026-05-05
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

In existing technologies, rice plant height regulation gene resources are scarce, making it difficult to achieve slight dwarfing of plant height in the context of the sd1 gene. This results in insufficient lodging resistance and an inability to adapt to changes in modern cultivation conditions, such as direct seeding, simplified cultivation, and mechanized operations.

Method used

By cloning the SDV1 gene and knocking it out or inactivating it in rice using CRISPR/Cas9 technology, rice plant height can be regulated, plant height can be reduced, lodging resistance can be enhanced, and yield stability can be maintained.

Benefits of technology

This method significantly reduces rice plant height and improves lodging resistance without affecting yield, adapting to the needs of modern cultivation conditions and providing new genetic resources for breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119462873B_ABST
    Figure CN119462873B_ABST
Patent Text Reader

Abstract

Currently, most reported rice dwarfing mutants exhibit drastic changes in plant height, severely impacting yield and thus hindering practical application in breeding. Furthermore, there is a severe lack of "fine-tuning genes" capable of slightly dwarfing plant height under the SD1 background. This application relates to a gene, SDV1, that regulates plant height. Mutants, alleles, or derivatives can be generated by adding, substituting, inserting, or deleting one or more nucleotides in the nucleotide sequences shown in SEQ ID NO.2, SEQ ID NO.3, or SEQ ID NO.4. This application clarifies the function of two dwarfing mutants in regulating rice plant height development through phenotypic analysis, genetic analysis, gene cloning, and expression analysis, providing valuable gene resources for rice lodging resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding, and more particularly to the rice SDV1 gene, its encoded protein, and its applications. Background Technology

[0002] Lodging is the phenomenon where upright-growing crops become leaning in large areas, or even completely flattened on the ground. Lodging not only leads to reduced crop yield and quality but also makes harvesting extremely difficult. For example, when wheat and rice suffer severe lodging, yields can be reduced by more than half. Because lodging often occurs in the middle to late stages of crop growth, which is the most critical stage for crop development, losses are even more severe for cereal crops such as rice and wheat if they lodge after jointing. Plant height is one of the main factors affecting crops and potentially causing lodging; therefore, rice plant height is closely related to high / stable yields.

[0003] The causes of rice lodging can be summarized as follows:

[0004] First, there's the varietal factor; different varieties have vastly different lodging resistance. High-quality lodging-resistant rice varieties typically have characteristics such as short plant height, sturdy stems, and upright leaves.

[0005] Secondly, there is the factor of fertility. Excessive application of nitrogen fertilizer, especially in the later stages of rice growth, will lead to a reduction in the cellulose content of cells at the base of the stem, thinning of cell walls, and softening of tissue structure, thus making lodging more likely.

[0006] In addition, water management is also an important factor. Maintaining an excessively high water level for a long time will result in poor soil permeability, poor root development, easy poisoning, weak root strength, excessively tall rice growth, soft stems, and reduced lodging resistance.

[0007] In addition, the invasion of diseases and pests can also cause rice to grow weak and lodging, such as sheath blight;

[0008] Finally, cultivation management is also an important factor. For example, dense planting and shallow cultivation can lead to elongated internodes and loose tissues in rice, making it prone to lodging.

[0009] Currently, a semi-dwarf mutant gene (sd1) encoding gibberellin (GA) biosynthesizers has been introduced into modern cultivated rice, giving it the dual advantages of tolerance to dense planting and lodging resistance, thus significantly increasing rice yield. This can be considered a "green revolution" starting with plant height. In current rice breeding, the semi-dwarf phenotype has become one of the most important breeding goals, forming the foundation for high and stable yields in modern rice, demonstrating the importance of plant height to rice yield. Numerous genetic studies have shown that rice plant architecture is mainly related to the synthesis, metabolism, and signal transduction pathways of various plant hormones (such as gibberellin (GA), brassinolide (BR), strigolactone (SL), and auxin (IAA)) and their interactions.

[0010] Existing technologies also disclose some literature related to plant height regulation, such as the OsNramp5 mutant and its related products and applications disclosed in CN117447567A, which mentions the application of the amino acid sequence of the OsNramp5 mutant in plant height regulation.

[0011] However, with changes in modern cultivation conditions, such as direct seeding, simplified cultivation, and mechanized operations, higher demands have been placed on rice plant type and lodging resistance. To adapt to these changes, breeders have proposed a new approach: further reducing plant height slightly based on the semi-dwarf mutant gene to cultivate "dwarf-to-dwarf" rice varieties. This approach has the following advantages: 1) further improving lodging resistance; 2) adapting to direct seeding and mechanized operations; 3) increasing planting density, ensuring total effective panicles, and avoiding the impact of reduced plant height on yield. Recently, Liu et al. discovered a new rice plant height regulating gene called Shortened Basal Internodes (SBI) and used its allelic variations to breed some new rice varieties with lodging resistance, high and stable yield, and strong adaptability, proving that the molecular breeding strategy of cultivating "dwarf-to-dwarf" rice based on the semi-dwarf mutant gene is feasible.

[0012] Clearly, the realization of this approach depends on the discovery of gene resources capable of fine-tuning plant height based on semi-dwarf mutant genes. However, such gene resources for fine-tuning plant height are currently relatively scarce. Therefore, continued exploration and in-depth research into new rice semi-dwarf gene resources could potentially further enhance the yield potential and stability of rice, possessing clear practical application value.

[0013] This study, through phenotypic analysis, genetic analysis, gene cloning, and expression analysis of two dwarfing mutants, identified genes involved in regulating rice plant height and stem internode development, laying the foundation for further analysis of the molecular regulatory network of rice straw development and providing gene resources for breeding applications. Furthermore, while differences in understanding among those skilled in the art exist, and the applicant consulted numerous literature and patents when developing this invention (though not all details are listed here due to space limitations), this does not mean the invention lacks the features of these prior art techniques. On the contrary, the invention possesses all the features of the prior art, and the applicant reserves the right to add relevant prior art to the background section. Summary of the Invention

[0014] Currently, the control of rice plant height and lodging resistance is mainly based on the sd1 gene, which was discovered and applied many years ago. Intensive rice production in the new era faces a series of challenges from changing cultivation conditions, such as direct seeding, simplified cultivation, and mechanized operations, which place higher demands on rice plant architecture and lodging resistance. Theoretically, it is necessary to further slightly dwarf the plant height under the sd1 background to cultivate "dwarf-to-dwarf" rice varieties to further improve their lodging resistance. However, since most reported rice dwarfing mutants exhibit drastic changes in plant height, severely impacting yield, they are difficult to utilize in practical breeding. Furthermore, there is a severe lack of "fine-tuning genes" capable of slightly dwarfing plant height under the sd1 background.

[0015] This application relates, in one aspect, to a protein SDV1 that regulates plant height. The amino acid sequence of protein SDV1 is shown in A1), A2), or A3) below:

[0016] A1)SEQ ID NO.1;

[0017] A2) A protein derived from rice that has more than 90% similarity to the protein described in A1) and has the same function;

[0018] A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2). Preferably, the sequence of a protein SDV1 that regulates plant height is as shown in SEQ ID NO.1.

[0019] This application, in another aspect, relates to a gene SDV1 that regulates plant height. The nucleotide sequence of the SDV1 gene can be modified by adding, substituting, inserting, or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3 to generate mutants, alleles, or derivatives. Preferably, the nucleotide sequence encoding the protein SDV1 is shown in SEQ ID NO. 2, SEQ ID NO. 3, or SEQ ID NO. 4.

[0020] Another aspect of this application relates to the use of protein SDV1 or the gene encoding protein SDV1 in controlling the stem wall thickness of the basal internodes of plants.

[0021] Another aspect of this application relates to the use of the protein SDV1 or the gene encoding the protein SDV1 in controlling plant stem node length.

[0022] Another aspect of this application relates to a recombinant DNA vector, cell, or strain containing the gene SDV1 that regulates plant height.

[0023] According to a preferred embodiment, the strain is Agrobacterium or Escherichia coli.

[0024] Another aspect of this application relates to a method for improving the lodging resistance of rice, comprising the following steps:

[0025] Downregulate the expression level of the SDV1 gene in rice.

[0026] Or it could downregulate the expression level of the protein encoded by the SDV1 gene in rice.

[0027] Or it may reduce the activity of the protein encoded by the SDV1 gene in rice.

[0028] According to a preferred embodiment, another aspect of this application relates to a method for regulating the plant height of plants with an SD1 genetic background, the method comprising downregulating the expression level of the SDV1 gene in the plant, or downregulating the expression level of the protein encoded by the SDV1 gene in the plant, or reducing the activity of the protein encoded by the SDV1 gene in the plant. Preferably, the plant can be a gramineous crop such as rice, wheat, or corn.

[0029] According to a preferred embodiment, a method for downregulating the expression level of the SDV1 gene in rice, downregulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice includes:

[0030] Delete base AG at positions 307-308 (or 56-57 in the coding region) of the SDV1 gene;

[0031] Delete CAAGA bases at positions 307-311 (or 56-60) of the SDV1 gene;

[0032] Insert base A at position 307 (or position 56) of the SDV1 gene; or

[0033] The recombinant vector for knocking out the SDV1 gene was set up using the sequence indicated by the sgRNA target site.

[0034] The SDV1 gene contains two exons. For example... Figure 2As shown in D, the protein domain corresponding to the first exon contains leucine-rich repeats (LRRs) and a kinase domain. The sequence of the first exon is shown in SEQ ID NO. 4. The knockout target (target sequence TCGTCTTGCTGCGCTGGTCG) and the mutation site of the mutant given in this application are both located on the first exon. Experimental results show that disrupting the functional domain of the first exon can lead to loss of function of the SDV1 gene.

[0035] Based on this, another aspect of this application relates to a method for improving rice plant architecture, comprising the following steps: modifying the first exon of the SDV1 gene to reduce the expression level or activity of the protein encoded by the SDV1 gene. Preferably, the modification of the first exon of the SDV1 gene may be a structure that disrupts the leucine-rich repeat domain in the protein encoded by the SDV1 gene. The modification of the first exon of the SDV1 gene may be a structure that disrupts the kinase domain in the protein encoded by the SDV1 gene. More preferably, the modification of the first exon of the SDV1 gene comprises:

[0036] Delete base AG at positions 307-308 (or 56-57 in the coding region) of the SDV1 gene;

[0037] CAAGA deletion at positions 307-311 (or 56-60) of the SDV1 gene;

[0038] Insert a base A at position 307 (or position 56 in the coding region) of the SDV1 gene;

[0039] A mutation at position 754 of the protein encoded by the SDV1 gene; or

[0040] The mutation occurs at position 868 of the protein encoded by the SDV1 gene.

[0041] Preferably, the mutation at position 754 of the protein encoded by the SDV1 gene can be a mutation of lysine (Lys) to glutamic acid (Glu). The mutation at position 868 of the protein encoded by the SDV1 gene can be a mutation of histidine (His) to arginine (Arg).

[0042] According to a preferred embodiment, a method for downregulating the expression level of the SDV1 gene in rice, downregulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice includes:

[0043] The SDV1 gene or expression constructs / vectors containing the SDV1 gene are transferred into plants.

[0044] Preferably, the method for introducing the recombinant vector into plants can be Agrobacterium-mediated transformation, gene gun transformation, electroporation transformation, pollen tube transformation, liposome fusion transformation, or any other method that can introduce plasmids to transform plant cells or tissues.

[0045] Another aspect of this application relates to a method for increasing plant yield or biomass, the method comprising the following steps:

[0046] Upregulate the expression level of the SDV1 gene in rice.

[0047] Or it may upregulate the expression level of the protein encoded by the SDV1 gene in rice.

[0048] Or it may increase the activity of the protein encoded by the SDV1 gene in rice.

[0049] According to a preferred embodiment, methods for upregulating the expression level of the SDV1 gene in rice, upregulating the expression level of the protein encoded by the SDV1 gene in rice, or increasing the activity of the protein encoded by the SDV1 gene in rice include gene knockout, RNA interference, or natural variant screening.

[0050] Another aspect of this application relates to a recombinant vector for regulating plant height. The recombinant vector contains a transcribed DNA sequence encoding an mRNA molecule. Preferably, the mRNA molecule contains a sequence complementary to at least 15 consecutive nucleotides of the SDV1 gene encoding monocotyledonous plants. Preferably, the mRNA molecule contains a sequence complementary to at least 15 consecutive nucleotides of the second exon of the SDV1 gene encoding monocotyledonous plants. The recombinant vector also contains a promoter operatively linked to the transcribed DNA sequence and expressible in the plant.

[0051] In another aspect, this invention provides a recombinant vector containing the aforementioned SDV1 gene that regulates rice plant architecture. Preferably, the base vector of the recombinant vector includes a prokaryotic expression vector and / or a eukaryotic expression vector. More preferably, the recombinant vector includes a binary Agrobacterium vector or a vector suitable for plant gene gun bombardment, such as pCAMBIA3301, pCAMBIA2300, pCAMBIA2301, pCAMBIA1300, pCAMBIA1301, pWM101, pGreen0029, pBI121, pBin19, pCAMBIA1301-UbiN, or other derived plant expression vectors. More preferably, the recombinant vector may use enhancers, including translational enhancers or transcriptional enhancers, and these enhancer regions may be ATG start codons (within the reading frame of the coding sequence) or adjacent region start codons (within the reading frame of the coding sequence), etc. Preferably, the enhancers are known in the art, including SV40 enhancer regions, 35S enhancer elements, etc.

[0052] The SDV1 gene with a mutation site that inhibits plant height, as described in this application, can be isolated from natural materials or synthesized artificially. "Isolated" here refers to materials such as nucleic acids or proteins that substantially or essentially do not contain components that normally accompany or interact with the material in its natural environment, or, if the material is in its natural environment, that has been intentionally altered into a composition and / or placed in a cell at a location other than the material's natural location through human intervention.

[0053] Recombinant vectors can use genes expressed in plants that encode enzymes or luminescent compounds that produce color changes, antibiotic resistance markers, or chemical resistance marker genes to screen for positive plants.

[0054] Another aspect of this application relates to the application of the SDV1 gene in controlling plant height and lodging resistance.

[0055] This application also relates to a method for reducing rice plant height. The method includes one or more of the following:

[0056] Reduce the protein content of SDV1 gene expression in recipient rice;

[0057] Reduce or block the activity of proteins expressed by the SDV1 gene in recipient rice;

[0058] Reduce or block the proper expression of the SDV1 gene in recipient rice.

[0059] Rice with reduced plant height was obtained, among which,

[0060] Another aspect of this application relates to a method for improving lodging resistance in rice. The method includes the following steps: gene editing of the SDV1 gene in recipient rice to obtain gene-edited rice; compared to recipient rice, the plant height of the gene-edited rice is improved;

[0061] The proteins expressed by the SDV1 gene are either A1), A2), or A3):

[0062] A1) Proteins expressed by the SDV1 gene;

[0063] A2) is a protein derived from rice that has more than 90% similarity to the protein described in A1) and has the same function;

[0064] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0065] This application, in another aspect, relates to a method for increasing the stem wall thickness of basal internodes in rice. The method includes one or more of the following:

[0066] Reduce the protein content of SDV1 gene expression in recipient rice;

[0067] Reduce or block the activity of proteins expressed by the SDV1 gene in recipient rice;

[0068] Reduce or block the proper expression of the SDV1 gene in recipient rice.

[0069] Rice varieties exhibiting increased stem wall thickness at the basal internodes, among which...

[0070] The proteins expressed by the SDV1 gene are either A1), A2), or A3):

[0071] A1) Proteins expressed by the SDV1 gene;

[0072] A2) A protein derived from rice that has more than 90% similarity to the protein described in A1) and has the same function;

[0073] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0074] The technical problem this invention aims to solve is to provide a novel rice semi-dwarf gene SDV1 and its encoded protein. Knocking out or inactivating this gene using CRISPR / Cas9 editing technology and other methods can moderately reduce the plant height of rice and other crops while significantly increasing lodging resistance, thereby maintaining crop yield stability. Therefore, this gene has clear application potential in the field of breeding.

[0075] By combining EMS mutagenesis with precise phenotypic identification, this application created mutants (sdv1-1 and sdv1-2) that slightly dwarfed plant height in the sd1 background; using genetic and molecular biology techniques, the "fine-tuning gene" SDV1, which can slightly dwarf plant height in the sd1 background, was cloned; through genetic techniques such as gene editing, it was confirmed that inactivation of this gene (sdv1-3 and sdv1-4) can reduce plant height and significantly increase lodging resistance.

[0076] This application screened a mutant that finely modulates rice plant height and successfully cloned the gene. After knocking out the gene in the japonica rice ZH11 material using CRISPR / Cas9 technology, the rice plant height was significantly reduced and the lodging resistance was significantly enhanced, but the yield was not significantly affected.

[0077] Another aspect of this application relates to a gene SDV1 or protein SDV1 that regulates rice plant height.

[0078] Another aspect of this application relates to the inactivation and downregulation of the gene SDV1 or protein SDV1 in various forms, including possible forms such as knockout, RNAi, and natural variants.

[0079] This application also relates to the SDV1 gene or the SDV1 protein inactivation mutant sdv1 in various backgrounds such as indica and japonica rice.

[0080] Another aspect of this application relates to the application of gene SDV1 or protein SDV1 or materials related to the regulation of gene SDV1 or protein SDV1 in regulating rice plant height and lodging resistance.

[0081] This application, on the other hand, relates to plasmids, strains or plants containing any of the above-mentioned variants of the gene SDV1 or protein SDV1, and their use in regulating plant height or lodging resistance.

[0082] In this application, plants with the SDV1 gene can be obtained by gene editing, thereby interfering with the plant phenotype by regulating the plant protein SDV1. Alternatively, regenerated hybrid plants can be obtained by somatic cell hybridization to regulate the plant protein SDV1.

[0083] This application, in another aspect, relates to an SDV1 gene variant. Preferably, the SDV1 gene variant contains at least one mutation in the SDV1 gene.

[0084] This application, in another aspect, relates to the application of the SDV1 gene in improving plant lodging resistance. Preferably, plants containing SDV1 gene variants are obtained through hybridization and transfer to plants with other genetic backgrounds. Preferably, rice plants obtained by transferring SDV1 gene variants into plants with other genetic backgrounds through hybridization and transfer can improve rice lodging resistance.

[0085] Another aspect of this application relates to a non-viable or non-renewable plant product. The plant product comprises a recombinant DNA vector, cell, or strain containing the gene SDV1, which regulates plant height.

[0086] Another aspect of this application relates to a non-viable or non-renewable plant product. The plant product comprises: a DNA recombinant vector, cell, or strain containing the gene SDV1 that regulates plant height; and a non-viable or non-renewable portion of a rice plant.

[0087] The beneficial effects of this technical solution are:

[0088] This application discovers a gene that finely adjusts plant height without affecting yield, providing a new gene resource for high and stable yield of rice and for breeding varieties adapted to mechanized and simplified operations. It also provides gene sequences for cloning related genes in other crops using the homologous gene method.

[0089] Meanwhile, the gene cloned in this application provides a basis for further regulation of dwarf rice plant height and provides more genetic resources for rice resistance during field cultivation.

[0090] This application verified the effect of SDV1 on plant growth under different background conditions for japonica and indica rice. The results showed that under different background conditions, SDV1 did not affect rice yield and could dwarf rice and increase lodging resistance. This result also further reduces the difficulty of promoting and applying SDV1 gene mutant plants (or rice carrying SDV1 gene failure). Attached Figure Description

[0091] Figure 1 The phenotypic identification of the d30 mutant includes: A. Comparison of seedling height between wild type and d30 mutant; B. Comparison of mature plant height between wild type and d30 mutant; C. Comparison of internode length between wild type and d30 mutant; D. Comparison of ear size between wild type and d30 mutant; E. Comparison of yield per plant between wild type and d30 mutant.

[0092] Figure 2 A. Cloning of SDV1 gene mutation sites; B. Distribution of SNPs on chromosomes in the d30 mutant pool; C. Schematic diagram of SDV1 protein structure and mutation sites; D. Schematic diagram of SDV1 gene structure.

[0093] Figure 3 The knockout plant type of SDV1 in japonica rice ZH11 material; A. Comparison of whole plant at maturity and plant height statistics of ZH11 and SDV1 knockout mutants; B-D. Comparison of internode length, internode thickness and plant height statistics of ZH11 and SDV1 knockout mutants; E. Plant height statistics of ZH11 and SDV1.

[0094] Figure 4 The following are phenotypic statistics of complementary positive lines in SDV1 knockout mutants: A. SDV1 sequence verification results of knockout mutants and complementary positive lines; B and C. Phenotypic images of knockout mutants and complementary positive lines; D. Statistical graph of agronomic traits of knockout mutants and complementary positive lines.

[0095] Figure 5The evaluation includes: A. Grain length comparison between ZH11 and SDV1 knockout mutants; B. Grain width comparison between ZH11 and SDV1 knockout mutants; C. Grain length, grain width, and thousand-grain weight statistics of ZH11 and SDV1 knockout mutants; D. Ear size comparison between ZH11 and SDV1 knockout mutants; E. Ear length, primary branches, and secondary branches statistics of ZH11 and SDV1 knockout mutants; F. Ear size comparison of ZH11 and SDV1 knockout mutants. Statistics on grain yield, number of grains per ear, and number of tillers; comparison and statistics of yield per plant for G-H ZH11 and SDV1 knockout mutants; I. Lodging situation of ZH11 and SDV1 knockout mutant lines in the field; JI. Representative plants in the figure; K. Comparison of stem wall thickness of basal internodes of ZH11 and SDV1 mutants; L. Statistics on yield per mu of ZH11 and SDV1 under different fertility and planting conditions in the field; M. Comparison of stem wall thickness of basal internodes of ZH11 and SDV1 mutants. Detailed Implementation

[0096] The following is a detailed explanation with reference to the accompanying drawings.

[0097] For those skilled in the art, the specific meaning of the terms used in this invention can be understood according to the specific circumstances. Unless otherwise specified, the experimental procedures described in the following embodiments are conventional procedures. Unless otherwise specified, the reagents and other materials used in the following embodiments are commercially available.

[0098] It should be noted that "plant product" can be any product made from a plant, plant part, plant cell, or plant chromosome or any part or component thereof. "Wild-type" plants include, for example, non-transgenic and non-genome-edited plants, plant seeds, plant parts, and / or plant cells. Meanwhile, the "plant" described in this invention can be an explant, plant part, seedling, plantlet, or a complete plant at any stage of regeneration or development. The "transgenic plant" or "gene-edited plant" described in this invention can refer to a plant whose genome has been altered by integrating or inserting recombinant DNA molecules, recombinant vectors, or sequences.

[0099] The transgenic plants, plant cells, seeds, and plant parts of the present invention may be homozygous or heterozygous for transgenic events or insertions into the transcribed DNA sequence for repressing the SDV1 gene in the genome of at least one plant cell, and the plants, plant cells, seeds, and plant parts of embodiments of the present invention may contain any number of copies of one or more transgenic edits, insertions, and / or edits.

[0100] In this invention, genetic technologies such as gene editing can be performed using screening and selection methods known to those skilled in the art of molecular biology. Examples of screening and selection methods include, but are not limited to, Southern blotting, PCR amplification for detecting polynucleotides, Northern blotting, RNase protection, primer extension, RT-PCR amplification for detecting RNA transcripts, Sanger sequencing, next-generation sequencing, enzymatic assays for detecting the activity of enzymes or ribozymes in peptides and polynucleotides, and protein gel electrophoresis, Western blotting, immunoprecipitation, and enzyme-linked immunosorbent assays for detecting peptides. Other techniques such as in situ hybridization, enzyme staining, and immunostaining can also be used to detect the presence or expression of peptides and / or polynucleotides.

[0101] For a long time, due to the difficulty of phenotypic research, genetic studies on rice plant height have mostly focused on dwarf mutants with drastic variations in plant height. Although many genes have been cloned, overall, these mutants exhibit excessive variations in plant height, severely impacting yield and making them difficult to utilize in practical breeding.

[0102] The specific experimental methods designed in this application are as follows:

[0103] 1. Creation of mutant materials

[0104] Numerous mutants were obtained by EMS mutagenesis of indica rice variety 9311 (wild type, WT), and a semi-dwarf mutant material d30 was screened from this mutant library. All rice materials were planted at the Sichuan Agricultural University experimental base in Wenjiang District, Chengdu, Sichuan Province, and the Nanfan base in Lingshui Li Autonomous County, Hainan Province, and were all under routine management.

[0105] EMS chemical mutagenesis method: Indica rice 9311 seeds were immersed in ethyl methanesulfonate at a concentration of 0.05-0.5M for about half an hour. After that, the seeds were germinated, raised into seedlings, and transplanted to the field. After multiple generations of self-pollination, the mutant sdv1 was finally screened out.

[0106] 2. Analysis of the semi-dwarf phenotype of the mutant

[0107] The mutant seedlings are slightly shorter than the wild type. Figure 1 A), its mature plant height is about 20cm shorter than the wild type, exhibiting a semi-dwarf appearance. Figure 1 B). The lengths of internodes at maturity of this mutant were measured, and the results showed that all internodes in this mutant were significantly shorter than those in the wild type. Figure 1 C). After grain filling and maturity, the grain shape and weight of the d30 mutant did not change significantly, but the ear was significantly smaller than that of the wild type, and its single ear weight was also significantly lower than that of the wild type. Figure 1 D), which leads to a decrease in yield per plant. Figure 1 E). For example Figure 1The bar chart shown in B indicates that the mature wild-type plant height is 110cm, while the mature mutant plant height is 80cm.

[0108] 3. Candidate gene localization cloning

[0109] Crossing the wild-type and the d30 mutant resulted in F1 generation plants that were comparable to the wild-type. Phenotypic analysis of the F2 generation revealed that the ratio of plants with normal height to those exhibiting semi-dwarfism was approximately 3:1 (143:57; χ²). 2 =0.6252<3.84). These results indicate that d30 is a recessive semi-dwarf mutant.

[0110] Using MutMap technology, this application performed pooled sequencing on 50 semi-dwarf phenotype plants from the F2 population and compared them with the wild type. Linkage analysis of the SNP index distribution revealed an SNP site (A>G) at position 2606 of the gene LOC_Os11g12620 on chromosome 11 (Oryza sativa), which is completely linked to the semi-dwarf phenotype. Figure 2 A). The full-length sequence of the gene is shown in SEQ ID NO.2 in Table 1. The CDS sequence of the gene is shown in SEQ ID NO.3 in Table 1. The amino acid sequence encoded by the gene is shown in SEQ ID NO.1. Bioinformatics analysis shows that the protein encoded by this gene belongs to the leucine-rich repeats receptor-like kinases (LRR-RLKs) subfamily. Its N-terminus contains multiple LRRs, and its C-terminus is a kinase domain. Between the LRRs and the kinase domain is a transmembrane domain (TM). Figure 2 C). The first exon sequence of this gene is shown in SEQ ID NO.4 in Table 1. The first exon of this gene contains LRRs, a transmembrane domain, and a kinase domain.

[0111] The d30-1 mutation alters a potential ATP-binding site on the protein kinase domain, indicating that the d30 mutation impairs the kinase activity of this protein. Figure 2 C). Meanwhile, this application screened a semi-dwarf mutant (d30-2) with the d30-1 allele in another indica rice (R600) background EMS mutagenesis mutant library. Figure 2 B). Gene localization cloning showed that the d30-2 mutation resulted in a substitution of one amino acid at the potential kinase active site of this protein, indicating that the d30-2 mutation affected the normal kinase activity of this protein. Figure 2C). Therefore, it is inferred that this gene is the causal gene of the d30 mutant. Sequence analysis revealed that the mutation site in d30-1 is at base 2513 (AG) of the full-length gene; the mutation site in d30-2 is at base 2856 (AG) of the full-length gene. Both mutation sites are located within the kinase domain. Through the confirmation of these mutation sites and their phenotypes, it can be confirmed that disrupting the function of the kinase domain can effectively silence the expression of the SDV1 gene or the function of the SDV1 protein.

[0112] 4. Creation of SDV1 gene knockout materials

[0113] To further confirm the function of SDV1 in regulating rice plant height, this application utilized CRISPR / Cas9 gene editing technology to knock out its gene in the japonica rice variety Zhonghua 11 (ZH11), a heavy-panicle type. PCR identification of the target site showed that the transgenic positive lines all exhibited a semi-dwarf phenotype (all lines were in a stable state). Figure 3 A) The length of each internode of the main stem is significantly shorter than that of the wild type. Figure 3 B. Figure 3 C). Interestingly, this application found that the stem wall thickness of the basal internodes in the knockout lines was significantly thicker than that of the wild type. Figure 3 D). This application crossed knockout plants of different genotypes with the parent ZH11 and analyzed the phenotypes and genotypes of their F1 and F2 offspring. The results showed that heterozygous (Ht) plants exhibited plant height similar to the parent ZH11, while homozygous knockout offspring showed significant semi-dwarfism. After years of investigation and verification, the dwarf phenotype and gene knockout co-segregated. Figure 3 As shown in Figure E, the wild-type plant height was 105 cm; the knockout lines, which underwent large-effect editing at the target site (insertion of base A, deletion of base AG, and deletion of base CAAGA), resulting in gene inactivation, had a plant height of approximately 90 cm. These results confirm that the semi-dwarf phenotype is indeed caused by SDV1 inactivation. The target location corresponds to a sequence on the LRR protein domain. Through the confirmation of these three knockout sites and their phenotypes, it can be confirmed that disrupting the function of the LRR protein domain can effectively silence SDV1 gene expression or SDV1 protein function.

[0114] 5. Complementary functions of sdv1

[0115] To further clarify the function of SDV1, the full-length SDV1 genome plus the promoter (first 3.3 kb of the ATG) was transferred into the knockout mutant ko-1 to obtain genetically complementary plants. The results showed that the plant height of the complementary positive plants was restored to normal. Figure 4 (A, B) The size of the spikelets is almost identical to that of the wild type and the mutant. Figure 4C), and statistically, there were no significant differences between the wild type and the wild type in agronomic traits such as tiller number, primary branches, secondary branches, and seed setting rate. Figure 4 D). The above results consistently demonstrate that SDV1 is indeed an important gene regulating rice plant height.

[0116] 6. Evaluation of yield and lodging resistance of SDV1 knockout mutant

[0117] To further evaluate the impact of the SDV1 mutation on yield under different background conditions, this application investigated the main yield traits of the ZH11 knockout line. Consistent with d30, the grain shape and grain weight of the knockout line showed no significant changes compared to the control. Figure 5 A~ Figure 5 C). Furthermore, this application found that in the ZH11 genetic background, inactivation of SDV1 does not lead to smaller panicles (C). Figure 5 D、 Figure 5 E), its main yield components, such as seed setting rate, number of filled grains per ear, and number of tillers, were comparable to the control. Figure 5 F). For example Figure 5 As shown in H, the yield per plant of ZH11 was 30g, while the yield per plant of the knockout plant was 32g, and the yield per plant was not significantly different from that of ZH11. Figure 5 G, Figure 5 The above results indicate that different alleles of SDV1 or different genetic backgrounds have different effects on yield, and mutations in this gene do not necessarily lead to a decrease in yield.

[0118] In production practice, this application found that ZH11, due to its heavy ear weight, experienced lodging when planted in the Chengdu Plain. Therefore, the lodging resistance of the SDV1 knockout mutant was observed. The results showed that in the natural field environment of Wenjiang, Chengdu, wild-type ZH11 experienced severe lodging in the summer of 2020–2023 (with 2–3 severe storms and heavy rains during the maturity period), while SDV1 knockout mutants planted during the same period and of the same size did not show any lodging. Figure 5 I, Figure 5 J、 Figure 5 L), and the stem wall thickness of the basal internodes of the knockout strains was significantly greater than that of the wild type ( Figure 5 K, Figure 5 The presence of M indicates a significant enhancement in its lodging resistance. Considering that its yield is not significantly different from ZH11, this application suggests that sdv1 has considerable application value in dwarfing and lodging resistance.

[0119] The sequence is shown in Table 1.

[0120] Table 1

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128] It should be noted that the specific embodiments described above are exemplary. Those skilled in the art can devise various solutions inspired by the disclosure of this invention, and these solutions all fall within the scope of this invention and its protection. Those skilled in the art should understand that this specification and its accompanying drawings are illustrative and do not constitute a limitation on the claims. The scope of protection of this invention is defined by the claims and their equivalents. This specification contains multiple inventive concepts; phrases such as "preferredly" and "according to a preferred embodiment" indicate that the corresponding paragraph discloses an independent concept. The applicant reserves the right to file divisional applications based on each inventive concept. Throughout the text, the feature introduced by "preferredly" is only an optional mode and should not be construed as mandatory. Therefore, the applicant reserves the right to abandon or delete relevant preferred features at any time.

Claims

1. The application of downregulating the expression level of the SDV1 gene in rice, or downregulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice in increasing the stem wall thickness of the basal internodes of rice, characterized in that, The protein SDV1 sequence is the amino acid sequence shown in SEQ ID NO.

1.

2. The application of downregulating the expression level of the SDV1 gene in rice, or downregulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice in shortening the length of rice stem nodes, characterized in that... The protein SDV1 sequence is the amino acid sequence shown in SEQ ID NO.

1.

3. A method for improving lodging resistance in rice, comprising the following steps: Downregulate the expression level of the SDV1 gene in rice. Or it could downregulate the expression level of the protein encoded by the SDV1 gene in rice. Or it may reduce the activity of the protein encoded by the SDV1 gene in rice; in, The nucleotide sequence of the SDV1 gene is shown in SEQ ID NO.2 or SEQ ID NO.

3.

4. The method according to claim 3, characterized in that, Methods for downregulating the expression level of the SDV1 gene in rice, downregulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice include: Gene knockout, RNA interference, physicochemical mutagenesis, and natural mutation can produce variations in the SDV1 gene or promoter region, resulting in downregulation of SDV1 expression, decreased abundance of SDV1 protein, or reduced activity of SDV1 protein.

5. The method according to claim 3, characterized in that, Methods for downregulating the expression level of the SDV1 gene in rice, downregulating the expression level of the protein encoded by the SDV1 gene in rice, or reducing the activity of the protein encoded by the SDV1 gene in rice include: The SDV1 gene or expression constructs / vectors containing SDV1 gene fragments are transferred into rice to construct downregulated or inactivated mutants of SDV1. Rice was subjected to physicochemical mutagenesis to screen for mutants of the SDV1 gene.

Citation Information

Patent Citations

  • OsNramp5 mutant as well as related products and application thereof

    CN117447567A

  • Rice SDR1 gene as well as encoding protein and application thereof

    CN119162198A

  • Genes and uses for plant improvement

    US20080295196A1

  • Transgenic plants with enhanced agronomic traits

    US20110265221A1